Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
August 2012 Volume 4 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August 2012 Volume 4 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Inhibition of proliferation of human lung cancer cells by green tea catechins is mediated by upregulation of let-7

  • Authors:
    • Zhiwei Zhong
    • Zhuo Dong
    • Lihua Yang
    • Xiaoqiang Chen
    • Zhaohui Gong
  • View Affiliations / Copyright

    Affiliations: Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211, P.R. China, Hangzhou Tea Research Institute, All China Federation of Supply and Marketing Cooperatives, Hangzhou 310016, P.R. China
  • Pages: 267-272
    |
    Published online on: May 17, 2012
       https://doi.org/10.3892/etm.2012.580
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Green tea catechins are known to function as anticancer agents via inhibition of carcinogenesis during the initiation, promotion and progression stages. Many potential mechanisms have been proposed, yet the precise mechanism of lung cancer prevention by green tea catechins remains unclear. microRNAs (miRs) are a class of 21-24 nucleotide small non-coding RNAs and play critical roles throughout cellular development and regulation. Emerging evidence demonstrates that tea catechins influence the expression of miRs in human cancer cells to inhibit tumorigenesis. Both let-7a-1 and let-7g were detected in the human lung cancer cells treated with tea catechins. The cell viability and cell cycle were analyzed after tea catechins treatment. In the present study, we found that tea catechins upregulated the tumor-suppressor miRs, let-7a-1 and let-7g, in lung cancer cell lines. The upregulation of let‑7a/7g repressed the expression of their targets, C-MYC and the regulatory protein of LIN-28, at the mRNA and protein levels. Moreover, the cell growth assay indicated that tea catechins significantly inhibited cell proliferation, and the flow cytometric analysis revealed an increase in the number of cells in the G2/M phase and a decrease in the number of cells in the S phase after treatment with tea catechins. These observations suggest that green tea catechins mediate the inhibition of proliferation of lung cancer cells through the let-7 signaling pathway.

Introduction

Lung cancer is one of the most common malignant tumors and the leading cause of cancer-related mortality worldwide (1). Small-cell lung carcinoma (SCLC) is the most aggressive subtype of all lung tumors and is associated with poor patient survival (2). Although the investigation of known genes and proteins has yielded much new information, previously unknown biomarkers such as non-coding RNA gene products may also lend insight into the biology of lung cancer. Further investigation of the use of differential microRNA (miR) expression in the diagnosis, prognosis and treatment of lung cancer is warranted.

miRs are a class of short, single-stranded, endogenous and highly conserved non-coding RNAs that are involved in numerous developmental processes and the modulation of gene expression. Recent studies have demonstrated that various miRs, such as let-7, miR-15 and miR-16, are downregulated in human cancer cells and may function as tumor suppressors (3–6). Conversely, various miRs, including miR-21, miR-31 and miR-155, are upregulated in human cancer cells and may function as oncomirs (oncogene miRs) (7–9). Members of the let-7 family of miRs are expressed at an extremely low level in lung cancer (10) and act as tumor suppressors by repressing cell proliferation and regulating multiple oncogenes, such as RAS and C-MYC (11–14). In addition, the C-MYC oncogene was found to regulate the expression of the pluripotency factor LIN-28, which modulates the process of mature let-7 (15). Therefore, the upregulation of let-7 expression may inhibit cell proliferation by downregulating the C-MYC and LIN-28 expression signaling pathway in lung cancer cells.

Tea, one of the most popular beverages consumed worldwide, has received much attention due to its disease prevention effects (16,17). Studies have shown that these effects are attributed to the polyphenolic constituents which are present in high amounts in green tea (18). The inhibitory effects of tea catechins against experimental carcinogenesis have also been demonstrated in many animal models (19–21). In recent years, it has been reported that tea catechins induce the modification of the expression profile of miRs and mediate the apoptotic effect in human cancer cells (22,23). Furthermore, let-7 is known as a tumor suppressor in lung cancer cells or animal models by repressing cell proliferation (10,24–26) and its expression profile may be altered by various agents (23,27,28). However, the effect and mechanism of tea catechins on let-7 expression in human lung cancer remain unknown. Here, we identified let-7a-1, let-7g, C-MYC and LIN-28 expression levels in human lung cancer cells after tea catechin treatment and found that tea catechins repressed cell proliferation of lung cancer cells through upregulation of let-7 and downregulation of the C-MYC, LIN-28 signaling pathway.

