Human cervical cancer cell lines (CaSki, C33A, HeLa and SiHa) were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). C33A, HeLa and SiHa cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM; Sigma-Aldrich, St. Louis, MO, USA), and CaSki was cultured in RPMI-1640 (Sigma-Aldrich), supplemented with 10% heat-inactivated fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA). All cell lines were maintained at 37°C in a humidified 5% CO₂ incubator.

The human specimens (n=107) were collected from patients at the Second Affiliated Hospital of Xi'an Jiaotong University from 2010 to 2015. Of the 107 samples 43 were normal cervical (NC) tissues and 64 were squamous cervical cancer (SCC) tissues. All of the procedures followed approved medical ethics practices. None of the patients had received chemotherapy, immunotherapy or radiotherapy before specimen collection. The histological classifications and clinical staging were done in accordance with the International Federation of Gynecology and Obstetrics classification system.

Formalin-fixed, paraffin-embedded tissue sections were analyzed in an immunohistochemical study. After being placed in a 60°C incubator overnight, four micrometer-thick sections were deparaffinized with xylene and rehydrated in a series of ethanols. Then the sections were incubated in heat-induced epitope retrieval in citric acid buffer (pH 7.0) for 2 min. Endogenous peroxidase was blocked at room temperature using 3% hydrogen peroxide in methanol for 10 min. Then slides were incubated with mouse monoclonal anti-RAD51 (1:100; Bioscience, Boston, MA, USA) at 4°C overnight, followed with inclubation of goat anti-mouse immunoglobulin at room temperature for 30 min. The slides were counterstained stained with hematoxylin (7). RAD51 immunostaining was presented by a semi-quantitative immunoreactivity score (IRS), which (negative 0–3, weak 4–7, strong 8–12) was evaluated by multiplying the values for staining intensity (scored as 0, no staining; 1, light brown; 2, brown; 3, dark brown) and the values for percentage of positive cells (scored as 0, <10%; 1, 10–25%; 2, 25–50%; 3, 50–75%; 4, >75%) in each sample. An overall score of ≤3 was defined as negative and a score of >3 as positive. All specimens were evaluated by two pathologists in a blinded manner.

The RAD51 inhibitor RI-1 was purchased from Selleck Chemicals (Houston, TX, USA), according to the manufacturer's instructions. RI-1 was dissolved in DMSO at a stock concentration of 1 mM.

Exponentially growing cells were harvested and resuspended in PBS pH 7.4 (Gibco). Then the cells were lysed by lysis buffer mixed with protease inhibitor cocktail (Roche, Mannheim, Germany). The lysate was mixed with Laemmli sample buffer containing 5% 2-mercaptoethanol and boiled for 5 min. Equal amounts of protein extracts were separated on a 10% SDS/PAGE, blotted onto an activated polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA) and blocked in TBST with 5% dried milk. Membranes were probed with anti-RAD51 (1:1000, Bioscience), anti-GAPDH (1:1000, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-cyclin D1 (1:500, Santa Cruz Biotechnology), anti-p21 (1:500, Santa Cruz Biotechnology) at 4°C overnight. Then, they were probed with goat anti-mouse secondary antibodies (Thermo Fisher Scientific, Grand Island, NY, USA) for 1 h.

Cells were seeded in triplicates at a density of 5×10⁴ cells with 2 ml of media into 35-mm tissue culture dishes for 7 days. The numbers of cells were manually counted after harvesting using a hemocyto-meter under light microscopy every two days. Cell viability assays were performed by applying 3-(4,5-dimethylthiazol-yl)-2,5-diphenyl tetrazolium bromide (MTT; Sigma-Aldrich) dye to cells that were seeded in 96-well plates with 800 cells in each well, as described in a standard protocol. Then, the number of live cells was determined by the absorbance at 490 nm (Bio-Rad, Hercules, CA, USA).

To assess the tumorigenicity in vivo, cells (1×10⁷) in the exponential growth phase were collected and were suspended in 200-µl phosphate-buffered saline and then injected subcutaneously into the posterior side of 4- to 6-week-old female BALB/c-nude mice purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). Xenograft tumor volume (V) was calculated using the length (a) and width (b) by V=ab²/2. To study the function of the RAD51 inhibitor RI-1, 5 mg/kg in 200-µl phosphate-buffered saline was injected intraperitoneally every other day into BALB/c nude mice (n=6) when the tumor volume reached 120 mm³. In this analysis, the negative control group (n=6) received saline. The animal experimental protocols were evaluated and approved by the Animal Care and Use Committee of the Medical College of Xi'an Jiaotong University. The mice were sacrificed and tumors were dissected and weighed at the end of the experiment.

Cell cycle analysis was performed using flow cytometry (FACScan; Becton Dickinson, Franklin Lakes, NJ, USA) according to the manufacturer's instructions. Cells were harvested and fixed in 70% ice-cold ethanol overnight at 4°C. Thirty minutes before FACS analysis, the samples were washed with PBS, treated with 1 mg/ml RNase A and then stained with 20 µg/ml propidium iodide (Sigma-Aldrich). Cell cycle distribution was analyzed using a FACSCalibur flow cytometer with Mod-Fit LT software.

