Open Access

Salvianolic acid B reverses multidrug resistance in HCT‑8/VCR human colorectal cancer cells by increasing ROS levels

  • Authors:
    • Piaoting Guo
    • Songpo Wang
    • Wei Liang
    • Wenjing Wang
    • Huijun Wang
    • Miaomiao Zhao
    • Xiaowei Liu
  • View Affiliations

  • Published online on: December 14, 2016     https://doi.org/10.3892/mmr.2016.6049
  • Pages: 724-730
  • Copyright: © Guo et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Salvianolic acid B (SalB) a water‑soluble phenolic compound, extracted from Salvia miltiorrhiza, has previously been demonstrated to reverse tumor multidrug resistance (MDR), including in colorectal cancer. Reactive oxygen species (ROS) are oxygen radicals generated during aerobic metabolism (superoxide and hydroxyl radicals) and superoxide easily generating free radicals (H2O2). The concept that increased ROS levels can lead to augmented tumor cell‑sensitivity to chemotherapy drugs has become notable. The aim of the present study was to elucidate the role of ROS in mediating the effect of SalB on drug resistance and the correlation with drug resistance‑associated protein, P‑glycoprotein (P‑gp), and apoptosis‑associated proteins, B‑cell lymphoma 2 (Bcl‑2) and Bcl‑2‑associated X (Bax). In the current study, through utilizing the multidrug resistant colorectal cancer cell line, HCT‑8/VCR, it was demonstrate that SalB reversed MDR in HCT‑8/VCR. In addition, SalB significantly increased ROS levels, which may have accelerated the apoptosis of HCT‑8/VCR cells by downregulating Bcl‑2 and increasing Bax protein expression. Furthermore the increased intracellular ROS levels may have inhibited P‑gp expression at the gene and protein levels. In conclusion, the data of the current study demonstrate that SalB reversed MDR in HCT‑8/VCR cells, and the effect is associated with increased ROS levels, which may downregulate P‑gp expression and promote tumor cell apoptosis, which in turn increases the sensitivity of drug‑resistant cells to chemotherapy drugs.

Introduction

Colorectal cancer is a gastrointestinal malignancy, and the third most common cause of cancer and cancer-associated mortality (1). The 5-year survival rate of colorectal cancer patients is 50–55% (2). Chemotherapy is a primary therapeutic strategy for colorectal cancer; however, multidrug resistance (MDR) is a key reason for the failure of this treatment. Identification of effective MDR reversal strategies is therefore required to address this issue.

Reactive oxygen species (ROS), which are primarily produced by mitochondria, have strong reactivity and a short life cycle, and may damage the majority of organelles, including mitochondria. Previously, ROS were considered to be toxic substances that cause cell damage and play an important role in the occurrence and development of tumors. However, in recent years, anti-tumor effects exerted by ROS have been demonstrated. Multiple studies have demonstrated that long-term administration of a drug may reduce intracellular ROS levels and convert sensitive tumor cells into drug-resistant cells (3). ROS concentrations moderately greater than physiological levels downregulate P-glycoprotein (P-gp) expression and increase tumor cell sensitivity to chemotherapy drugs (4). In addition, ROS induce apoptosis of tumor cells via various pathways, increasing their chemotherapeutic sensitivity (5,6).

The B-cell lymphoma 2 (Bcl-2) family is critical in the mitochondrial apoptotic pathway; Bcl-2 (anti-apoptotic) and Bcl-2-associated X (Bax; pro-apoptotic) are important members of this family. The mitochondria-dependent apoptosis pathway is a primary pathway of apoptosis, and mitochondrial membrane potential decline is a feature of early apoptosis (7). Bax translocates from the cytoplasm to mitochondria and associates with the mitochondrial membrane, to promote the opening of the mitochondrial permeability transition pore, which leads to the loss of mitochondrial membrane potential and the destruction of membrane integrity, thereby promoting the release of mitochondrial pro-apoptotic factors and inducing cell apoptosis. The pro-apoptotic effect of Bax may be inhibited by overexpression of Bcl-2. P-gp, an important member of the ABC transporter superfamily, is encoded by the MDR1 gene and functions as an energy-dependent drug efflux pump. P-gp-mediated drug efflux is the classical mechanism underlying MDR. In colorectal cancer, P-gp expression levels and frequencies are high, with up to 96% of cells expressing this molecule (8). A previous study has revealed that P-gp function in MDR colorectal cancer cells is significantly enhanced, and that P-gp serves an important role in the generation and maintenance of colorectal cancer drug resistance (9).