Materials and methods

Cell lines and tea catechins

NCI-H446 and MSTO-211H lung cancer cells were purchased from the Cell Resource Centre of the Shanghai Institutes for Biological Sciences of the Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI-1640 medium (Invitrogen Life Technologies, Carlsbad, CA, USA) containing 10% fetal bovine serum (Hyclone, USA). These two cell lines overexpress the C-MYC protooncogene. The tea catechins were extracted from green tea by the All China Federation of Supply and Marketing Cooperatives (ACFSMC) (Hangzhou, China) and the purity was 85%. The catechins were dissolved in double-distilled H2O and stored at −20°C for research use.

Tea catechin stimulation

Prior to tea-catechin treatment, the cells were maintained in a humidified incubator at 37°C in 5% CO2 and the media were replaced two times/week. Logarithmically growing lung cancer cells were harvested and seeded in 6-well plates (1×105 cells/well) or 96-well plates (1×104 cells/well). After overnight proliferation, the adherent cells were incubated with tea catechins at final concentrations of 0, 50, 100 and 200 μg/ml for 24–96 h. At the end of each treatment, the cells were used for cell growth assay.

Quantitative real-time RT-PCR for miRs and relative gene expression

Forty-eight hours post-treatment, total-RNA was isolated from the cells using RNAiso reagent (Takara Bio, Inc., Shiga, Japan) according to the manufacturer’s instructions. One microgram of total-RNA was subjected to reverse transcription reaction. Quantitative real-time RT-PCR of miRs (let-7a-1/7g) was performed using the Hairpin-it™ miR qPCR quantitation kit (Shanghai GenePharma, Co., Ltd., Shanghai, China) and the SYBR-Green PCR master mix (Takara Bio, Inc.) in the Mx3005P real-time PCR system (Stratagene, USA) for quantitative miR detection. The reactions were performed in 8-strip tubes (Axygen, USA) at 95°C for 2 min, followed by 40 cycles of 95°C for 15 sec and 62°C for 1 min. Data were analyzed by MxPro 3.2 according to the manufacturer’s instructions. The analysis of miR-related genes (C-MYC and LIN-28) was carried out by quantitative real-time RT-PCR. The reactions were performed at 95°C for 2 min, followed by 40 cycles of 95°C for 20 sec and 60°C for 1 min and β-actin was used as an internal control. The primer sequences for qPCR and RT-PCR are shown in Table I.

Table I.

Primer sequences for real-time RT-PCR.

Table I.

Primer sequences for real-time RT-PCR.

GenesForward primer sequences (5′→3′)Reverse primer sequences (5′→3′)
let-7a-1 CGATTCAGTGAGGTAGTAGGTTGT TATGGTTGTTCTGCTCTCTGTCTC
let-7g CGCCAGTTGAGGTAGTAGTTTGTA TATGGTTGTTCTGCTCTCTGTCTC
U6 snRNA CTCGGTTCGGCAGCACA AACGCTTCACGAATTTGCGT
C-MYC CCACCAGCAGCGACTCTGA GCAGAAGGTGATCCAGACTC
LIN-28 AGGCGGTGGAGTTCACCTTTAAGA AGCTTGCATTCCTTGGCATGATGG
β-actin CAGAAGGAGATTACTGCTCTGGCT TACTCCTGCTTGCTGATCCACATC
Cell viability assay

At 24, 48, 72 and 96 h post-treatment using different concentrations of tea catechins, 20 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 5 mg/ml) was added to each well, and the cells were incubated for 4 h at 37°C in 5% CO2. After incubation, the medium was carefully removed from the plates, and 150 μl of dimethyl sulfoxide (DMSO) was added to solubilize the formazan produced from MTT by the viable cells. Absorbance was measured at 490 nm by using an automatic microplate reader (Labsystems, Helsinki, Finland).

Flow cytometry

Twenty-four hours post-stimulation by tea cate-chins, the cells were harvested and washed with cold PBS and then fixed in 70% ice-cold ethanol for 24 h. After washing with PBS, the cells were incubated with 1 μg/ml propidium iodide (PI) for 30 min at room temperature before FACS Calibur system (Becton-Dickinson, USA) analysis. The data were collected and processed using the ModFit LT FACS analysis software.

