Electric pulse current stimulation increases electrophysiological properties of If current reconstructed in mHCN4-transfected canine mesenchymal stem cells
- Authors:
- Published online on: February 11, 2016 https://doi.org/10.3892/etm.2016.3072
- Pages: 1323-1329
-
Copyright: © Feng et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
The sinoatrial node (SAN) is located in the right dorsal wall of the right atrium, and serves as the primary pacemaker for initiating the heartbeat and controlling the rate and rhythm of contraction (1). Deficiencies in such function due to congenital defects, acquired diseases, gene mutation and aging may lead to sinus node dysfunction (sick sinus syndrome), necessitating pacemaking therapy (2). The present primary therapy is electronic pacemaker implantation. However, such devices are not optimal because of the limited battery life, biological responsiveness deficiency and other shortages (2). With respect to these concerns, on-going research is focused on developing a biological pacemaker that is able to integrate into the myocardium and provide a permanent cure (2–5).
The ‘funny’ current, also called the If current, is crucially involved in the spontaneous diastolic depolarization of SAN cells. The If current is generated by the hyperpolarization-activated cyclic nucleotide-gated channel (HCN) family. Among the four known HCN isoforms, isoform 4 (encoded by HCN4) strongly contributes to pacemaker function (3). In previous studies, the present authors showed that mouse HCN4 (mHCN4)-transfected mesenchymal stem cells (MSCs) are able to generate a functional If current (3–5).
The heart is the largest source of bioelectricity in the human body (6,7). Electrical signals are correlated with cardiac depolarization and contraction, and electrical currents have been administered to cells in order to mimic native heart conditions in a number of prior biomimetic studies (7–9). Furthermore, an electrical stimulation system has been designed to deliver electrical signals mimicking those in the native heart by the present authors (10). This electric pulse current stimulation (EPCS) had been shown to be safe in canine MSCs (cMSCs), and may be able to promote cardiogenesis in cMSCs in our previous study (10). However, it is not clear whether EPCS is able to influence the properties of If current reconstructed in HCN4-transfected cMSCs.
In the present study, cMSCs with high-level expression of mHCN4 were produced using exogenous transfection. The kinetic characteristics of the resulting If current were analyzed. In addition, the mRNA and protein expression levels of HCN4, connexin 43 (Cx43) and Cx45 were evaluated using reverse transcription-quantitative polymerase chain reaction (RT-qpcr) and western blot assays, and the ultrastructures of the cardiac connective proteins were characterized using transmission electron microscopy (TEM).
Materials and methods
cMSC culture
Under 30 mg/kg sodium pentobarbital (i.v.) and 1–2% isoflurane anesthesia (Abbott Laboratories Co., Ltd., Shanghai, China), cMSCs were harvested from bone marrow of three adult Chinese rural canines (two males and one female; Third Military Medical University (Chongqing, Chian), weighing 10–14 kg, as previously described (5). cMDCs were cultured in α-minimum essential medium (α-MEM) with L-glutamine and ribo- and deoxyribonucleosides (SH30265.01B; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA). cMSC purity was evaluated using flow cytometry, as previously described (5), in order to detect the markers CD29+, CD44+, CD34- and CD45-, and by the ability to differentiate into adipogenic, chondrogenic and osteogenic lineages, using Oil Red O, Alcian Blue and Toluidine Blue, and Alizarin Red staining, respectively (5). Third generation cMSCs were transfected with pLentis-mHCN4-GFP in the presence of 2 µg/ml polybrene (H9268; Sigma-Aldrich, St. Louis, MO, USA) at a multiplicity of infection (MOI) of 20 for 24 h. Following 48 h of transfection, 90% of the cMSCs cells exhibited green fluorescent protein (GFP) expression, which indicated successful transfection. These cMSCs were expanded using standard techniques (3–5,10). In order to produce consistent comparisons between mHCN4-transfected cMSCs with or without EPCS induction, the cells were divided into two groups: mHCN4-transfected cMSCs (group A), and mHCN4-transfected cMSCs induced with EPCS (group B). Ethical approval for the present study was obtained from the Committee on the Ethics of Animal Experiments of Third Military Medical University (SYXK2013-0012).
mHCN4 transfection
The lentiviral vector expressing mHCN4 (pLentis-mHCN4-GFP) was constructed by inserting the mHCN4 gene into a pLentis-GFP vector using BamHI (FD0054) and EcoRI (N41890) restriction sites, using materials obtained from Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The transcription of mHCN4 was promoted by a Spleen Focus-Forming Virus promoter (Invitrogen). The lentiviral particles were prepared using a calcium phosphate method, as previously described (3–5).