Salvianolic acid B (SalB) is a water-soluble phenolic compound, extracted from Salvia miltiorrhiza. Its role in reversing tumor MDR has attracted increasing attention (10,11). In the present study, SalB was used to treat the MDR colorectal cancer cell line HCT-8/VCR, and explore its effect on drug resistance. The present study aimed to determine the potential mechanism by which SalB reverses MDR in colorectal cancer by assessing its effects on ROS levels, P-gp expression and the levels of apoptosis-associated factors in HCT-8/VCR.

Materials and methods

Drugs and reagents

HCT-8 and HCT-8/VCR, human colorectal cancer sensitive and multidrug resistant cell lines, respectively, were purchased from Gu Haibo Biological Technology Co., Ltd. (Shanghai, China). SalB was obtained from Shanghai Winherb Medical Technology Co., Ltd. (Shanghai, China). Vincristine (VCR) was manufactured by Shenzhen Main Luck Pharmaceuticals Inc. (Shenzhen, China). 5-Fluorouracil (5-FU), cisplatin (CDDP) and N-acetylcysteine (NAC) were purchased from Sigma-Aldrich (Merck Millipore, Darmstadt, Germany). Paclitaxel (Taxol) was from Bristol-Myers Squibb (New York, NY, USA). H2O2 was obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Cell Counting Kit-8 (CCK-8) was manufactured by Dojindo Molecular Technologies, Inc. (Kumamoto, Japan). Bicinchoninic acid (BCA) assay and ROS kits were from Beyotime Institute of Biotechnology (Haimen, China). A rabbit monoclonal antibody against P-gp (catalog no. ab170904) was purchased from Abcam (Cambridge, MA, USA). Rabbit monoclonal antibodies against Bcl-2 (catalog no. 4223), Bax (catalog no. 5023) and GAPDH (catalog no. 2118), and the horseradish peroxidase-conjugated secondary antibody mouse anti-rabbit IgG (catalog no. 5127), were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA).

Cell culture

HCT-8 and HCT-8/VCR cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), 100 µg/ml penicillin and 100 µg/ml streptomycin. VCR (800 ng/ml) was added in the culture medium for HCT-8/VCR cells to maintain drug resistance. Cells were incubated at 37°C in a humid environment containing 5% CO2. The VCR in the medium was removed 1 week before experiments were performed, and cells in the logarithmic phase were used.

Assessment of drug resistance in HCT-8/VCR cells by CCK-8

HCT-8 and HCT-8/VCR cells in the logarithmic phase were seeded at 5×103/ml/well (100 µl) in 96-well plates. Chemotherapy drugs, VCR, 5-FU, CDDP and Taxol, at five different concentrations (0.01, 0.1, 1, 10 and 100 µg/ml), were added following overnight incubation. Three replicates were performed for each condition, and 10 µl CCK-8 was added after 48 h incubation. After 40 min, absorbance was read by using a microplate reader at 450 nm, with a reference wavelength of 650 nm. The following equation was used to calculate growth inhibition: Cell suppression rate (%) = (1-OD in the study group/OD in the control group) × 100. The experiment was repeated 3 times. SPSS 18.0 (SPSS, Inc., Chicago, IL, USA) was employed to calculate the median inhibitory concentration (IC50) of each drug. The cell resistance index was calculated as follows: resistance index (%) = IC50 resistant cells/IC50 parent cells ×100.

