Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2015 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2015 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Construction and identification of an RNA interference lentiviral vector targeting the mouse TNF-α gene

  • Authors:
    • Jibo Wang
    • Hongda Liang
    • Yingjie Zhao
    • Xiangping Liu
    • Kun Yang
    • Aihua Sui
  • View Affiliations / Copyright

    Affiliations: Department of Rheumatology and Clinical Immunology, The Affiliated Hospital of Qingdao University, Qingdao, Shandong 266003, P.R. China, Department of Central Laboratory, The Affiliated Hospital of Qingdao University, Qingdao, Shandong 266003, P.R. China
  • Pages: 2283-2288
    |
    Published online on: October 19, 2015
       https://doi.org/10.3892/etm.2015.2813
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of this study was to construct RNA interference (RNAi) lentiviral vector particles targeting the mouse tumor necrosis factor-α (TNF-α) gene. Three types of small interfering RNA (siRNA) targeting the mouse TNF-α gene were designed, synthesized and transfected into RAW264.7 cells. Screening was performed to identify the siRNA sequence exhibiting the highest inhibition efficiency; based on this, recombinant lentiviral plasmids were constructed and co‑transfected into 293T cells with packaging plasmids for the production of lentiviral particles. The screening results showed that the TNF‑α mRNA expression levels of the three siRNA groups were significantly lower than those of the negative control group, with the highest inhibition rate in the siRNA2 group (83.09%). Similarly, the expression levels of TNF‑α protein in the three siRNA groups were significantly lower than those of the negative control group, and the highest inhibition rate was found in the siRNA2 group (51.16%). The mRNA expression of interleukin (IL)‑1β and IL‑6 showed no significant difference among the siRNA groups and the negative control. The recombinant lentiviral shuttle plasmid was constructed, and electrophoresis revealed the polymerase chain reaction product to be 343 bp, while that of the empty vector was 306 bp; DNA sequencing showed partial insertion. The virus titer was calculated to be 2x106 TU/µl. In conclusion, RNAi lentiviral vector particles targeting the mouse TNF‑α gene were successfully obtained in the present study. This method may be used to produce lentiviral vector for the in vivo study of RNAi gene therapy targeting TNF-α.

Introduction

The completion of the Human Genome Project genomic map has led to significant advances in the field of gene therapy, one being the development of RNA interference (RNAi). To implement RNAi, the specific small interfering RNA (siRNA) for the target gene must firstly be designed and synthesized; the oligonucleotide sequence can then be designed and synthesized according to its sequence in order to construct a recombinant lentiviral plasmid-expressing short hairpin RNA (shRNA) (1,2). The selection of the viral vector for the implementation of RNAi is also important. Certain viral vectors used for gene transfer are nonintegrative, whereas others are able to integrate into the host cell chromatin. The most commonly used nonintegrative vectors are derived from adenoviruses, herpes virus or adeno-associated virus. The integrative vectors are derived from type C retroviruses, such as murine leukemia virus or lentiviruses such as human immunodeficiency virus. Lentiviral vectors are a widely used type of virus vector for studies of gene function and therapy. These vectors can be integrated into the genome of target cells and are associated with a long expression duration, low immunogenicity and low cytotoxicity, meaning that they can be effectively used in cell lines that are considered to be difficult to transfect, including macrophages, neurons and pancreatic cells (3–8). Tumor necrosis factor-α (TNF-α) is an important proinflammatory cytokine associated with inflammatory arthritis (9) that is involved in the physiopathological process of rheumatoid arthritis. The aim of the present study, therefore, was to construct an RNAi lentiviral vector targeting the mouse TNF-α gene, in order to provide a basis for RNAi gene therapy targeting TNF-α.

Materials and methods

Design and synthesis of siRNA

Based on the mouse TNF-α gene mRNA sequence (NM_013693) in the GenBank database (http://www.ncbi.nlm.nih.gov/genbank/), siRNA was designed according to siRNA design principles (10) and the siRNA Target Finder found on the Ambion® (USA) website (https://www.lifetechnologies.com/cn/zh/home/life-science/rnai/synthetic-rnai-analysis.html#tool). In order to avoid off-target effects (11), the Basic Local Alignment Search Tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was run against the siRNA sequence so that homologous sequences could be excluded; the negative control was designed according to the literature (12–14). The detailed sequences are shown in Table I. siRNA was synthesized by Zimmer (Shanghai) Medical International Trading Co., Ltd. (Shanghai, China).

