A549 and H460 lung carcinoma cell lines were obtained from the Kunming Institute of Zoology, Chinese Academy of Sciences, and cultured in high glucose Dulbecco's modified Eagle's medium (DMEM; GE Healthcare) containing 10% fetal bovine serum (FBS, EMD Millipore) and 1% penicillin-streptomycin (EMD Millipore) in a 37°C incubator with 5% CO₂ (Thermo Fisher Scientific, Inc.). Cells were grown to 70% confluence prior to use for subsequent experiments.

GA-13315 (purity >95%, measured by proton nuclear magnetic resonance spectroscopy) was prepared by the School of Chemical Science and Technology at Yunnan University (Kunming, China). Cell proliferation, with or without GA-13315 treatment, was measured using a Cell Counting Kit-8 (CCK-8) assay kit (BD Biosciences). Briefly, cells were seeded into 96-well plates at 2,000 cells/plate, incubated overnight and treated with various doses (4, 8, 16 and 32 ng/µl) of GA-13315 or the vehicle control for 48 h. Then, 10 µl CCK8 solution was added to each well and cells were incubated for an additional 2.5 h. Optical density was measured by a microplate reader (Thermo Fisher Scientific, Inc.) at a wavelength of 450 nm.

In total, 2 ml A549 cells (2×10⁵ cells/ml) were plated into a 6-well plate in triplicate. A total of 3 wells were treated with 16 ng/µl GA-13315 (treated), and the other 3 wells treated with control vehicle (dimethyl sulfoxide; DMSO) at 37°C for 48 h. RNA was extracted with a RNeasy kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. RNA libraries were prepared using an Illumina NEB Next Ultra RNA Library Prep Kit (New England Biolabs, Inc.; cat. no. E7530). Briefly, replicates of 5 µg total RNA were sheared into fragments (200 nt) and reverse transcribed into cDNA, which were then blunt-ended and phosphorylated followed by the addition of single 3′ adenosine moiety and ligated with Illumina adapters. Libraries were amplified by polymerase chain reaction (PCR) using a NEB Phusion Polymerase (New England Biolabs, Inc.) followed by purification. The thermocycling conditions were as follows: Initial denaturation at 98°C for 30 sec; followed by 13 cycles of 98°C for 10 sec, 65°C for 30 sec, 72°C for 30 sec and by a final extension step at 65°C for 5 min. The primers used to amplify the libraries were the following: Forward primer, 5′-AATGATACGGCGACCACCGA-3′; and reverse primer, 5′-CAAGCAGAAGACGGCATACGA-3′. RNA-Seq was conducted using paired-end, 100 base pair reads by HiSeq 2500 v4 100PE (Illumina, Inc.).

Subsequent to filtering out the low quality reads, the remaining reads were aligned to the reference genome hg19 using TopHat2 software (v2.0.8: http://tophat.cbcb.umd.edu/) with default parameters (15). Fragments per kilobase of exon model per million fragments mapped was used to quantify the expression of each gene. Differentially expressed genes were identified using Cuffdiff software (v2.1.0: http://cole-trapnell-lab.github.io/cufflinks/) by comparing the GA-13315 treated group to the control vehicle treated group. Genes that passed the |log2 fold change (FC)|>1.5 and P<0.05 thresholds were considered to be significant DEGs (16). Pathway analysis was performed using Ingenuity Pathway Analysis tools (version 2018; Qiagen Bioinformatics).

A549 or H460 cells were plated in triplicate into a 6-well plate. A total of 3 wells of cells were treated with 16 ng/µl GA-13315 (Treated) and the other three wells of cells treated with control vehicle (DMSO) at 37°C for 48 h. RNA was extracted with RNeasy kit (Invitrogen; Thermo Fisher Scientific, Inc.). Equal amounts of cDNA were synthesized using the Advantage RT-for-PCR kit (Clontech, Mountain View, CA). Briefly, the samples were mixed with random primers and incubated at 65°C for 5 min and then on ice for at least 1 min. Reverse transcriptase was added to each tube, mix and incubate at 25°C for 10 min and then 42°C for 50 min, heat inactivated at 70°C for 15 min, and then kept on ice. A total of 1 ul RNase H was added and the samples were incubated at 37°C for 20 min. The 1st strand cDNA was stored at-20°C until use for qPCR.

qPCR was performed using Power SYBR-Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). All qPCR performed using SYBR Green was conducted at 50°C for 2 min and 95°C for 10 min, and then 40 cycles of 95°C for 15 sec and 60°C for 1 min. The specificity of the reaction was verified by melt curve analysis. GAPDH was used an internal control and all data were normalized to GAPDH. Control groups for the TRIM67 siRNA transfection and TRIM67 plasmid assays used negative control siRNA and control empty vectors, respectively. The relative gene expression was calculated using 2^−ΔΔCq quantification method (17). The primers used are summarized in Table SI.