Assessment of the cytotoxic effect of SalB on HCT-8/VCR cells by CCK-8

Inhibition rates were calculated as described above. Then, drug concentration and cell inhibition rate were used as ordinates to plot a dose-response curve of SalB for HCT-8/VCR. IC50 and non-toxic dose (IC20) were derived from the curve. The experiment was repeated three times.

Evaluation of reverse index for drug resistance of SalB in HCT-8/VCR by CCK-8

IC50 values for VCR, 5-FU, CDDP and Taxol for HCT-8/VCR cells were calculated as described above. In addition, the IC50 values of their combination with SalB for HCT-8/VCR cells were also calculated. Reverse index for drug resistance was calculated as follows, with the experiment repeated 3 times. Reverse index=IC50 before combination/IC50 after combination.

Detection of ROS levels by flow cytometry (FCM)

HCT-8 and HCT-8/VCR cells in the logarithmic phase were divided into 8 groups: Including HCT-8, HCT-8 + NAC, HCT-8/VCR, HCT-8/VCR + H2O2, HCT-8/VCR + SalB20, HCT-8/VCR + SalB40, HCT-8/VCR + SalB80 and HCT-8/VCR + SalB80 + NAC. The HCT-8/VCR + H2O2 group served as a positive control. Cells were pretreated with the ROS scavenger NAC (5 mM), and the exogenous activator H2O2 (200 µM) for 2 h prior to SalB treatment. Cells were subsequently cultured for 48 h at 37°C with 5% CO2. Dichlorofluorescin diacetate (DCFH-DA; 1 ml) diluted with serum free RPMI-1640 culture medium was added to cells, which were cultured at 37°C for 30 min and washed with PBS three times to remove free DCFH-DA. Then, cells were harvested and resuspended in PBS for FCM analysis using a FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). Untreated cells were used as controls; 10,000 cells were detected in each sample, using average fluorescence intensity to reflect intracellular ROS levels. Data were analyzed using FlowJo software version 10.0.7 (FlowJo, LLC, Ashland, OR). The experiment was repeated three times.

Effect of SalB on HCT-8/VCR apoptosis rate

FCM was performed with cells divided into 6 groups: HCT-8/VCR, HCT-8/VCR + SalB20, HCT-8/VCR + SalB40, HCT-8/VCR + SalB80, HCT-8/VCR + SalB80 + NAC, and HCT-8/VCR + H2O2 groups. They were treated as described above for 48 h at 37°C with 5% CO2. After washing, cells were resuspended in PBS to 1×106 cells/ml. To 100 µl cell suspensions, 5 µl Annexin V-fluorescein isothiocyanate and 5 µl propidium iodide were added. The mixture was gently shaken and incubated at room temperature, and shielded from direct sunlight for 15 min. FCM was performed immediately after washing. The experiment was repeated three times.

Effect of SalB on MDR1 mRNA expression in HCT-8/VCR

HCT-8/VCR cells in the logarithmic phase were divided into 6 groups: HCT-8/VCR, HCT-8/VCR + H2O2, HCT-8/VCR + SalB20, HCT-8/VCR + SalB40, HCT-8/VCR + SalB80 and HCT-8/VCR + SalB80 + NAC. The HCT-8/VCR + H2O2 group served as a positive control. For reverse transcription-quantitative polymerase chain reaction (RT-qPCR), cells were seeded at 5×105/ml. Total RNA was extracted using the RNeasy Extraction kit (catalog no. 9108Q; Takara Biotechnology Co., Ltd., Dalian, China), and 1 µg total RNA was reverse-transcribed to cDNA using a FastQuant RT kit (catalog no. KR106; Tiangen Biotech Co., Ltd., Beijing, China). Thermocycling conditions for RT were as follows: An initial step at 42°C for 15 min followed by 95°C for 3 min. qPCR on the obtained cDNA was performed in triplicate using the SYBR®-Green PCR Master mix (catalog no. FP302; Tiangen Biotech Co., Ltd.), with thermocycling conditions as follows: An initial denaturation step at 95°C for 2 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. The quantitation cycle (Cq) values of each sample were calculated and normalized to GAPDH, which served as an internal control, using the 2−ΔΔCq method (12). The primers used are listed in Table I.