Western blot analysis

Forty-eight hours after tea catechin treatment, the cells were washed three times with cold PBS and lysed in ice-cold lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% Triton X-100, 100 μg/ml PMSF). Thirty minutes later, the cell pellets were collected by scraping. They were then transferred to new tubes and centrifuged at 12,000 rpm for 15 min at 4°C. The supernatant was used for protein quantitative analysis by the Bradford procedure (Bio-Rad, USA) and then for western blot analysis. The proteins were resolved on 12% SDS-polyacrylamide gels, transferred onto PVDF membranes and incubated with appropriate antibodies according to the manufacturer’s instructions. The rabbit polyclonal antibody of anti-β-actin (Beijing Bioss Biotechnology, Beijing, China) was used at a 1:500 dilution, the rabbit monoclonal anti-LIN-28 antibody (Epitomics, Inc., USA) was used at a 1:5,000 dilution, and the secondary antibody of IgG-HRP (Sigma, USA) was used at a 1:6,000 dilution. Color development reaction of HRP was performed using the BeyoECL Plus system (Beyotime, Haimen, China). The Quantity One analysis program (Bio-Rad) was used to obtain the quantitative data.

Statistical analysis

The experimental data are expressed as the mean ± SD of three independent experiments, and all experiments were performed in triplicate. The statistical significance between different groups was determined using a two-tailed Student’s t-test. A P-value of <0.05 was considered to indicate a statitically significant difference.

Results

let-7 expression is upregulated after tea catechin treatment

To determine whether let-7a-1 and let-7g are involved in the response of lung cancer cells to tea catechin treatment, NCI-H446 and MSTO-211H cells were incubated with different doses of tea catechins before miR analysis. The qRT-PCR results of miRs showed that both of the mature let-7a-1 and let-7g were upregulated from the dose of 50 μg/ml, and their induced expression levels were markedly higher than those of the control groups (Fig. 1A and B). Moreover, tea catechins upregulated let-7g in a dose-dependent manner in both cell lines (Fig. 1B). Taken together, these results demonstrated that tea catechins upregulated the expression of the tumor-suppressor miRs, let-7a-1 and let-7g.

Figure 1.

Tea catechins upregulated (A) let-7a-1 and (B) let-7g expression in NCI-H446 and MSTO-211H cells. U6 snRNA was used as an internal control. *P<0.05, **P<0.01 and ***P<0.001 compared to the control.

Tea catechins repress let-7 target and regulatory gene expression

For further confirmation of the effect of tea catechins on let-7 target and regulatory gene expression, we used qRT-PCR to detect the let-7 target gene C-MYC and its regulatory gene LIN-28, at the mRNA level. C-MYC and LIN-28 mRNA expression was significantly reduced 48 h after treatment of the NCI-H446 and MSTO-211H cells with tea catechins (Fig. 2A and B). To identify the effect of tea catechins on the expression of let-7 regulatory protein LIN-28, we further detected the LIN-28 expression at the protein level by western blot analysis and found that LIN-28 protein was decreased after tea catechin treatment (Fig. 2C and D). The results revealed that tea catechins not only affected the let-7 target C-MYC expression, but also repressed let-7 regulatory LIN-28 expression.

Figure 2.

Effects of tea catechins on let-7a-1/7g targeted gene expression: (A) C-MYC mRNA level; (B) LIN-28 mRNA level; (C) LIN-28 protein level. (D) Quantitative analysis of LIN-28 protein by the Quantity One program. *P<0.05, **P<0.01 and ***P<0.001 compared to the control.

Tea catechins inhibit cell proliferation through a let-7 signaling pathway

To determine the cancer-preventive effect of the upregulation of let-7 by tea catechins on cell proliferation, we investigated the effect of tea catechins on cell growth and the cell cycle. The MTT results showed that tea catechins significantly suppressed NCI-H446 and MSTO-211H cell proliferation (Fig. 3). Additionally, the inhibitory effects were markedly exhibited in a dose- and time-dependent manner. At doses of 50, 100 and 200 μg/ml of tea catechins, the percentages of inhibition were 28.9, 43.13 and 47.25% in NCI-H446 cells, respectively (Fig. 3A) as well as 34.72, 65.23 and 57.69% in MSTO-211H cells, respectively (Fig. 3B). Furthermore, treatment of the cells with tea-catechin resulted in a significant dose-dependent decrease in cell density by suppression of NCI-H446 cell growth (Fig. 3C).

Figure 3.