Table I.

siRNA sequences.

Table I.

siRNA sequences.

NameSequence
siRNA1Sense: 5′-CAGAAAGCAUGAUCCGCGATT-3′
Antisense: 5′-UCGCGGAUCAUGCUUUCUGTG-3′
siRNA2Sense: 5′-GUGCCUAUGUCUCAGCCUCUUTT-3′
Antisense: 5′-AAGAGGCUGAGACAUAGGCACTT-3′
siRNA3Sense: 5′-GCCGAUUUGCUAUCUCAUATT-3′
Antisense: 5′-UAUGAGAUAGCAAAUCGGCTG-3′
Negative control siRNASense: 5′-UUCUCCGAACGUGUCACGUTT-3′

[i] siRNA, small interfering RNA.

Cell culture and transfection

RAW264.7 mouse macrophage cells (Shanghai Cell Bank of China Academy of Medical Sciences, Shanghai, China) were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (Gibco; Life Technologies, Carlsbad, CA, USA) in a 37°C incubator with 5% CO2. The RAW264.7 cells were inoculated in 24-well cell culture plates at a density of 8×104/well and underwent transfection at 40% confluence. The final concentration of siRNA was 100 nM (15). The transfection was performed using X-tremeGENE™ siRNA Transfection Reagent (Roche Applied Science, Indianapolis, IN, USA), according to the manufacturer's instructions. Three control groups were established: A blank control group, with an equal volume of medium; a transfection reagent control group and a negative control group. Each group was set-up in three repeated wells. A total of 5 h after the completion of the siRNA transfection, lipopolysaccharide (LPS; Sigma-Aldrich, St. Louis, MO, USA) was added at a final concentration of 1 µg/µl to each well. Following 2 h of incubation, the cells and supernatant were collected for use in ELISA and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) detection. The experiments were repeated three times.

RT-qPCR

Total RNA was extracted from the cells in each group using the Takara RNA extraction kit, in accordance with the manufacturer's instructions (Takara Biotechnology Co., Ltd., Dalian, China). Following extraction, 1 µg total RNA was subjected to RT to obtain cDNA for qPCR analysis. The mouse TNF-α, interleukin (IL)-1β, IL-6, β-actin primers and Taqman probe were designed using an application of the Primer Express™ software v2.0 (Applied Biosystems, Foster City, CA, USA), and the sequences were as shown in Table II. The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China), and the probes were synthesized by Takara Biotechnology Co., Ltd. The RT-qPCR system and reaction conditions were implemented based on the instructions of the PrimeScript™ RT-PCR kit (Takara Biotechnology Co., Ltd.). The qPCR was performed in the Rotor-Gene RG3500 PCR reaction instrument (Qiagen, Shanghai, China). The Ct value was automatically recorded by Rotor-Gene6 software. The relative expression levels of the TNF-α, IL-1β and IL-6 mRNA were calculated using the 2−ΔΔCt method: ΔΔCt = (Ct target gene - Ct reference gene)test group - (Ct target gene - Ct reference gene)blank control group. The inhibition rate of mRNA expression in each group was calculated using the following formula: mRNA inhibition rate = [(1-relative expression level of mRNAtreatment group/mRNA relative expressionnegative control group)/1] × 100%.

Table II.

Sequences of the primers and probes.

Table II.

Sequences of the primers and probes.

GenePrimers and probesAnnealing temperature (°C)
TNF-αForward primer: 5′-TCTTCCCTGAGGTGCAATGC-3′62
Reverse primer: 5′-GCTCCGTTTTCACAGAAAACATG-3′
Probe: 5′-(FAM) TGGAGGACCCAGTGTGGGAAGCTGT(TAMRA)-3′
IL-1βForward primer: 5′-GGAGCTCCCTTTTCGTGAATG-3′62
Reverse primer: 5′-AGGTAAGTGGTTGCCCATCAGA-3′
Probe: 5′-(FAM) CCAAGACAGGTCGCTCAGGGTCACA(TAMRA)-3′
IL-6Forward primer: 5′-TCCTACCCCAATTTCCAATGC-3′62
Reverse primer: 5′-CCACAGTGAGGAATGTCCACAA-3′
Probe: 5′-(FAM) ATCTACTCGGCAAACCTAGTGCGTT(TAMRA)-3′
β-actinForward primer: 5′-ATGGTGGGAATGGGTCAGAAG-3′62
Reverse primer: 5′-TCCATGTCGTCCCAGTTGGTA-3′
Probe: 5′-(FAM) TGACGAGGCCCAGAGCAAGAGAGGT(TAMRA)-3′

[i] TNF-α, tumor necrosis factor-α; IL, interleukin.