EPCS induction
An electric stimulation device designed in our lab provided a constant electric signal to the cMSCs, which had been shown to be safe to cMSCs and to promote cardiogenesis in cMSCs. The property of the electrical signal was pulse polarity-altered positive and negative variations (rectangular, 2 msec; current intensity, 40 µA; current frequency, 2 Hz) (10). For EPCS, the transfected GFP-positive cells in group B were reseeded in α-MEM at a density of 2×105 cells into 60-mm culture dishes (430166; Corning Incorporated, Corning, NY, USA) with platinum electrode (Chow Sang Sang Jewellery Corporation, Hong Kong, China). The EPCS treatment was initiated on the next day after seeding, lasting 3–6 h per day for 5 days until the cells reached ~95% confluence. α-MEM was changed once during this treatment period. Each experiment was repeated three times.
Patch clamp studies for If current detection in transfected cMSCs
Following EPCS induction for 5 days, the cMSCs in group B and parallel cMSCs in group A were subjected to whole-cell patch clamp detection. The If current was recorded using a voltage clamp (Axon Instruments. Foster City, CA, USA) with an Axopatch 200B amplifier (Molecular Devices, LLC, Sunnyvale, CA, USA) (3–5). The pipette solution contained the following (in mmol/l): 5.0 Na2-phosphocreatine, 5.0 Mg2-adenosine triphosphate, 110 K aspartate, 0.1 GTP (Sigma-Aldrich), 1.0 MgCl2, 20 KCl, 0.05 EGTA and 10 HEPES (Sangon Biotech Co., Ltd., Shanghai, China); pH was adjusted to 7.2 with KOH (Zhengzhongyi Biotech Co., Ltd., Beijing, China). The extracellular solution contained the following (in mmol/l): 0.33 NaH2PO4, 1.0 MgCl2, 1.8 CaCl2, 5.4 KCl, 136 NaCl, 10 glucose and 10 HEPES; pH was adjusted to 7.4 with NaOH (Sangon Biotech Co., Ltd.). When required, 4 mmol/l CsCl was added into the bath solution. Cs+ is a specific pacemaker current blocker to block If current and has been used to confirm the If current. The sealing resistance was >4 mΩ and the temperature was maintained at 25±1°C.
In preparation for patch clamping, cells were trypsinized (SH30042.01; Hyclone; GE Healthcare Life Sciences) for 10–20 sec, while remaining attached to the coverslips. The membrane capacity was measured by the application of a voltage clamp step, and current density was shown as the value of the peak current per capacity. If current was detected using custom voltage clamp methods, as previously described (3–5). Normalized tail currents were recorded to construct the fully activated current-voltage relation. The slope factor (k) and the half-maximal activation voltage (V1/2) were obtained by fitting the activation curves to the Boltzmann equation, as follows: Itail/Imax = A/{1.0 + exp [(V-V1/2)/k]}. The time constants of activation were determined by fitting current traces to a single exponential function.
Immunofluorescence analysis
Immunofluorescence was performed according to previously reported methods (10). Transfected cMSCs (1.5×104 cells/cm2) were fixed with 4% paraformaldehyde (Wuhan Boster Biological Technology, Ltd., Wuhan, China) for 15 min at room temperature, washed in phosphate-buffered saline (PBS; AR0030; Wuhan Boster Biological Technology, Ltd.), then treated with 0.2% Triton X-100 (T8787; Sigma-Aldrich) for 15 min. Cells were incubated with rabbit polyclonal anti-HCN4 antibody (1:100; ab69054; Abcam, Cambridge, UK) overnight at 4°C. Following washing three times with PBS for 5 min, the cells were incubated with Alexa FluorTM 647-conjugated donkey anti-rabbit IgG (1:200; A-31573; Invitrogen) for 60 min at 25±1°C. After further washing with PBS, the cells were mounted with Antifade Mounting Medium (Beyotime Institute of Biotechnology, Shanghai, China). Nuclei were stained with 4′,6-diamidino-2-phenylindole (D9542; Sigma-Aldrich) as a location control. Fluorescent images were obtained using an inverted laser confocal microscope (LSM 710; Carl Zeiss Microscopy GmbH, Cologne, Germany). The results were analyzed using ZEN lite software, 2011 edition (Carl Zeiss Microscopy GmbH).