Total RNA was extracted from exponentially growing cells with the TRIzol reagent (Invitrogen). Total cDNA was used as a template for PCR amplification. Quantitative real-time PCR was performed using the IQ5 Real-time PCR Detection System (Bio-Rad) in triplicates and the following primers: GAPDH (GCACCGT CAAGGCTGAGAAC and TGGTGAAGACGCCAGTGGA); Cyclin D1 (AAACAGATCATCCGCAAACAC and GTT GGGGCTCCTCAGGTTC) and p21 (GCAGACCAGCATG ACAGATTTC and CGGATTAGGGCTTCCTCTTG). The protocol was 95°C for 30 sec, 40 cycles of 95°C for 5 sec and 60°C for 30 sec, and then a dissociation stage. The results were analyzed via the ∆∆Ct method using GAPDH as the housekeeping gene.

Cells were treated with cisplatin (Sigma-Aldrich; 0–32 nmol/l) for 24 h. In other experiments, the cells were irradiated with doses between 0 and 18 Gy under aerobic conditions, at room temperature, using a ¹³⁷Cs unit at a dose rate of 2.5 Gy/min.

All of the statistical analyses were performed using GraphPad Prism 5.0 software (GraphPad Software, La Jolla, CA, USA). All data are expressed as mean ± standard deviation (SD). Student's t-test was used for comparisons between two groups and one-way or two-way analysis of variance (ANOVA) test was used to analyze statistical differences between groups under different conditions. P<0.05 was considered to indicate a statistically significant difference.

To explore the RAD51 expression levels and its association with normal or neoplastic cervical tissues, we first conducted the immunohistochemistry assay using paraffin-embedded normal cervix and squamous cervical cancer tissues. RAD51 staining was observed in the nuclei of positive cells in different cervical tissues (Fig. 1A). The number of specimens with positive RAD51 staining gradually increased from 13.95% (6/43) in the normal cervical tissues to 73.44% (47/64) in the cervical cancer tissues (Table I and Fig. 1B, P<0.01). IHC score results revealed that the immunoreactivity score (IRS) of RAD51 staining was 1.6 for the normal cervical tissues and 6.8 for the cervical cancer tissues (P<0.01, Fig. 1C).

Next, using western blot assay, we found that RAD51 showed different expression levels in CaSki, C33-A, HeLa and SiHa cells (Fig. 1D). In particular, higher levels of the RAD51 protein appeared in the HeLa and Siha cells.

Having shown that RAD51 expression was increased in cervical cancer progression, the role of RAD51 in cervical cancer was functionally evaluated. We conducted experiments using the RAD51 inhibitor RI-1. We found that RAD51 was almost eliminated using 10 µM RI-1 in HeLa and SiHa cells that expressed higher levels of RAD51 protein by western blotting (Fig. 2A). Next, we tested whether the inhibition of RAD51 activity would suppress cervical cancer cell proliferation. Cell growth curve and MTT assays showed that compared to controls, RI-1 significantly reduced cell growth and viability in HeLa (Fig. 2B and C, P<0.01) and SiHa (Fig. 2D and E, P<0.01). These results demonstrated that RI-1 suppressed the proliferation of cervical cancer cells in vitro.

To investigate whether RI-1 has similar inhibitory effect on tumorigenicity in vivo, female athymic nude mice (6 mice per group) were injected subcutaneously with HeLa and SiHa cells. When tumor formation reached 120 mm³, the volume of tumors was measured every three days, and we intervened with an intraperitoneal injection of RI-1 (5 mg/kg in 200 µl PBS) or normal saline. The net weights of the sacrificed mice were recorded upon termination of the experiment. As shown in Fig. 3A, compared to the negative controls, the RI-1-treated mice exhibited significantly inhibited tumor growth in HeLa cells (P<0.01). The average volume and weight of xenografts of the RI-1-treated groups were markedly reduced (Fig. 3A-C, P<0.01). The results were similar in SiHa cells (Fig. 3D-F, P<0.01). These results indicated that RI-1 suppressed tumor formation of cervical cancer cells in vivo.

To investigate the mechanism of RI-1-mediated suppression of cervical cancer cell proliferation, cell cycle analyses of RI-1-HeLa and SiHa and control cells was performed by fluorescence-activated cell sorting (FACS). The percentage of cells in S phase significantly decreased from 47.25% for HeLa-DMSO cells to 31.56% for HeLa-RI-1 cells (Fig. 4A and B, P<0.05). A similar effect was observed in SiHa-RI-1 cells, which had 20.34% in the S phase compared to 33.12% of control cells (Fig. 4C and D, P<0.05). This result showed that the RAD51 inhibitor RI-1 may arrest the cell cycle transition at the G1/S phase and further suppress the proliferation of cervical cancer cells.

Further experiments showed that the mRNA level of the cell cycle associated protein cyclin D1 was reduced while that of p21 increased after RI-1 treatment in HeLa and SiHa cells (Fig. 4E, P<0.05). The administration of RI-1 for 48 h resulted in a downregulation of cyclin D1 and upregulation of p21 by western blotting (Fig. 4F, P<0.01). Collectively, these results suggested that inhibition of RAD51 blocked the cell cycle transition possibly through interaction with cyclin D1 and p21.

Given the decreased expression and function of RAD51 in cervical cancer cell lines after using RI-1, we investigated whether RI-1 could lead to an increase in tumor cell sensitivity to cisplatin and radiation. We observed that cervical cancer cells, HeLa and SiHa, when treated with RI-1 had significantly reduced survival compared to cells treated with DMSO in response to cisplatin (Fig. 5A and B). In response to radiotherapy, HeLa and SiHa cells treated with RI-1 had also significantly reduced survival compared to cells treated with DMSO (Fig. 5C and D). Thus, we concluded that RI-1 can sensitize cervical cancer cells to chemotherapeutic drugs and radiation.