Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
September-2015 Volume 10 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2015 Volume 10 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Detection of AmpC β-lactamases in Acinetobacter baumannii in the Xuzhou region and analysis of drug resistance

  • Authors:
    • Yongrui Liu
    • Xiangqun Liu
  • View Affiliations / Copyright

    Affiliations: Department of Respiration, The First People's Hospital of Jining, Shandong 272002, P.R. China, Department of Respiration, Xuzhou City Hospital Affiliated to Xuzhou Medical College, Xuzhou, Jiangsu 221002, P.R. China
    Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 933-936
    |
    Published online on: July 2, 2015
       https://doi.org/10.3892/etm.2015.2612
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to determine the prevalence and related drug resistance of AmpC β-lactamases in Acinetobacter baumannii in tertiary-level hospitals in the Xuzhou region in China. A total of 134 clinical isolates of non-repetitive Acinetobacter baumannii were collected from different hospitals in the Xuzhou region, and multiplex polymerase chain reaction (PCR) was employed to determine the genotype of AmpC. The PCR products were purified and sequenced. The susceptibility to antibiotics was tested using the biometrics automated microbiological-assay system, VITEK-2. Amongst the 134 isolated strains, 96 strains were found to produce AmpC β-lactamases, and the positive rate was 72%, all of which carried acinetobacter-derived cephalosporinase (ADC) type AmpC resistance genes. The drug sensitivity tests indicated that the positive Acinetobacter baumannii strains were resistant to the majority of extended-spectrum β-lactam antibiotics, but were only sensitive to polymyxin. In conclusion, the incidence of AmpC enzymes in Acinetobacter baumannii strains in tertiary-level hospitals in the Xuzhou area is relatively high, and resistance to the majority of extended-spectrum β-lactam antibiotics may be related to the ADC type of AmpC.

Introduction

Acinetobacter baumannii (A. baumannii), a non-fermenting bacteria, is the known conditioned pathogen leading to noso-comial infection, which exists widely in nature and the hospital environment and is the only Gram-negative bacillus which can survive for weeks on human skin (1). With the wide use of immunosuppressive drugs, the increase in invasion surgeries and the development of intensive care technology (2), an increasing number of A. baumannii infections have been detected. Multi-drug resistance and the amplification of resistance to A. baumannii have increased the mortality rate in the clinic (3). Resistance to antibiotics against A. baumannii mostly occurs due to the loss of membrane proteins, active efflux mechanisms, changes in penicillin-binding proteins (PBPs) and the production of various enzymes, amongst which the production of β-lactamases plays an important role in the resistance to β-lactam antibiotics (5). Both domestic and foreign studies have suggested the severe drug resistance to A. baumannii (4). The aim of the present study was to perform a genetic test and drug resistance analysis for the AmpC enzyme in A. baumannii isolated from tertiary-level hospitals in the Xuzhou region, China by polymerase chain reaction (PCR), to strengthen the study of drug resistance genes, which is of great significance ot understand the distribution of gene type to control and treat infections caused by A. baumannii. The findings of our study may facilitate and provide guidelines for the rational clinical use of antibiotics and the prevention and epidemic control of the drug-resistant bacterium, A. baumannii.

Materials and methods

Materials

A total of 134 clinical isolates of non-repetitive A. baumannii were collected from patients at the First People's Hospital, Affiliated to Xuzhou Medical College, Central Hospital in Xuzhou, China, from August 2012 to November 2012. The Escherichia coli ATCC 25922 strain was employed as a negative quality control, while Enterobacter cloacae was employed as a positive quality control. The VITEK® 2 Compact system was obtained from bioMérieux, Inc., Craponne, France; the Gel Imaging System was from Tianneng, Shanghai, China; the GeneAmp PCR System was purchased from Biometra GmbH, Goettingen, Germany; the Electrophoresis System was from Beijing Liuyi Instrument Plant, Beijing, China; the Mueller-Hinton (MH) was from Oxoid, Basingstoke, UK; the Ex Taq enzyme, dNTPs and the DNA Marker 1200 were from Tiangen Biotech, Beijing, China (http://www.tiangen.com/); and agarose and ethidium bromide were from Sigma, St. Louis, MO, USA.

Methods

Clinical samples were cultured in blood agar culture medium at 35°C for 18–24 h. The identification of the bacteria was carried out according to the ‘National Clinical Laboratory procedures’. All strains were tested for drug sensitivity analysis with the Gram-negative bacteria GN and AST GN-13 identification of the French Merieux automatic bacteria Vitek-2 identification system.