A set of siRNAs targeting TRIM67 (5′-GTACCATCGACGGTCTTCA-3′; 5′-CCTCGTTGCTCAGTGTGAT-3′; 5′-GCGGAGTTTGATCTGACTT-3′; Shanghai GenePharma Co., Ltd.) targeting TRIM67 or fluorescein amidite-labeled control siRNA (5′-TAAGGCTATGAAGAGATAC-3′; cat. no., A07001; Shanghai GenePharma Co., Ltd.) was dissolved in ddH₂O to a final concentration of 0.05 nmol/l, aliquoted and stored at −20°C. Cells in the logarithmic growth phase were plated into 6-well plates at 1×10⁵ cells per well. When the cells reached 60–70% density, transfection with 10 nM siRNA was performed using Lipofectamine (Invitrogen; Thermo Fisher Scientific, Inc.) according to the protocol of the manufacturer. The transfection efficiency of control siRNA was visually inspected under a fluorescence microscope (magnification, ×200). Culture medium (90% DMEM + 10% FBS) was replaced 6 h after transfection. A total of 48 h after transfection, cells were harvested and RNA or protein was extracted for analysis.

For the gene overexpression assays, whole-length TRIM67 was synthesized and inserted into pcDNA3.1 expression vector (GenScript). An empty vector was used as a control. When the cells were at 60–70% confluence, gene transfection (1 µg plasmid) was performed using Lipofectamine, as aforementioned. Transfection efficiency was evaluated through visual inspection under a fluorescence microscope (magnification, ×200) by transfecting 1 µg expression vector (pEGFP-N1; Clontech Laboratories, Inc.) containing green fluorescent protein. A total of 48 h after transfection, cells were harvested and RNA or protein was extracted for analysis. The transfection efficiency of knockdown or overexpression was additionally quantified by measuring the density of the band of western blot analysis using ImageJ software (v1.8.0; National Institutes of Health) (Fig. S1).

Cells were transfected and GA-13315 (16 ng/µl) was added 24 h after transfection. At 48 h after transfection, cells were harvested for the apoptosis assay with FITC Annexin V Apoptosis Detection Kit I (BD Biosciences). Briefly, adherent cells were trypsinized, transferred to an Eppendorf tube and collected via centrifugation for 10 min at 4°C at 300 × g. Cell pellets were washed twice with pre-cooled PBS and rinsed once with 1X binding buffer (10X; double vapor dilution). Cells were additionally suspended in PBS to a concentration of 1×10⁶/ml, following which 100 µl cell suspensions (1×10⁵) were transferred to centrifuge tubes, mixed with 5 µl fluorescein isothiocyanate-Annexin V and 10 µl propidium iodide, and incubated for 15 min at room temperature in the dark. Then, 400 µl 1X binding buffer was added to the cells 1 h prior to flow cytometry. The data were analyzed using FlowJo software (version 10; BD Biosciences). To investigate the role of NF-κB pathway in GA-13315 induced apoptosis, A549 cells (2×10⁵ cells/ml; 2 ml) were plated into a 6-well plate in triplicate and incubated in a cell culture incubator at 37°C and 5% CO₂. After 24 h, cells were treated with control vehicle, GA-13315 (16 ng/µl), and GA-13315 plus 500 µM NF-κB essential modulator-binding domain (NBD; ABclonal, Inc.) for 48 h. Cells were subsequently harvested to measure the level of apoptosis.