Table I.

Primer sequences.

Table I.

Primer sequences.

PrimerSequence (5′-3′)
MDR1 forward CCACTCCTCCACCTTTGAC
MDR1 reverse ACCCTGTTGCTGTAGCCA
GAPDH forward AAGGTGAAGGTCGGAGTCAAC
GAPDH reverse GGGGTCATTGATGGCAACAATA
Influence of SalB on P-gp, Bcl-2 and Bax protein expression in HCT-8/VCR

The protein expression levels were detected by western blotting. Grouping and treatments were the same as apoptosis analysis. Cytoplasmic and nuclear proteins were extracted using radioimmunoprecipitation assay lysis buffer (catalog no. P0013B; Beyotime Institute of Biotechnology), according to the manufacturer's protocol and protein content was determined using a Bicinchoninic Acid Protein assay kit (catalog no. P0010; Beyotime Institute of Biotechnology). Total protein (30 µg) was resolved by SDS-PAGE. Blocking was performed using 5% bovine serum albumin (BSA) for 2 h at room temperature following membrane transfer. Anti-P-gp, anti-Bcl-2, anti-Bax and anti-GAPDH antibodies [all diluted 1:1,000 with 5% BSA in TBS containing 0.1% Tween-20 (TBST)] were added and incubated overnight at 4°C. Following three washes with TBST, membranes were probed with a horseradish peroxidase-conjugated secondary antibody (1:1,000) for 2 h at 37°C. Membranes were washed three times with TBST, and protein bands were visualized using an Enhanced Chemiluminiscence reagent (catalog no. P0018; Beyotime Institute of Biotechnology). Quantity-One software version 4.6.2 (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used for densitometry. Experiments were repeated three times.

Statistical analysis

Data were analyzed using SPSS 18.0 (SPSS, Inc., Chicago, IL, USA), and presented as the mean ± standard deviation. One-way analysis of variance was used for comparisons among groups with Student-Newman-Keuls-q test used for multiple comparisons between groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Multidrug resistance in HCT-8/VCR cells

CCK-8 assay data (Table II) demonstrated that HCT-8/VCR were resistant to the four chemotherapy drugs (VCR, 5-FU, CDDP and Taxol), with significant differences in the IC50 values of cytotoxicity compared with the sensitive HCT-8 cells (P<0.01).

Table II.

Resistance of HCT-8 and HCT-8/VCR cells to chemotherapy drugs.

Table II.

Resistance of HCT-8 and HCT-8/VCR cells to chemotherapy drugs.

IC50 (µg/ml)

DrugHCT-8HCT-8/VCRResistance index
VCR0.76±0.16 39.09±1.47a51.43
5-FU0.25±0.11 2.22±1.12a8.88
CDDP1.81±0.19 9.06±1.14a5.01
Taxol0.19±0.01 5.34±0.84a28.11

a P<0.01 vs. HCT-8 cells. VCR, vincristine; 5-FU, 5-fluorouracil; CDDP, cisplatin; Taxol, paclitaxel.

Cytotoxicity of SalB in HCT-8/VCR

Cytotoxicity of SalB in HCT-8/VCR was assessed by the CCK-8 method. As demonstrated in Table III, SalB significantly inhibited HCT-8/VCR proliferation in a concentration-dependent manner in a certain concentration range. IC20 and IC50 were 20.79±4.76 µg/ml and 114.79±10.94 µg/ml, respectively. Concentrations ≤IC20 were selected as non-cytotoxic dose to perform drug resistance experiments.

Table III.

Growth inhibitory effects of salvianolic acid B on HCT-8/VCR cells.

Table III.

Growth inhibitory effects of salvianolic acid B on HCT-8/VCR cells.