Effects of different concentrations of tea catechins on the cell growth of (A) NCI-H446 and (B) MSTO-211H cells. *P<0.05 compared to the control. (C) Representative cell growth density of NCI-H446 cells treated with 0, 50 100, 200 μg/ml tea catechin by inverted microscopy (magnification, x200).

Tea catechins induce cell cycle arrest at the G2/M phase

We further investigated whether the upregulation of let-7 and the downregulation of the C-MYC/LIN-28 pathway by tea catechins affect the cell cycle. The DNA content analysis of the cell cycle was accomplished using flow cytometry. The results showed that the cell cycle was arrested at the G2/M phase, and the number of cells in the S phase was significantly decreased at an appropriate dose of tea catechins in NCI-H446 and MSTO-211H lung cancer cells (Fig. 4A and B). These results indicate that treatment with tea catechins results in cell cycle arrest.

Figure 4.

Treatment with tea catechins resulted in cell cycle arrest in (A) NCI-H446 and (B) MSTO-211H cells. *P<0.05, **P<0.01 and ***P<0.001 compared to the control.

Discussion

The present study reveals that tea catechins significantly suppress cell growth by upregulating let-7 and downregulating the C-MYC/LIN-28 signaling pathway in lung cancer cells and mesothelioma cells which overexpress the C-MYC protooncogene. Tea catechins were found to exhibit inhibitory effects against the formation and development of various tumors. More specifically, tea catechins have been reported to alter the expression of C-MYC in lung carcinogenesis (29). Their anti-cancer effects include suppressing cell proliferation, promoting apoptosis, modulating signaling transduction and inhibiting cell invasion or metastasis (30). Interestingly, tea catechins also inhibit non-cancer (human embryonic lung fibroblast) cell proliferation (unpublished data from our own group), which indicates the suppression of cell growth is a non-specific effect. The in vitro cytotoxicity of tea catechins to cancer and normal cells has also been reported in previous studies (31,32). Although the effects of tea catechins on inhibiting human cancer cell proliferation have been reported in several studies (18,30), the precise mechanism of suppressing cancer cell growth is unclear. miRs are small non-coding RNA and are known to be important in the regulation of numerous cellular events (33). In particular, the let-7 miR family is an important class of cell regulatory factors of cellular growth. Our results also showed that let-7 is a tumor-suppressor miR and reduces C-MYC and LIN-28 expression in lung cancer cells. Recently, it has been shown that glia dedifferentiation and retinal regeneration are regulated through a LIN-28-dependent, let-7 miR signaling pathway (34). Moreover, the previous study indicates that LIN-28 functions as a negative regulator of let-7 miRs, and C-MYC suppresses mature let-7 miR expression through promotion of LIN-28 expression (15). Based on these studies, since C-MYC and LIN-28 regulate let-7 expression in cell differentiation and regeneration, here we confirmed our hypothesis that tea catechins suppress lung cancer cell growth via upregulation of let-7; through the inhibition of C-MYC and LIN-28 expression.

Recent studies have demonstrated that natural agents, such as B-DIM, isoflavone, genistein and curcumin, can alter the expression of specific miRs and thereby inhibit tumor growth (35–37). In addition, Zhang et al (38) reported that curcumin down-regulates miR-186 and therefore induces cell apoptosis in lung cancer cells. The main component of tea catechins, EGCG, was found to upregulate miR-16 and downregulate its targeted gene Bcl-2 to induce apoptosis in human cancer cells (23). This previous study also demonstrated that EGCG modified the expression of various miRs in human hepatocellular carcinoma HepG2 cells. In particular, 13 miRs were upregulated and 48 miRs were downregulated. Among them, the upregulated miRs included let-7a, let-7b and let-7c (23). Izzotti et al (27,28) found that exposure to cigarette smoke alters miR expression in the lungs of rats. Our study demonstrated that expression of the tumor suppressors let-7a/7g was upregulated after tea catechin treatment. The properties and functions of these miRs may contribute to the differential anticancer effects of tea catechins. These emerging studies suggest that various agents affect mechanisms through miRNA pathways, and these support our finding that tea catechins alter the expression of various miRs and their targets or expression of related genes.