ELISA

The supernatant of the cell culture in each group was used to detect the TNF-α content via the ELISA method, according to the kit manufacturer's instructions (Wuhan Boster Biological Technology, Ltd., Wuhan, China). The protein inhibition rate of TNF-α of each group was calculated using the following formula: Protein inhibition rate = [(TNF-αnegative control group-TNF-αtreatment group)/TNF-αnegative control group] × 100%.

Design of shRNA

Having screened for the high-efficiency siRNA sequence, the oligonucleotide sequence was designed and synthesized according to the requirements of the lentiviral vector construction. The 21-nucleotide oligonucleotide sequence in the forward single strand was forward and reverse combined, during which the loop structure was added to make the oligonucleotide forming the hairpin structure, with the restriction enzyme cutting site at the two ends. The sequence of the duplex structure was as follows: 5′-CCG GAA GAG GCT GAG ACA TAG GCA CTT CAA GAG AGT GCC TAT GTC TCA GCC TCT TTT TTTG-3′; 5′-AAT TCA AAA AAA GAG GCT GAG ACA TAG GCA CTC TCT TGA AGT GCC TAT GTC TCA GCC TCTT-3′.

Construction of recombinant lentivirus shuttle plasmid

The double-stranded DNA was formed by oligonucleotides annealing at the reaction conditions of 90°C for 4 min, 70°C for 10 min and a slow decrease to room temperature. The PGCSIL-green fluorescent protein (GFP) vector (Shanghai Jikai Industry, Co., Shanghai, China) was double enzyme digested by AgeI and EcoRI at 37°C for 1 h, and gel electrophoretic recovery of the linear pGCSIL-GFP fragments was performed. The annealed, double-stranded DNA and linear pGCSIL-GFP fragments were connected using T4 ligase (Takara Biotechnology Co., Ltd.) at 4°C for 16 h. The pGCSIL-GFP-shRNA connection products were used to transform DH5α competent cells (Takara Biotechnology Co., Ltd.), and the transformed competent cells were then shifted into antibiotic LB medium containing ampicillin (Shanghai Solarbio Bioscience & Technology Co., Ltd., Shanghai, China), at 37°C for 16 h. A single colony was selected to undergo PCR. The PCR primers were as follows: Upstream, 5′-CCTATTTCCCATGATTCCTTCATA-3′; and downstream, 5′-GTAATACGGTTATCCACGCG-3′. The PCR reaction conditions comprised initial denaturation at 94°C for 30 sec; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 30 sec (30 cycles); and then extension at 72°C for 6 min. The PCR products were subjected to 2% agarose gel electrophoresis. Following the selection of the single colony and the agitation of the bacteria, the plasmid was extracted for sequencing.

Lentiviral packaging

293T cells (Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China) were cultured in DMEM containing 10% fetal bovine serum in a 37°C incubator with 5% CO2. One day before transfection, the logarithmic growth phase cells were inoculated at a density of 6×108/l in 15-cm cell culture dishes (70–80% confluence at the time of transfection). At 2 h before transfection, the cell medium was changed to serum-free medium. The lentiviral shuttle plasmid, lentiviral packaging plasmid and transfection reagent Lipofectamine™ 2000 (Invitrogen; Life Technologies) were mixed to form transfection complexes, which were co-transfected into 293T cells. At 8 h after transfection, the medium was replaced with fresh medium containing 10% serum and the cells were then cultured for a further 48 h, prior to the culture supernatant being collected, centrifuged at 4,000 × g for 10 min and filtered with a 0.45-µM filter. The concentrated vector, which was referred to as lentivirus-shTNF, was stored at −80°C until use.