Concentration (µg/ml)Cell inhibition raten
50094.47±1.423
25066.66±12.343
12526.37±0.373
12.515.17±4.063
1.258.50±1.643
Reverse index of SalB for drug resistance in HCT-8/VCR

As demonstrated in Table IV, CCK-8 data demonstrated that non-cytotoxic SalB doses (20 µg/ml; <IC20) could significantly increase HCT-8/VCR sensitivity to VCR, 5-FU, CDDP and Taxol, further reducing the IC50 of various chemotherapeutics. Therefore, it was inferred that SalB could reverse the MDR of colorectal cancer HCT-8/VCR cells.

Table IV.

IC50 for chemotherapy drugs used in combination with salvianolic acid B in HCT-8/VCR cells.

Table IV.

IC50 for chemotherapy drugs used in combination with salvianolic acid B in HCT-8/VCR cells.

IC50 (µg/ml)
DrugChemotherapy onlyChemotherapy + SalB (20 µg/ml)Reversal index
VCR39.09±1.47 2.76±0.92a14.16
5-FU2.22±1.12 0.26±0.10b8.54
CDDP9.06±1.41 2.05±0.47a4.42
TAXOL5.34±0.84 1.16±0.26a4.60

a P<0.0001

b P<0.01 vs. single medication. VCR, vincristine; 5-FU, fluorouracil; CDDP, cisplatin; Taxol, paclitaxel.

Effect of SalB on intracellular ROS levels

Average fluorescence intensities of intracellular DCFH detected by FCM (Fig. 1) demonstrated that ROS levels were significantly decreased in HCT-8/VCR compared with those in HCT-8. Following HCT-8 cell treatment with the ROS scavenger, NAC (5 mM), and HCT-8/VCR incubation with H2O2 (200 µM) for 2 h, ROS level changes were analyzed by FCM. Notably, NAC significantly reduced ROS levels compared with untreated HCT-8 cells (P<0.01), whereas H2O2 markedly increased ROS compared with untreated HCT-8/VCR cells (P<0.01).

Following treatment with SalB at different concentrations (20, 40 and 80 µg/ml) for 48 h, ROS levels in HCT-8/VCR cells were significantly increased in a concentration-dependent manner. In addition, statistical significance was obtained in cells treated with 80 µg/ml SalB compared with the untreated HCT-8/VCR control group (P<0.01). Pretreatment with NAC (5 mM) significantly decreased intracellular ROS levels in the HCT-8/VCR+SalB 80 group (P<0.01), suggesting that NAC eliminated the increased ROS levels caused by high concentrations of SalB (Fig. 2).

Effect of SalB on HCT-8/VCR apoptosis

As demonstrated in Fig. 3, SalB induced HCT-8/VCR apoptosis in a concentration-dependent manner. In addition, apoptosis rates in cells treated with SalB at 40 and 80 µg/ml (no significant difference between both groups) were significantly higher compared with the untreated control group (P<0.01). HCT-8/VCR apoptosis rates in cells receiving SalB after pretreatment with NAC (5 mM) for 2 h were significantly lower than in the groups treated only with 80 µg/ml SalB (P<0.05).

Effect of SalB on MDR1 levels in HCT-8/VCR

As demonstrated in Fig. 4, Real-Time PCR demonstrated that following SalB low, medium and high-dose treatments for 48 h, MDR1 expression levels were decreased in a dose-dependent manner. Furthermore, there was a statistical decrease in the MDR1 levels following SalB treatment compared with the untreated negative control group (P<0.01) and no difference compared with the HCT-8/VCR + H2O2 positive control group (P>0.05). Pretreatment with NAC partially reversed the high SalB concentration-induced decrease of MDR1 expression (P<0.01).

Effect of SalB on P-gp protein expression in HCT-8/VCR cells

As demonstrated in Figs. 5 and 6, SalB significantly reduced P-gp protein expression in a dose-dependent manner (P<0.01), however, there was no statistical difference between the high SalB concentration (80 µg/ml) and positive control groups (P>0.05). Following pretreatment with NAC and high SalB for 48 h, P-gp expression levels were significantly increased compared with cells administered with high SalB only (P<0.01).