Total protein from the A549 cells was extracted using radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology) and quantified using a BCA Protein Assay kit (Beyotime Institute of Biotechnology). Equal amounts of proteins (15 µg) were separated via 10% SDS-PAGE and transferred onto a 0.45 µm polyvinylidene difluoride (PVDF) membrane (EMD Millipore) through a wet trans-blot system (Bio-Rad Laboratories, Inc.). The membranes were then blocked for 1 h at room temperature in 5% nonfat dried milk diluted in TBST (Bio-Rad Laboratories, Inc.), incubated overnight at 4°C with rabbit polyclonal antibodies against TRIM67 (1:250; cat. no., PA5-42274; Thermo Fisher Scientific, Inc.), Fas (1:1,000; cat. no., ab82419; Abcam), or NF-κB2 (1:2,000; cat. no., 37359; Cell Signaling Technology), and then with a goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:3,000; cat. no., 12-348; Sigma-Aldrich; Merck KGaA) for 1 h at room temperature, and analyzed using an enhanced chemiluminescence (ECL) detection kit (Applygen Technologies, Inc.). β-actin (1:2,000; cat. no. ab8227; Abcam) was used as the internal control. The density of the bands was analyzed using ImageJ software (v1.8.0; National Institutes of Health).

Wild type FAS promoter (−1,025 to +25 bp) or mutant (without NF-κB binding sites) was synthesized and inserted into a pGL3-Basic vector (GeneScript). A FAS promoter activity assay was performed using a dual luciferase reporter system (Promega Corporation), according to the manufacturer's protocol. Briefly, 10,000 cells in 0.5 ml DMEM culture medium (GE Healthcare) were seeded into 24-well plates and incubated at 37°C until the cells had attached. Each well was co-transfected with 200 ng luciferase plasmids (pGL3-Basic plasmids without the promotor region as the negative control or plasmids containing FAS promoter with/without NF-κB binding sites) and 5 ng pRL-TK plasmids (Promega Corporation) encoding Renilla, which was used as the internal control to assess transfection efficiency. At 24 h after transfection, whole-cell lysates were collected and measured using a GloMax Microplate Luminometer (Promega Corporation). Transfections were performed in triplicate and then repeated 3 times to assure reproducibility. All luciferase reads were normalized to the corresponding Renilla value. Relative luciferase activity was calculated using the following formula: Relative luciferase levels = Luc-promoter/Luc-pGL3 basic.

A ChIP assay was performed with a ChIP-IT kit (cat. no. 53040; Active Motif). A total of 1×10⁷ cells were cross-linked and lysed. Chromatin was extracted and sonicated to 200–800 bp length fragments with 8 rounds of 10 sec pulses using 25% power. Normalized inputs of sheared chromatin DNA were incubated with 3 µg negative control immunoglobulin G (1:30; cat. no. ab171870; Abcam) or a p52 antibody (1:30; cat. no. ab7972; Abcam) overnight at 4°C. The immunocomplex was treated with RNase A to remove RNA and incubated at 65°C for 4 h to remove cross-links. Proteins were removed by treating with proteinase K, and DNA was purified and subjected to PCR detection following the aforementioned protocol. Primers targeting the FAS promoter (forward, CTCCATTCTCCTTCAAGACCT; reverse, GTGTGTCACTCTTGCGCGAGAT) were used to evaluate the binding of the p52 antibody.

Data were analyzed by SPSS 19.0 software (SPSS Inc.). and are presented as the mean ± standard deviation. Student's t-tests were performed to evaluate the significance of difference between two groups. Differences between multiple groups were analyzed using analysis of variance followed by Tukey's honestly significant difference post-hoc test was used to evaluate the differences between groups. P<0.05 was considered to indicate a statistically significant difference.

A cell viability assay indicated that GA-13315 caused ~50% A549 cell death at a concentration of 16 ng/µl (Fig. 1A). Therefore, this concentration was selected for subsequent experiments. Upon GA-13315 treatment, a total of 250 genes were identified to be significantly differentially expressed (FC≥1.5; P<0.05), of which 94 genes were upregulated and 156 genes were downregulated (Fig. 1B). A detailed list is presented in Table SII. The TRIM67, NFKB2 and FAS genes were selected for subsequent investigation as they were enriched in pathway analysis. In total, seven genes were randomly selected for qPCR verification. The expression levels of these 10 genes were additionally confirmed using qPCR, including TRIM67 (3.1), F-box protein 15 (2.5), NF-κB2 (2.4), Fas cell surface death receptor (3.2), baculoviral IAP repeat containing 3 (1.9), pyruvate dehydrogenase kinase 1 (−2), cyclin dependent kinase inhibitor 2D (−2.1), Fos proto-oncogene, AP-1 transcription factor subunit (−3), JunB proto-oncogene, AP-1 transcription factor subunit (−2.1) and BAF chromatin remodeling complex subunit BCL11B (−3.2) (Fig. 1C). TRIM67 has been demonstrated to be downregulated in NSCLC cancer cell lines (11), and pathway analysis from the present study indicated that NF-κB and FAS pathways were involved in this process (Fig. S2). Therefore, the protein levels of TRIM67, FAS and NF-κB2 were also examined, and it was identified that all 3 were increased (Fig. 1D), thereby confirming the qPCR results.