Determination of virus titer

The 293T cells that were used for virus transfection were inoculated in 96-well plates at a density of 4×104/well and cultured in a 37°C incubator with 5% CO2 for 24 h. A total of 90 µl culture medium was removed and 90 µl serial dilution of virus stock was added, prior to further culture for 24 h and the replacement of the medium. After 96 h, the green fluorescence expression was observed under a fluorescence microscope. The wells in which ~5 fluorescent cells as well as the corresponding dilution ratio were recorded (fluorescent cells were counted independently by 2 specifically assigned individuals). The virus titer was calculated using the following formula: Virus titer (TU/µl) = number of fluorescent cells/corresponding dilution ratio.

Statistical analysis

The software SigmaStat 11.0 (Systat Software, Inc., San Jose, CA, USA) was used for data processing. Quantitative data are expressed as the mean ± standard error of the mean; comparisons among the groups were performed using one-way analysis of variance, and the Dunnett's t-test was used for comparisons between the experimental groups and the control group. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of TNF-α, IL-1β and IL-6 mRNA

The relative mRNA expression levels of TNF-α in the siRNA1, siRNA2, siRNA3 and negative control groups were, respectively, 0.24±0.01, 0.16±0.02, 0.19±0.01 and 0.95±0.02. Significant differences were found in the expression levels between each group (F=531.3, P<0.0001). As compared with the negative control group, the mRNA inhibition rates were 74.26, 83.09 and 79.93% for siRNA1, siRNA2 and siRNA3, respectively. The relative mRNA expression levels of IL-1β in the siRNA1, siRNA2, siRNA3 and negative control groups were, respectively, 0.93±0.04, 0.93±0.02, 0.92±0.02 and 0.93±0.03, and no significant differences were found among the groups (F=0.981, P=0.9807). The relative mRNA expression levels of IL-6 in the siRNA1, siRNA2, siRNA3 and negative control groups were, respectively, 0.96±0.04, 1±0.07, 0.92±0.03 and 0.94±0.01, and no significant differences were found among the groups (F=0.739, P=0.5867), as shown in Fig. 1.

Figure 1.

Relative mRNA expression levels of TNF-α, IL-β and IL-6 in RAW264.7 cells of different groups. Data are expressed as the mean ± standard error of the mean. *P<0.05 vs. negative control. TNF-α, tumor necrosis factor-α; IL, interleukin; siRNA, small interfering RNA.

TNF-α protein expression

The protein expression levels of TNF-α in the siRNA1, siRNA2, siRNA3 and negative control groups were 23.95±1.21, 17.27±1.46, 19.07±1.57 and 35.37±2.93 ng/ml respectively, and significant differences were found between the groups (F=18.1, P=0.0006). Compared with the negative control, the TNF-α protein expression inhibition rates were 32.29, 51.16 and 46.08%, respectively. The protein expression levels in the blank and reagent control groups were 34.75±1.67 and 30.48±1.701 ng/ml, respectively, and no significant difference was found compared with the levels in the negative control group (F=1.49, P=0.30), as shown in Fig. 2.

Figure 2.

TNF-α protein expression levels of different RAW264.7 groups. Data are expressed as the mean ± standard error of the mean.**P<0.01 vs. negative control. TNF-α, tumor necrosis factor-α; siRNA, small interfering RNA.

qPCR

The recombinant lentiviral plasmid PCR amplification product was 343 bp, the empty-vector PCR product was 306 bp and the insert fragment was 61 bp; these results were consistent with the expectation. It should ne noted that there were 4 restriction enzyme sites in the pGCSIL-GFP vector between the AgeI and EcoRI sites, with a total length of 24 bp; therefore, the products were as follows: 306 bp – 24 bp + insert fragment = 343 bp, as shown in Fig. 3.

Figure 3.

Electrophoresis map of the polymerase chain reaction products. Lane 1, non-constructed vector negative control; lane 2, Marker; lane 4, negative clone; lanes 3 and 5–7, positive clones.

DNA sequencing

DNA sequencing revealed that the pGCSIL-GFP-shRNA sequencing reaction was interrupted, but the presence of an insertion sequence was indicated, as shown in Fig. 4.

Figure 4.

Recombinant plasmid DNA sequencing graph (part). The underlined region indicates the detected insertion sequence.