In conclusion, our study revelaed that tea catechins modulate the expression of various miRs in lung cancer cells; expression of let-7a-1 and let-7g was upregulated. The expression levels of let-7 target C-MYC and regulatory protein LIN-28 were reduced after treatment with a high dose of tea catechins. Based on the fact that let-7 overexpression suppresses cancer cell proliferation and tea catechins prevent cancers, our results found that tea catechins suppress cell growth via increased expression of let-7 miR and decreased expression of the targets, C-MYC and LIN-28.

Acknowledgements

We are grateful to Mrs Qiong Liu and Mrs Yanping Le for their technical assistance in flow cytometry and microscopy. This study was supported by research grants from the Key Scientific Research Fund of Zhejiang Provincial Education Department (Z201119414), the Natural Science Foundation of Zhejiang Province (Y12C060009), the Natural Science Foundation of Ningbo (201201A6110009), Zhejiang Provincial Research Project (2012F81G2070010), the Scientific Innovation Team Project of Ningbo (2011B82014), the Scientific Research Foundation of Graduate School of Ningbo University (G11JA007) and the K.C. Wong Magna Fund at Ningbo University.

References

1. 

Siegel R, Ward E, Brawley O and Jemal A: Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin. 61:212–236. 2011. View Article : Google Scholar : PubMed/NCBI

2. 

Rodriguez E and Lilenbaum RC: Small cell lung cancer: past, present, and future. Curr Oncol Rep. 12:327–334. 2010. View Article : Google Scholar : PubMed/NCBI

3. 

Osada H and Takahashi T: let-7 and miR-17-92: small-sized major players in lung cancer development. Cancer Sci. 102:9–17. 2011. View Article : Google Scholar : PubMed/NCBI

4. 

Bandi N, Zbinden S, Gugger M, et al: miR-15a and miR-16 are implicated in cell cycle regulation in a Rb-dependent manner and are frequently deleted or down-regulated in non-small cell lung cancer. Cancer Res. 69:5553–5559. 2009. View Article : Google Scholar : PubMed/NCBI

5. 

Wang QZ, Xu W, Habib N and Xu R: Potential uses of microRNA in lung cancer diagnosis, prognosis, and therapy. Curr Cancer Drug Targets. 9:572–594. 2009. View Article : Google Scholar : PubMed/NCBI

6. 

Cimmino A, Calin GA, Fabbri M, et al: miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci USA. 102:13944–13949. 2005. View Article : Google Scholar : PubMed/NCBI

7. 

Valeri N, Gasparini P, Fabbri M, et al: Modulation of mismatch repair and genomic stability by miR-155. Proc Natl Acad Sci USA. 107:6982–6987. 2010. View Article : Google Scholar : PubMed/NCBI

8. 

Liu X, Sempere LF, Ouyang H, et al: MicroRNA-31 functions as an oncogenic microRNA in mouse and human lung cancer cells by repressing specific tumor suppressors. J Clin Invest. 120:1298–1309. 2010. View Article : Google Scholar : PubMed/NCBI

9. 

Zhu S, Wu H, Wu F, Nie D, Sheng S and Mo YY: MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 18:350–359. 2008. View Article : Google Scholar : PubMed/NCBI

10. 

Johnson CD, Esquela-Kerscher A, Stefani G, et al: The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 67:7713–7722. 2007. View Article : Google Scholar : PubMed/NCBI

11. 

Johnson SM, Grosshans H, Shingara J, et al: RAS is regulated by the let-7 microRNA family. Cell. 120:635–647. 2005. View Article : Google Scholar : PubMed/NCBI

12. 

He XY, Chen JX, Zhang Z, Li CL, Peng QL and Peng HM: The let-7a microRNA protects from growth of lung carcinoma by suppression of k-Ras and c-Myc in nude mice. J Cancer Res Clin Oncol. 136:1023–1028. 2010. View Article : Google Scholar : PubMed/NCBI

13. 

Wong TS, Man OY, Tsang CM, et al: MicroRNA let-7 suppresses nasopharyngeal carcinoma cell proliferation through downregulating c-Myc expression. J Cancer Res Clin Oncol. 137:415–422. 2011. View Article : Google Scholar : PubMed/NCBI

14. 

Lan FF, Wang H, Chen YC, et al: Hsa-let-7g inhibits proliferation of hepatocellular carcinoma cells by downregulation of c-Myc and upregulation of p16(INK4A). Int J Cancer. 128:319–331. 2011. View Article : Google Scholar : PubMed/NCBI

15. 