According to the instructions provided with the bacteria DNA extracting kit (Tiangen Biochemical Technology Co., Ltd., Beijing, China), DNA samples of the clinical strains were extracted as a PCR template. The primers used for PCR amplification (7 pairs created by Shenggong Corp., Shanghai, China) were as previously reported (6,7) and are presented in Table I. PCR was performed with a final volume of 25 µl. The PCR program consisted of an initial denaturation step at 94°C for 3 min, followed by 28 cycles of DNA denaturation at 94°C for 30 sec, primer annealing at 56°C for 30 sec, and primer extension at 72°C for 1 min. After the final cycle, a final extension step at 72°C for 7 min was added. The PCR product was analyzed by gel electrophoresis on 1.5% agarose gels. The gels were stained with ethidium bromide at 0.5 µg/ml and visualized using a UV transillumination imaging system (Furi Technology Co., Ltd., Shanghai, China).

Table I.

PCR primer sequences and target genes.

Table I.

PCR primer sequences and target genes.

GenesPrimer sequences (5′→3′)Expected amplification size (bp)
blaADCP1: TAAACACCACATATGTTCCG663
P2: ACTTACTTCAACTCGCGACG
blaMOXP1: GCT GCT CAA GGA GCA CAG GAT520
P2: CAC ATT GAC ATA GGT GTG GTG C
blaCITP1: TGG CCA GAA CTG ACA GGC AAA462
P2: TTT CTC CTG AAC GTG GCT GGC
blaDHAP1: AAC TTT CAC AGG TGT GCT GGG T405
P2: CCG TAC GCT TAC TGG CTT TGC
blaACCP1: AAC AGC CTC AGC AGC CGG TTA346
P2: TTC GCC GCA ATC ATC CCT AGC
blaEBCP1: TCG GTA AAG CCG ATG TTG CGG302
P2: CTT CCA CTG CGG CTG CCA GTT
blaFOXP1: AAC ATG GGG TAT CAG GGA GAT G190
P2: CAA AGC GCG TAA CCG GAT TGG

[i] PCR, polymerase chain reaction.

Sequence analysis

Two strains with positive PCR amplication were selected, and were bidirectionally sequenced (by Shenggong Corp.) and searched using the BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The sequencing results were compared with data on the GenBank database.

Results

The results indicated that the majority of A. baumannii bacteria were present in the ICU deparments of the hospitals (Table II). The amplification products from 96 strains were observed for each template, and the size observed was consistent with the expected size (663 bp). All A. baumannii isolates were of the acinetobacter-derived cephalosporinase (ADC) type based on the size of the fragments amplified by the primers. The positive rate was 72% (96/134) (Fig. 1).

Figure 1.

Electrophoretogram of PCR amplification products for the ampC gene. Lane M, DNA marker (from top to bottom: 1200/900/700/500/300/100 bp); lane 1, positive control; lane 2, negative control; lanes 3–10, heterogeneous clinically-isolated Acinetobacter baumannii.

Table II.

Distribution of the 134 Acinetobacter baumannii strains in distinct departments.

Table II.

Distribution of the 134 Acinetobacter baumannii strains in distinct departments.

WardsStrainPercentage (%)
ICU8059.70
Department of Respiratory Care64.48
Department of Neurology411.19
Department of Geriatrics32.24
Department of Surgery1519.40
Others262.99

[i] All the departments mentioned above belong to First People's Hospital Affiliated to Zuzhou Medical College, Central Hospital in Xuzhou, where we obtained the isolates from.

Results of sequencing analysis

Based on the GenBank database (http://www.ncbi.nlm.nih.gov/Entrez/), the purification sequencing results revealed that the positive products of PCR amplication were the ampC gene of the ADC type. Partial sequencing results were shown in Fig. 2.

Figure 2.

Partial sequences of the ampC gene of ADC type.

Results of the drug sensitivity test

AmpC of A. baumannii was found to be significantly resistant to cephalosporin, quinolone, a synthetic compound combined with sulbactam and carbapenem antibiotics, but were sensitive to polymyxin (Table III).

Table III.

Results of the drug sensivity test of the 96 Acinetobacter baumannii strains positive for AmpC.

Table III.

Results of the drug sensivity test of the 96 Acinetobacter baumannii strains positive for AmpC.

SensivityMedium sensivityResistance



StrainRateStrainRateStrainRate
Cefoxitin000096100
Ceftazidime000096100
Cefepime000096100
Levofloxacin000096100
Gentamicin0022.19497.9
Ampicillin/sulbactam11.077.38891.7
Piperacillin/tazobactam11.088.38790.6
Tienam77.311.08891.7
Polymyxin961000000

Discussion

A. baumannii is a clinically opportunistic pathogen, particularly for hospital-acquired pneumonia (8), and infections are associated with invasive medical procedures (9). According to the monitoring data of nosocomial infection in 2003 in the USA, the prevalence of A. baumannii infection, ranks fourth in nosocomial infection. With the widespread application of extended-spectrum antibiotics, the contribution of the multidrug and pandrug resistance pattern of A. baumannii has increased over the years, making the treatment of clinical infections more difficult (10). For Gram-negative bacteria, the production of β-lactamases plays an important role in the resistance to β-lactam antibiotics (5).