Lentiviral packaging and identification

The lentiviral shuttle and packaging plasmids were co-transfected into the 293T cells. After 48 h, it was visible that cells were growing well, and the fluorescence expression was strong under the fluorescence microscope. After 96 h, it was observed under the fluorescence microscope that the number of fluorescent cells decreased as the dilution ratio increased. The lentiviral titer was calculated to be 2×106 TU/µl, as shown in Fig. 5.

Figure 5.

Green fluorescent protein expression of 293T cells transfected with lentiviral plasmids. (A) Light microscopy; (B) fluorescence microscopy (multiplicity of infection=0.5; scale bar=200 µm).

Discussion

TNF-α is the key cytokine leading to inflammatory joint diseases (9); therefore, the aim of the present study was to construct RNAi lentiviral vectors targeting the mouse TNF-α gene, providing a basis for RNAi gene therapy. Developing an efficient interference fragment and effective gene transfer method is fundamental in RNAi gene therapy.

In this study, three pairs of siRNA targeting TNF-α were designed, synthesized and screened at the cellular level. RAW264.7 mouse macrophage cells are commonly used as inflammatory cell models, expressing high levels of TNF-α following stimulation by LPS (16,17), and can thus be used for siRNA screening. Following the transfection of the siRNA into the RAW264.7 cells and the administration of the LPS stimulus, the RNAi gene silencing effect was detected at the mRNA and protein levels. The results showed that the expression inhibition of the three siRNAs on TNF-α at the mRNA and protein levels was significantly different compared with that in the control group; siRNA2 exhibited the highest inhibitory effect at both investigated levels and was selected as the highest silence efficiency interference sequence for follow-up study.

The inhibition of TNF-α expression was expected be accompanied by a decrease in the expression of IL-1β, IL-6 and other inflammatory factors, as TNF-α can further induce the generation of IL-1β and IL-6; however, the results showed that RNAi targeting the TNF-α gene had no significant effect on the mRNA expression of IL-1β or IL-6. This may have been a result of the fact that, although the application of the siRNA inhibited the expression of TNF-α, the inflammatory cell model was still in existence due to the LPS stimulation, and the combination of LPS and the RAW264.7 cell surface receptor was still able to induce the generation of IL-1β and IL-6 via the activation of nuclear factor-κB. The results therefore showed the specificity of the RNAi.

In the present study, the siRNA was transfected into the RAW264.7 cells, which were then stimulated by LPS; 7 h after transfection, the gene silencing effect was observed. A study involving the J774.1 mouse macrophage cell line described similar results to those in the present study (15); however, the study reported that the gene silencing effect of siRNA was observed at the mRNA level >24 h after transfection and at the protein level >48 h after transfection.

Liposomes and electrotransfection are common methods of gene transfection; however, the target gene fragments following transfection are easily degraded and, following electrotransfection, cells have a low survival rate and low availability in clinical experiments (18,19). Viral vectors, such as adenovirus, adeno-associated virus and lentiviral vectors, have been widely used in molecular biology; however, adenoviruses are difficult to transfect into monocytes (20). It has previously been shown that lentiviral vectors can be used in numerous types of cells that are difficult to transfect, including monocytes (6–8,21). In addition, lentiviral vectors can result in the integration of the interference fragment of the target gene into the genome, enabling the long-term suppression of target gene expression. This is particularly advantageous for in vitro and in vivo experimental studies and, therefore, a lentiviral vector was selected for use in the RNAi in the present study.

In this study, the pGCSIL-GFP vector containing a U6 promoter was used as the interference plasmid, which enabled the sustained expression of shRNA in the host cells, as well as the concurrent expression of GFP. In the identification of the recombinant lentiviral shuttle plasmid PCR product, electrophoresis showed that a 61-bp target fragment was inserted in the positive clones. DNA sequencing only showed a partial insertion sequence, which may have been due to the readiness of shRNA to form a secondary structure (22,23). PCR product electrophoresis and DNA sequencing determined that the recombination was successful. In addition to the pGCSIL-GFP vector, the recombinant lentivirus packaging system must contain a packaging vector with the other elements and capsid protein for lentiviral packaging. The use of 293T cells as the virus packaging cells can produce high-titer virus particles, which can be used to detect the virus packaging effect and infection efficiency of target cells. The virus titer in the present study was found to be 2×106 TU/µl, indicating usefulness for subsequent in vitro and in vivo experimental studies.