Dangi-Garimella S, Yun J, Eves EM, et al: Raf kinase inhibitory protein suppresses a metastasis signalling cascade involving LIN28 and let-7. EMBO J. 28:347–358. 2009. View Article : Google Scholar : PubMed/NCBI

16. 

Balentine DA, Wiseman SA and Bouwens LC: The chemistry of tea flavonoids. Crit Rev Food Sci Nutr. 37:693–704. 1997. View Article : Google Scholar : PubMed/NCBI

17. 

Dube A, Nicolazzo JA and Larson I: Chitosan nanoparticles enhance the intestinal absorption of the green tea catechins (+)-catechin and (-)-epigallocatechin gallate. Eur J Pharm Sci. 41:219–225. 2010.

18. 

Higdon JV and Frei B: Tea catechins and polyphenols: health effects, metabolism, and antioxidant functions. Crit Rev Food Sci Nutr. 43:89–143. 2003. View Article : Google Scholar : PubMed/NCBI

19. 

Fujiki H, Yoshizawa S, Horiuchi T, et al: Anticarcinogenic effects of (-)-epigallocatechin gallate. Prev Med. 21:503–509. 1992. View Article : Google Scholar

20. 

Liao S, Umekita Y, Guo J, Kokontis JM and Hiipakka RA: Growth inhibition and regression of human prostate and breast tumors in athymic mice by tea epigallocatechin gallate. Cancer Lett. 96:239–243. 1995. View Article : Google Scholar : PubMed/NCBI

21. 

Hirose M, Mizoguchi Y, Yaono M, Tanaka H, Yamaguchi T and Shirai T: Effects of green tea catechins on the progression or late promotion stage of mammary gland carcinogenesis in female Sprague-Dawley rats pretreated with 7,12-dimethylbenz(a) anthracene. Cancer Lett. 112:141–147. 1997. View Article : Google Scholar : PubMed/NCBI

22. 

Fix LN, Shah M, Efferth T, Farwell MA and Zhang B: MicroRNA expression profile of MCF-7 human breast cancer cells and the effect of green tea polyphenon-60. Cancer Genomics Proteomics. 7:261–277. 2010.PubMed/NCBI

23. 

Tsang WP and Kwok TT: Epigallocatechin gallate up-regulation of miR-16 and induction of apoptosis in human cancer cells. J Nutr Biochem. 21:140–146. 2008. View Article : Google Scholar : PubMed/NCBI

24. 

Kumar MS, Erkeland SJ, Pester RE, Chen CY, Ebert MS, Sharp PA and Jacks T: Suppression of non-small cell lung tumor development by the let-7 microRNA family. Proc Natl Acad Sci USA. 105:3903–3908. 2008. View Article : Google Scholar : PubMed/NCBI

25. 

Esquela-Kerscher A, Trang P, Wiggins JF, et al: The let-7 microRNA reduces tumor growth in mouse models of lung cancer. Cell Cycle. 7:759–764. 2008. View Article : Google Scholar : PubMed/NCBI

26. 

He X, Duan C, Chen J, Ou-Yang X, Zhang Z, Li C and Peng H: Let-7a elevates p21(WAF1) levels by targeting of NIRF and suppresses the growth of A549 lung cancer cells. FEBS Lett. 583:3501–3507. 2009. View Article : Google Scholar : PubMed/NCBI

27. 

Izzotti A, Calin GA, Arrigo P, Steele VE, Croce CM and De Flora S: Downregulation of microRNA expression in the lungs of rats exposed to cigarette smoke. FASEB J. 23:806–812. 2009. View Article : Google Scholar : PubMed/NCBI

28. 

Izzotti A, Calin GA, Steele VE, Cartiglia C, Longobardi M, Croce CM and De Flora S: Chemoprevention of cigarette smoke-induced alterations of microRNA expression in rat lungs. Cancer Prev Res (Phila). 3:62–72. 2010. View Article : Google Scholar : PubMed/NCBI

29. 

Manna S, Mukherjee S, Roy A, Das S and Panda CK: Tea polyphenols can restrict benzo[a]pyrene-induced lung carcinogenesis by altered expression of p53-associated genes and H-ras, c-myc and cyclin D1. J Nutr Biochem. 20:337–349. 2009.

30. 

Yang CS and Wang X: Green tea and cancer prevention. Nutr Cancer. 62:931–937. 2010. View Article : Google Scholar : PubMed/NCBI

31. 