To investigate the association between TRIM67 and GA-13315-induced apoptosis, TRIM67 expression was silenced using siRNA and the levels of apoptosis were assessed using Annexin V staining and cleaved caspase-3. Annexin V staining indicated that silencing TRIM67 decreased the GA-13315-induced apoptosis rate from 50 to 15% in A549 cells (P<0.001) and from 35 to 12% in H460 cells (P<0.001; Fig. 2A). Exemplary images of flow cytometry are presented in Fig. S3. This observation was additionally confirmed by western blot analysis, which indicated that the silencing of TRIM67 decreased the levels of GA-13315-induced cleaved caspase-3 in both cell lines examined (Fig. 2B). Therefore, these results suggested a role for TRIM67 in mediating GA-13315-induced apoptosis.

Pathway analysis indicated that the NF-κB complex was enhanced in GA-13315-treated cells. As NF-κB2 is a precursor protein that requires additional processing to convert into its active forms (18), and TRIM67 belongs to the TRIM family and possesses ubiquitin E3 ligase activity (19), whether TRIM67 affected NF-κB2 processing was examined. Forced overexpression of TRIM67 increased p52 but decreased the levels of NF-κB2 precursor p100 (Fig. 3A), while knockdown of TRIM67 increased p100 levels but decreased p52 levels (Fig. 3B), suggesting that TRIM67 promoted NF-κB2 processing. The results from the qPCR analysis indicated that the alteration of TRIM67 had no effect on the NF-κB2 mRNA level (Fig. 3C and D), suggesting that TRIM67 regulates NF-κB2 at the protein level.

Whether the NF-κB pathway is involved in GA-13315-induced FAS upregulation and apoptosis was then investigated. An NF-κB essential NBD peptide was used to inhibit the NF-κB pathway, and it was identified that it suppressed the GA-13315-induced cell apoptosis rate, decreasing it from 35 to 12% in A549 cells (P<0.001) and from 32 to 11% in H460 cells (Fig. 4A). The anti-apoptotic effects of NBD peptide on GA-13315-induced cell apoptosis were additionally confirmed by western blot analysis on cleaved caspase-3 (Fig. 4B). Both RNA and protein levels of FAS were decreased, suggesting that GA-13315-induced apoptosis involved NF-κB-induced FAS (Fig. 4B and C). The effect of NBD peptide on TRIM67 and NFBK2 were also examined; the results indicated that neither mRNA nor protein levels were changed (Fig. 4B and C).

There is an NF-κB binding motif on the FAS promoter. A ChIP assay was used to investigate whether GA-13315 promoted NF-κB binding to the FAS promoter. As indicated in Fig. 4D, the binding of NF-κB to the FAS promoter was increased. A luciferase reporter assay was also used to determine whether GA-13315 activated FAS through NF-κB. Luciferase reporter plasmids containing the FAS promoter with or without NF-κB binding site were used. The results indicated that the FAS promoter activity was increased by 45-fold in A549 cells and 25-fold in H460 cells upon GA-13315 treatment. Treatment with the NF-κB inhibitor NDB peptide decreased the induction to 15-fold. Deletion of NF-κB binding site also markedly decreased the luciferase activity (Fig. 4E), confirming the critical role of NF-κB in mediating GA-13315-induced FAS. Similar results were observed in the lung cancer H460 cells. Colelctively, the present study suggested that GA-13315 induced apoptosis via TRIM67, NF-κB2 and FAS. In addition, TRIM67 promoted the NF-κB pathway and enhanced FAS expression (Fig. 5).