In conclusion, an RNAi lentiviral vector targeting the TNF-α gene was in constructed the present study; the vector construction was found to be successful and, following packaging and concentration, high-titer lentiviral vectors were obtained. The findings of this study provide a basis for subsequent experimental study of RNAi gene therapy targeting TNF-α.

Acknowledgements

This study was supported by the Scientific Research Award Fund of Shandong Province Outstanding Young Scientist.

References

1 

Chen SY, Shiau AL, Li YT, Lin YS, Lee CH, Wu CL and Wang CR: Suppression of collagen-induced arthritis by intra-articular lentiviral vector-mediated delivery of Toll-like receptor 7 short hairpin RNA gene. Gene Ther. 19:752–760. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Sakuma T, Barry MA and Ikeda Y: Lentiviral vectors: Basic to translational. Biochem J. 443:603–618. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Gouze E, Pawliuk R, Pilapil C, Gouze JN, Fleet C, Palmer GD, Evans CH, Leboulch P and Ghivizzani SC: In vivo gene delivery to synovium by lentiviral vectors. Mol Ther. 5:397–404. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Lewis PF and Emerman M: Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus. J Virol. 68:510–516. 1994.PubMed/NCBI

5 

Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM and Trono D: In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 272:263–267. 1996. View Article : Google Scholar : PubMed/NCBI

6 

Wilson AA, Kwok LW, Porter EL, Payne JG, McElroy GS, Ohle SJ, Greenhill SR, Blahna MT, Yamamoto K, Jean JC, et al: Lentiviral delivery of RNAi for in vivo lineage-specific modulation of gene expression in mouse lung macrophages. Mol Ther. 21:825–833. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Wollebo HS, Woldemichaele B and White MK: Lentiviral transduction of neuronal cells. Methods Mol Biol. 1078:141–146. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Houbracken I, Baeyens L, Ravassard P, Heimberg H and Bouwens L: Gene delivery to pancreatic exocrine cells in vivo and in vitro. BMC Biotechnol. 12:742012. View Article : Google Scholar : PubMed/NCBI

9 

Moelants EA, Mortier A, Van Damme J and Proost P: Regulation of TNF-α with a focus on rheumatoid arthritis. Immunol Cell Biol. 91:393–401. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K and Tuschl T: Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411:494–498. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Svoboda P: Off-targeting and other non-specific effects of RNAi experiments in mammalian cells. Curr Opin Mol Ther. 9:248–257. 2007.PubMed/NCBI

12 

Lin X, Yu Y, Zhao H, Zhang Y, Manela J and Tonetti DA: Overexpression of PKCalpha is required to impart estradiol inhibition and tamoxifen-resistance in a T47D human breast cancer tumor model. Carcinogenesis. 27:1538–1546. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Qiu Z, Huang C, Sun J, Qiu W, Zhang J, Li H, Jiang T, Huang K and Cao J: RNA interference-mediated signal transducers and activators of transcription 3 gene silencing inhibits invasion and metastasis of human pancreatic cancer cells. Cancer Sci. 98:1099–1106. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Ai Z, Yin L, Zhou X, Zhu Y, Zhu D, Yu Y and Feng Y: Inhibition of survivin reduces cell proliferation and induces apoptosis in human endometrial cancer. Cancer. 107:746–756. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Khoury M, Louis-Plence P, Escriou V, Noel D, Largeau C, Cantos C, Scherman D, Jorgensen C and Apparailly F: Efficient new cationic liposome formulation for systemic delivery of small interfering RNA silencing tumor necrosis factor alpha in experimental arthritis. Arthritis Rheum. 54:1867–1877. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Zhu ZG, Jin H, Yu PJ, Tian YX, Zhang JJ and Wu SG: Mollugin inhibits the inflammatory response in lipopolysaccharide-stimulated RAW264.7 macrophages by blocking the Janus kinase-signal transducers and activators of transcription signaling pathway. Biol Pharm Bull. 36:399–406. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Qureshi AA, Guan XQ, Reis JC, Papasian CJ, Jabre S, Morrison DC and Qureshi N: Inhibition of nitric oxide and inflammatory cytokines in LPS-stimulated murine macrophages by resveratrol, a potent proteasome inhibitor. Lipids Health Dis. 11:762012. View Article : Google Scholar : PubMed/NCBI