Effect of SalB on Bcl-2 and Bax protein expression levels in HCT-8/VCR

Western blot analysis (Figs. 7 and 8) demonstrated that following treatment with SalB at 20, 40 and 80 µg/ml, Bcl-2 expression levels in HCT-8/VCR cells were decreased compared with the negative control group. Additionally, Bax expression levels were increased by SalB compared with the negative control group. No differences in Bcl-2 and Bax expression levels were observed between the positive control and high SalB concentration group. Following pretreatment with NAC and high SalB, the Bcl-2/Bax ratio was significantly increased compared with cells administered with SalB only. Quantification of the Bcl-2/Bax ratios are presented in Fig. 8.

Discussion

Primary and secondary MDR in colorectal cancer cells is significantly higher than in other cancers, explaining the low efficacy of chemotherapy for colorectal cancer (13). Drug efflux mediated by P-gp is the classic mechanism of MDR. It has been demonstrated that P-gp downregulation or efflux inhibition can increase the sensitivity of resistant cells to chemotherapeutic drugs and reverse MDR in colorectal cancer cells (1418). Drug resistance mediated by anti-apoptosis is also a key MDR mechanism (19). Apoptosis is also considered the intersection of MDR pathways. ROS are oxygen radicals generated during aerobic metabolism [superoxide (O2-) and hydroxyl radicals], with superoxide easily generating free radicals (hydrogen peroxide) (20). It is known that, compared with sensitive cells, antioxidant levels in resistant cells are higher, and ROS levels are lower (2125). Furthermore, increased ROS levels lead to augmented sensitivity of tumor cells to chemotherapy drugs (2629).

HCT-8 (sensitive) and HCT-8/VCR (resistant) colorectal cancer cells were used in the current study. It was initially demonstrated that HCT-8/VCR cells were multidrug resistant, and screened non-toxic SalB doses (≤IC20). Subsequently, SalB at non-toxic doses was combined with VCR, 5-FU, CDDP and Taxol, and was demonstrated that SalB reversed MDR of HCT-8/VCR.

Notably, ROS levels in HCT-8/VCR were lower than those in sensitive HCT-8 cells as demonstrated by FCM, indicating that HCT-8/VCR drug resistance may be associated with low ROS levels, which could be increased by SalB. The current study demonstrated that NAC reversed SalB-induced apoptosis, suggesting that SalB reversed MDR in HCT-8/VCR by increasing ROS levels. Subsequently, the expression levels of apoptosis-associated proteins, and drug resistance-associated P-gp, were assessed. It was observed that changes of intracellular ROS levels may secondarily regulate the expression of Bcl-2, Bax and P-gp, affecting apoptosis and drug resistance.

Therefore, we speculated that SalB might reverse multidrug resistance in colorectal cancer HCT-8/VCR cells through two mechanisms related to increased ROS levels in resistant cells: i) Down-regulated P-gp at the gene and protein levels, which results in increased sensitivity of resistant cells to chemotherapy drugs; ii) reduced anti-apoptosis marker (Bcl-2) expression and increased pro-apoptosis (Bax) marker levels decrease mitochondrial transmembrane potential, promote apoptosis of drug resistant cells and reverse multidrug resistance of colorectal cancer HCT-8/VCR cells. More mechanisms of the colorectal cancer multidrug resistance reversed by SalB and reverse resistant effects in body require further investigation.

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2016. CA Cancer J Clin. 66:7–30. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ and He J: Cancer statistics in China, 2015. CA Cancer J Clin. 66:115–132. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Maiti AK: Genetic determinants of oxidative stress-mediated sensitization of drug-resistant cancer cells. Int J Cancer. 130:1–9. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Dahdouh F, Raane M, Thévenod F and Lee WK: Nickel-induced cell death and survival pathways in cultured renal proximal tubule cells: Roles of reactive oxygen species, ceramide and ABCB1. Arch Toxicol. 88:881–892. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Lo YL and Tu WC: Co-encapsulation of chrysophsin-1 and epirubicin in PEGylated liposomes circumvents multidrug resistance in HeLa cells. Chem Biol Interact. 242:13–23. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Brahimi-Horn MC, Giuliano S, Saland E, Lacas-Gervais S, Sheiko T, Pelletier J, Bourget I, Bost F, Féral C, Boulter E, et al: Knockout of Vdac1 activates hypoxia-inducible factor through reactive oxygen species generation and induces tumor growth by promoting metabolic reprogramming and inflammation. Cancer Metab. 3:82015. View Article : Google Scholar : PubMed/NCBI