Babich H, Krupka ME, Nissim HA and Zuckerbraun HL: Differential in vitro cytotoxicity of (-)-epicatechin gallate (ECG) to cancer and normal cells from the human oral cavity. Toxicol In Vitro. 19:231–242. 2005. View Article : Google Scholar : PubMed/NCBI

32. 

Yang CS, Wang X, Lu G and Picinich SC: Cancer prevention by tea: animal studies, molecular mechanisms and human relevance. Nat Rev Cancer. 9:429–439. 2009. View Article : Google Scholar : PubMed/NCBI

33. 

Yang N, Coukos G and Zhang L: MicroRNA epigenetic alterations in human cancer: one step forward in diagnosis and treatment. Int J Cancer. 122:963–968. 2008. View Article : Google Scholar : PubMed/NCBI

34. 

Ramachandran R, Fausett BV and Goldman D: Ascl1a regulates Müller glia dedifferentiation and retinal regeneration through a Lin-28-dependent, let-7 microRNA signalling pathway. Nat Cell Biol. 12:1101–1107. 2010.PubMed/NCBI

35. 

Li Y, VandenBoom TG II, Kong D, Wang Z, Ali S, Philip PA and Sarkar FH: Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 69:6704–6712. 2009. View Article : Google Scholar : PubMed/NCBI

36. 

Sun Q, Cong R, Yan H, et al: Genistein inhibits growth of human uveal melanoma cells and affects microRNA-27a and target gene expression. Oncol Rep. 22:563–567. 2009.PubMed/NCBI

37. 

Sun M, Estrov Z, Ji Y, Coombes KR, Harris DH and Kurzrock R: Curcumin (diferuloylmethane) alters the expression profiles of microRNAs in human pancreatic cancer cells. Mol Cancer Ther. 7:464–473. 2008. View Article : Google Scholar : PubMed/NCBI

38. 

Zhang J, Du Y, Wu C, et al: Curcumin promotes apoptosis in human lung adenocarcinoma cells through miR-186* signaling pathway. Oncol Rep. 24:1217–1223. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhong Z, Dong Z, Yang L, Chen X and Gong Z: Inhibition of proliferation of human lung cancer cells by green tea catechins is mediated by upregulation of let-7. Exp Ther Med 4: 267-272, 2012.
APA
Zhong, Z., Dong, Z., Yang, L., Chen, X., & Gong, Z. (2012). Inhibition of proliferation of human lung cancer cells by green tea catechins is mediated by upregulation of let-7. Experimental and Therapeutic Medicine, 4, 267-272. https://doi.org/10.3892/etm.2012.580
MLA
Zhong, Z., Dong, Z., Yang, L., Chen, X., Gong, Z."Inhibition of proliferation of human lung cancer cells by green tea catechins is mediated by upregulation of let-7". Experimental and Therapeutic Medicine 4.2 (2012): 267-272.
Chicago
Zhong, Z., Dong, Z., Yang, L., Chen, X., Gong, Z."Inhibition of proliferation of human lung cancer cells by green tea catechins is mediated by upregulation of let-7". Experimental and Therapeutic Medicine 4, no. 2 (2012): 267-272. https://doi.org/10.3892/etm.2012.580
Copy and paste a formatted citation
x
Spandidos Publications style
Zhong Z, Dong Z, Yang L, Chen X and Gong Z: Inhibition of proliferation of human lung cancer cells by green tea catechins is mediated by upregulation of let-7. Exp Ther Med 4: 267-272, 2012.
APA
Zhong, Z., Dong, Z., Yang, L., Chen, X., & Gong, Z. (2012). Inhibition of proliferation of human lung cancer cells by green tea catechins is mediated by upregulation of let-7. Experimental and Therapeutic Medicine, 4, 267-272. https://doi.org/10.3892/etm.2012.580
MLA
Zhong, Z., Dong, Z., Yang, L., Chen, X., Gong, Z."Inhibition of proliferation of human lung cancer cells by green tea catechins is mediated by upregulation of let-7". Experimental and Therapeutic Medicine 4.2 (2012): 267-272.
Chicago
Zhong, Z., Dong, Z., Yang, L., Chen, X., Gong, Z."Inhibition of proliferation of human lung cancer cells by green tea catechins is mediated by upregulation of let-7". Experimental and Therapeutic Medicine 4, no. 2 (2012): 267-272. https://doi.org/10.3892/etm.2012.580
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team