18 

Kusumawati A, Commes T, Liautard JP and Widada JS: Transfection of myelomonocytic cell lines: Cellular response to a lipid-based reagent and electroporation. Anal Biochem. 269:219–221. 1999. View Article : Google Scholar : PubMed/NCBI

19 

Liao HS, Kodama T, Doi T, Emi M, Asaoka H, Itakura H and Matsumoto A: Novel elements located at −504 to −399 bp of the promoter region regulated the expression of the human macrophage scavenger receptor gene in murine macrophages. J Lipid Res. 38:1433–1444. 1997.PubMed/NCBI

20 

Wirtz S, Becker C, Blumberg R, Galle PR and Neurath MF: Treatment of T cell-dependent experimental colitis in SCID mice by local administration of an adenovirus expressing IL-18 antisense mRNA. J Immunol. 168:411–420. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Lee JS, Hmama Z, Mui A and Reiner NE: Stable gene silencing in human monocytic cell lines using lentiviral-delivered small interference RNA. Silencing of the p110alpha isoform of phosphoinositide 3-kinase reveals differential regulation of adherence induced by 1alpha,25-dihydroxycholecalciferol and bacterial lipopolysaccharide. J Biol Chem. 279:9379–9388. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Guo Y, Liu J, Li YH, Song TB, Wu J, Zheng CX and Xue CF: Effect of vector-expressed shRNAs on hTERT expression. World J Gastroenterol. 11:2912–2915. 2005. View Article : Google Scholar : PubMed/NCBI

23 

McIntyre GJ and Fanning GC: Design and cloning strategies for constructing shRNA expression vectors. BMC Biotechnol. 6:12006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang J, Liang H, Zhao Y, Liu X, Yang K and Sui A: Construction and identification of an RNA interference lentiviral vector targeting the mouse TNF-α gene. Exp Ther Med 10: 2283-2288, 2015.
APA
Wang, J., Liang, H., Zhao, Y., Liu, X., Yang, K., & Sui, A. (2015). Construction and identification of an RNA interference lentiviral vector targeting the mouse TNF-α gene. Experimental and Therapeutic Medicine, 10, 2283-2288. https://doi.org/10.3892/etm.2015.2813
MLA
Wang, J., Liang, H., Zhao, Y., Liu, X., Yang, K., Sui, A."Construction and identification of an RNA interference lentiviral vector targeting the mouse TNF-α gene". Experimental and Therapeutic Medicine 10.6 (2015): 2283-2288.
Chicago
Wang, J., Liang, H., Zhao, Y., Liu, X., Yang, K., Sui, A."Construction and identification of an RNA interference lentiviral vector targeting the mouse TNF-α gene". Experimental and Therapeutic Medicine 10, no. 6 (2015): 2283-2288. https://doi.org/10.3892/etm.2015.2813
Copy and paste a formatted citation
x
Spandidos Publications style
Wang J, Liang H, Zhao Y, Liu X, Yang K and Sui A: Construction and identification of an RNA interference lentiviral vector targeting the mouse TNF-α gene. Exp Ther Med 10: 2283-2288, 2015.
APA
Wang, J., Liang, H., Zhao, Y., Liu, X., Yang, K., & Sui, A. (2015). Construction and identification of an RNA interference lentiviral vector targeting the mouse TNF-α gene. Experimental and Therapeutic Medicine, 10, 2283-2288. https://doi.org/10.3892/etm.2015.2813
MLA
Wang, J., Liang, H., Zhao, Y., Liu, X., Yang, K., Sui, A."Construction and identification of an RNA interference lentiviral vector targeting the mouse TNF-α gene". Experimental and Therapeutic Medicine 10.6 (2015): 2283-2288.
Chicago
Wang, J., Liang, H., Zhao, Y., Liu, X., Yang, K., Sui, A."Construction and identification of an RNA interference lentiviral vector targeting the mouse TNF-α gene". Experimental and Therapeutic Medicine 10, no. 6 (2015): 2283-2288. https://doi.org/10.3892/etm.2015.2813
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team