7 

Singh KK: Mitochondrial dysfunction is a common phenotype in aging and cancer. Ann N Y Acad Sci. 1019:260–264. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Sinicrope FA, Hart J, Brasitus TA, Michelassi F, Lee JJ and Safa AR: Relationship of P-glycoprotein and carcinombryonic antigen expression in human colon carcinoma to local invasion. DNA ploidy, and disease relapse. Caner. 74:2908–2917. 1994. View Article : Google Scholar

9 

Salphati L, Plise EG and Li G: Expression and activity of the efflux transporters ABCB1, ABCC2 and ABCG2 in the human colorectal carcinoma cell line LS513. Eur J Pharm Sci. 37:463–468. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Wang M, Sun G, Wu P, Chen R, Yao F, Qin M, Luo Y, Sun H, Zhang Q, Dong X and Sun X: Salvianolic Acid B prevents arsenic trioxide-induced cardiotoxicity in vivo and enhances its anticancer activity in vitro. Evid Based Complement Alternat Med. 2013:7594832013.PubMed/NCBI

11 

Zhao Y, Hao Y, Ji H, Fang Y, Guo Y, Sha W, Zhou Y, Pang X, Southerland WM, Califano JA and Gu X: Combination effects of salvianolic acid B with low-dose celecoxib on inhibition of head and neck squamous cell carcinoma growth in vitro and in vivo. Cancer Prev Res (Phila). 3:787–796. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Shen A, Chen H, Chen Y, Lin J, Lin W, Liu L, Sferra TJ and Peng J: Pien Tze Huang Overcomes Multidrug Resistance and Epithelial-Mesenchymal Transition in Human Colorectal Carcinoma Cells via Suppression of TGF-β Pathway. Evid Based Complement Alternat Med. 2014:6794362014. View Article : Google Scholar : PubMed/NCBI

14 

Ravindranath AK, Kaur S, Wernyj RP, Kumaran MN, Miletti-Gonzalez KE, Chan R, Lim E, Madura K and Rodriguez-Rodriguez L: CD44 promotes multi-drug resistance by protecting P-glycoprotein from FBXO21-mediated ubiquitination. Oncotarget. 6:26308–26321. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Katayama K, Noguchi K and Sugimoto Y: FBXO15 regulates P-glycoprotein/ABCB1 expression through the ubiquitin-proteasome pathway in cancer cells. Cancer Sci. 104:694–702. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Sui H, Liu X, Jin BH, Pan SF, Zhou LH, Yu NA, Wu J, Cai JF, Fan ZZ, Zhu HR and Li Q: Zuo Jin Wan, a Traditional Chinese Herbal Formula, Reverses P-gp-Mediated MDR In Vitro and In Vivo. Evid Based Complement Alternat Med. 2013:9570782013. View Article : Google Scholar : PubMed/NCBI

17 

Sun H, Liu XD, Liu Q, Wang FP, Bao XQ and Zhang D: Reversal of P-glycoprotein-mediated multidrug resistance by the novel tetrandrine derivative W6. J Asian Nat Prod Res. 17:638–648. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Jin Y, Zhang Z, Zhao T, Liu X and Jian L: Mixed micelles of doxorubicin overcome multidrug resistance by inhibiting the expression of P-Glycoprotein. J Biomed Nanotechnol. 11:1330–1338. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Beeran AA, Maliyakkal N, Rao CM and Udupa N: The enriched fraction of Elephantopus scaber Triggers apoptosis and inhibits multi-drug resistance transporters in human epithelial cancer cells. Pharmacogn Mag. 11:257–268. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Agarwal A, Ayaz A, Samanta L, Sharma R, Assidi M, Abuzenadah AM and Sabanegh E: Comparative proteomic network signatures in seminal plasma of infertile men as a function of reactive oxygen species. Clin Proteomics. 12:232015. View Article : Google Scholar : PubMed/NCBI