AmpC β-lactamases (AmpC enzymes) are produced by some bacteria and their production is mediated either by chromosomes or by plasmids of Gram-negative bacteria (5). As a ‘serine’ cephalosporinase, AmpC β-lactamases cannot be inhibited by clavulanic acid, but can be inhibited by cloxacillin (11). The enzymes belong to the functional group I [according to the Bush-Jacoby-Medeiros (B-J-M) classification] and the molecular class C. The A. baumannii bacterium is equipped with the chromosome encoded enzyme of class C, and ampC genes from heterogeneous A. baumannii strains highly correlate with each other, but differ from those from other types of strains. Thus, these enzymes are termed as the ADC family (7).

In this study, we genotyped A. baumannii isolates by PCR. Amplification products from 96 strains were observed for each template, with the expected size (663 bp). All A. baumannii isolates were of the ADC type based on the size of the fragments amplified by the primers. The absence of amplified products for the other 6 pairs of primers suggested that the assoication of the ampC gene with plasmid-mediated phenomenon did not occur in A. baumannii and in the other strains in this study. Two strains with positive PCR amplification were selected, the products of which were bidirectionally sequenced and searched using the BLAST program. The results revealed 100% homology with ADC-1. In accordance with previous literature (12), our results demonstrated a total positive rate of 72% for AmpC β-lactamases in A. baumannii in tertiary-level hospitals in the Xuzhou region in China.

In this study, 134 strains of A. baumannii were found to be extensively distributed in a range of departments, amongst which the ICU departmet was found to be the major source. The results of the drug sensitivity test revealed a multidrug, and even a pandrug resistance pattern of AmpC A. baumannii. Carbapenem is the priority drug used for the treatment of infections with AmpC G-bacillus. In this study, the resistance rate of ADC type AmpC A. baumannii to Tienam was as high as 91.7%, which is possibly associated with the spread of carbapenem of OXA type in Acinetobacter (13). Some lines of evidence indicate that sulbactam can irreversibly bind Acinetobacter PBP, which contributes to its inherent antimicrobial activity (14). However, this study demonstrated a drug resistance rate of approximately 90% to ampicillin-salbactam, complicating its drug-resistant mechanisms. We did not identify any drug-resistant strains for polymyxin, which can be a priority drug for treatment. It has been reported that aztreonam in combination with polymyxin may improve the therapeutic effect (14). Nonetheless, a kidney function test is necessary before the combined application of these two drugs, given that polymyxin may induce ototoxicity and renal toxicity. It has also been suggested that antibacterial peptides and vaccination may also be potential choices for therapeutic strategies (15).

In conclusion, the drug resistance condition of AmpC A. baumannii in tertiary-level hospitals in the Xuzhou region is relatively severe and warrants intensive monitoring.

References

1 

Bayuga S, Zeana C, Sahni J, Della-Latta P, el-Sadr W and Larson E: Prevalence and antimicrobial patterns of Acinetobacter baumannii on hands and nares of hospital personnel and patients: the iceberg phenomenon again. Heart Lung. 31:382–390. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Kumar A, Randhawa VS, Nirupam N, Rai Y and Saili A: Risk factors for carbapenem-resistant Acinetobacter baumanii blood stream infections in a neonatal intensive care unit, Delhi, India. J Infect Dev Ctries. 8:1049–1054. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Chopra T, Marchaim D, Awali RA, Krishna A, Johnson P, Tansek R, Chaudary K, Lephart P, Slim J, Hothi J, et al: Epidemiology of bloodstream infections caused by Acinetobacter baumannii and impact of drug resistance to both carbapenems and ampicillin-sulbactam on clinical outcomes. Antimicrob Agents Chemother. 57:6270–6275. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Dettori M, Piana A, Deriu MG, Lo Curto P, Cossu A, Musumeci R, Cocuzza C, Astone V, Contu MA and Sotgiu G: Outbreak of multidrug-resistant Acinetobacter baumannii in an intensive care unit. New Microbiol. 37:185–191. 2014.PubMed/NCBI

5 

Poirel L, Lebessi E, Castro M, Fèvre C, Foustoukou M and Nordmann P: Nosocomial outbreak of extended-spectrum beta-lactamase SHV-5-producing isolates of Pseudomonas aeruginosa in Athens, Greece. Antimicrob Agents Chemother. 48:2277–2279. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Pérez-Pérez FJ and Hanson ND: Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol. 40:2153–2162. 2002. View Article : Google Scholar : PubMed/NCBI