21 

Lo YL, Wang W and Ho CT: 7,3′,4′-Trihydroxyisoflavone modulates multidrug resistance transporters and induces apoptosis via production of reactive oxygen species. Toxicology. 302:221–232. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Pandey V, Chaube B and Bhat MK: Hyperglycemia regulates MDR-1, drug accumulation and ROS levels causing increased toxicity of carboplatin and 5-fluorouracil in MCF-7 cells. J Cell Biochem. 112:2942–2952. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Wei N, Liu GT, Chen XG, Liu Q, Wang FP and Sun H: H1, a derivative of Tetrandrine, exerts anti-MDR activity by initiating intrinsic apoptosis pathway and inhibiting the activation of Erk1/2 and Akt1/2. Biochem Pharmacol. 82:1593–1603. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Singer E, Judkins J, Salomonis N, Matlaf L, Soteropoulos P, McAllister S and Soroceanu L: Reactive oxygen species-mediated therapeutic response and resistance in glioblastoma. Cell Death Dis. 6:e16012015. View Article : Google Scholar : PubMed/NCBI

25 

Brozovic A, Ambriović-Ristov A and Osmak M: The relationship between cisplatin-induced reactive oxygen species, glutathione, and BCL-2 and resistance to cisplatin. Crit Rev Toxicol. 40:347–359. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Okon IS and Zou MH: Mitochondrial ROS and cancer drug resistance: Implications for therapy. Pharmacol Res. 100:170–174. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Okon IS, Coughlan KA, Zhang M, Wang Q and Zou MH: Gefitinib-mediated reactive oxygen specie (ROS) instigates mitochondrial dysfunction and drug resistance in lung cancer cells. J Biol Chem. 290:9101–9110. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Su Z, Chen M, Xiao Y, Sun M, Zong L, Asghar S, Dong M, Li H, Ping Q and Zhang C: ROS-triggered and regenerating anticancer nanosystem: An effective strategy to subdue tumor's multidrug resistance. J Control Release. 196:370–383. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Hao Y, Lin C, Fan H, Yu Y, Li N and Chen S: Proteomic analysis of Cucumis sativus cotyledons after glucohexaose treatment as a part of ROS accumulation related resistance mechanism. Proteome Sci. 12:342014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

February-2017
Volume 15 Issue 2

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Guo P, Wang S, Liang W, Wang W, Wang H, Zhao M and Liu X: Salvianolic acid B reverses multidrug resistance in HCT‑8/VCR human colorectal cancer cells by increasing ROS levels. Mol Med Rep 15: 724-730, 2017
APA
Guo, P., Wang, S., Liang, W., Wang, W., Wang, H., Zhao, M., & Liu, X. (2017). Salvianolic acid B reverses multidrug resistance in HCT‑8/VCR human colorectal cancer cells by increasing ROS levels. Molecular Medicine Reports, 15, 724-730. https://doi.org/10.3892/mmr.2016.6049
MLA
Guo, P., Wang, S., Liang, W., Wang, W., Wang, H., Zhao, M., Liu, X."Salvianolic acid B reverses multidrug resistance in HCT‑8/VCR human colorectal cancer cells by increasing ROS levels". Molecular Medicine Reports 15.2 (2017): 724-730.
Chicago
Guo, P., Wang, S., Liang, W., Wang, W., Wang, H., Zhao, M., Liu, X."Salvianolic acid B reverses multidrug resistance in HCT‑8/VCR human colorectal cancer cells by increasing ROS levels". Molecular Medicine Reports 15, no. 2 (2017): 724-730. https://doi.org/10.3892/mmr.2016.6049