7 

Bou G and Martínez-Beltrán J: Cloning, nucleotide sequencing, and analysis of the gene encoding an AmpC beta-lactamase in Acinetobacter baumannii. Antimicrob Agents Chemother. 44:428–432. 2000. View Article : Google Scholar : PubMed/NCBI

8 

Liu YN, Cao B, Wang H, Chen LA, She DY, Zhao TM, Liang ZX, Sun TY, Li YM, Tong ZH, et al: Adult hospital acquired pneumonia: A multicenter study on microbiology and clinical characteristics of patients from 9 Chinese cities. Zhonghua Jie He He Hu Xi Za Zhi. 35:739–746. 2012.(In Chinese). PubMed/NCBI

9 

Trottier V, Namias N, Pust DG, Nuwayhid Z, Manning R, Marttos AC Jr, Dunham MB, Schulman CI and McKenney MG: Outcomes of Acinetobacter baumannii infection in critically ill surgical patients. Surg Infect (Larchmt). 8:437–443. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Lee YL, Chen YS, Toh HS, Huang CC, Liu YM, Ho CM, Lu PL, Ko WC, Chen YH, Wang JH, et al: Antimicrobial susceptibility of pathogens isolated from patients with complicated intra-abdominal infections at five medical centers in Taiwan that continuously participated in the Study for Monitoring Antimicrobial Resistance Trends (SMART) from 2006 to 2010. Int J Antimicrob Agents. 40 (Suppl):S29–S36. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Seral C, Gude MJ and Castillo FJ: Emergence of plasmid mediated AmpC β-lactamasas: Origin, importance, detection and therapeutical options. Rev Esp Quimioter. 25:89–99. 2012.(In Spanish). PubMed/NCBI

12 

Zhu JM, Jiang RJ, Wu JL, Wu KL, Wang JM and Kong HS: Study on the AmpC gene of Multiple drug resistant Acinetobacter baumannii type ADC. Chin J Clin Infect Dis. 1:222–226. 2008.(In Chinese).

13 

Niumsup PR, Boonkerd N, Tansawai U and Tiloklurs M: Carbapenem-resistant Acinetobacter baumannii producing OXA-23 in Thailand. Jpn J Infect Dis. 62:152–154. 2009.PubMed/NCBI

14 

Malone L and Kwon DH: Carbapenem-associated multidrug-resistant Acinetobacter baumannii are sensitised by aztreonam in combination with polyamines. Int J Antimicrob Agents. 41:70–74. 2013. View Article : Google Scholar : PubMed/NCBI

15 

García-Quintanilla M, Pulido MR, López-Rojas R, Pachón J and McConnell MJ: Emerging therapies for multidrug resistant Acinetobacter baumannii. Trends Microbiol. 21:157–163. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu Y and Liu X: Detection of AmpC β-lactamases in Acinetobacter baumannii in the Xuzhou region and analysis of drug resistance. Exp Ther Med 10: 933-936, 2015.
APA
Liu, Y., & Liu, X. (2015). Detection of AmpC β-lactamases in Acinetobacter baumannii in the Xuzhou region and analysis of drug resistance. Experimental and Therapeutic Medicine, 10, 933-936. https://doi.org/10.3892/etm.2015.2612
MLA
Liu, Y., Liu, X."Detection of AmpC β-lactamases in Acinetobacter baumannii in the Xuzhou region and analysis of drug resistance". Experimental and Therapeutic Medicine 10.3 (2015): 933-936.
Chicago
Liu, Y., Liu, X."Detection of AmpC β-lactamases in Acinetobacter baumannii in the Xuzhou region and analysis of drug resistance". Experimental and Therapeutic Medicine 10, no. 3 (2015): 933-936. https://doi.org/10.3892/etm.2015.2612
Copy and paste a formatted citation
x
Spandidos Publications style
Liu Y and Liu X: Detection of AmpC β-lactamases in Acinetobacter baumannii in the Xuzhou region and analysis of drug resistance. Exp Ther Med 10: 933-936, 2015.
APA
Liu, Y., & Liu, X. (2015). Detection of AmpC β-lactamases in Acinetobacter baumannii in the Xuzhou region and analysis of drug resistance. Experimental and Therapeutic Medicine, 10, 933-936. https://doi.org/10.3892/etm.2015.2612
MLA
Liu, Y., Liu, X."Detection of AmpC β-lactamases in Acinetobacter baumannii in the Xuzhou region and analysis of drug resistance". Experimental and Therapeutic Medicine 10.3 (2015): 933-936.
Chicago
Liu, Y., Liu, X."Detection of AmpC β-lactamases in Acinetobacter baumannii in the Xuzhou region and analysis of drug resistance". Experimental and Therapeutic Medicine 10, no. 3 (2015): 933-936. https://doi.org/10.3892/etm.2015.2612
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team