TEM
Cells were fixed in caco-dylate-buffered 1% osmium tetroxide, then dehydrated and embedded in Epon 812 (both Sangon Biotech Co., Ltd.) for ultra-thin sectioning. The ultrastructures of connection protein were examined by TEM using a TecnaiTM-10 electron microscope (FEI Company, Hillsboro, OR, USA) and operated at a high-tension setting of 80 kV with a magnification of x135,000.
RT-qpcr analysis
RT-qPCR was conducted according to previously described methods (11). Briefly, total mRNA was extracted using TRIzol (Invitrogen) and purified. For RNA purification, the RNA was treated with chloroform, centrifuged at 12,000 × g for 15 min at 4°C to collect the supernatant prior to treatment with isoamylalcohol and vortexing for 10 min at room temperature. Following centrifugation at 12,000 × g for 15 min at 4°C, the supernatant was discarded and the subsequent sediment RNA was reverse transcribed into cDNA at 37°C for 15 min and 98°C for 5 min using a ReverTra Ace qPCR RT kit (FSQ-101; Toyobo Co., Ltd., Osaka, Japan). RT-qPCR amplification was performed using a 12.5 µl SYBR® Green (2X) Realtime PCR Master Mix kit (QPK-201; Toyobo Co., Ltd.), 1 µl forward primer, 1 µl reverse primer, 5 µl cDNA and 5.5 µl water on a Stratagene Mx3000P qPCR system (Agilent Technologies, Inc., Santa Clara, CA, USA), according to the manufacturer's instructions. Thermal cycling was performed as follows: 95°C for 30 sec, followed by 40 cycles of 95°C for 30 sec, 60°C for 30 sec and 72°C for 20 sec, and 72°C for 10 min prior to holding at 4°C. The primer sequences used were designed as follows: HCN4 forward, 5′-AGTTGCGTTTCGAGGTCTT-3′ and reverse, 5′-CTTTGTTGCCCTTAGTGAGC-3′; Cx43 forward, 5′-TGCTATGACAAATCCTTCCCAATC-3′ and reverse, 5′-GCCGTGCTCTTCAATTCCATACTT-3′; Cx45 forward, 5′-CAGCAGACTTCCTTGCCCTCATA-3′ and reverse, 5′-CTTAGCATTGGACAGTTCGGTGT-3′; GAPDH forward, 5′-GAGATCCCGCCAACATCAAA-3′ and reverse, 5′GGCATCAGCAGAAGGAGCAG3′ (Invitrogen). Quantitative measurements were determined using the comparative Ct (2-ΔΔCq) method (12). All samples were normalized against the endogenous level of GAPDH. All results were repeated in triplicate and were analyzed using MxPro-Mx3000P software (Agilent Technologies, Inc.).
Western blot analysis
Western blot assays were performed according to previously described methods (10,11,13). Briefly, cMSCs were lysed with RIPA buffer containing phenylmethylsulfonyl fluoride (Sangon Biotech Co., Ltd.), then 50 µg total protein was quantitated using a BCA protein assay kit (P0009; Beyotime Institute of Biotechnology) and subjected to 6–10% SDS-PAGE. After being resolved by electrophoresis, the proteins were transferred to a polyvinylidene fluoride membrane (EMD Millipore, Billerica, CA, USA), blocked for 3 h at room temperature in Tris-buffered saline (TBS) with 5% bovine serum albumin (10099–141; Gibco; Thermo Fisher Scientific, Inc.), and incubated with anti-HCN4 (1:100; ab69054; Abcam), anti-Cx43 (1:200; sc-9059; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), anti-Cx45 (1:200; sc-25716) rabbit and GAPDH (1:200; sc-48166; Santa Cruz Biotechnology, Inc.) goat polyclonal antibodies overnight at 4°C, with gentle agitation. After washing three times with TBS with Tween-20, the membranes were incubated with corresponding horseradish peroxidase-conjugated mouse anti-rabbit polyclonal IgG (1:5,000; sc-2357; Santa Cruz Biotechnology, Inc.) at room temperature for 2 h. The specific bands of the target proteins were visualized using an enhanced chemiluminescence detection kit (P0018A; Beyotime Institute of Biotechnology), according to the manufacturer's recommendations. Finally, the target signals were normalized against the GAPDH signal and analyzed using Quantity One software (version 4.62; Bio-Rad Laboratories, Inc., Hercules, CA, USA). Standard curve concentrations were 0.025, 0.05, 0.1, 0.2, 0.3, 0.4 and 0.5 µg/µl, respectively with the wavelength set to 562 nm in UV. Experiments were performed >3 times to verify quantification values.
Statistical analysis
All values are presented as the mean ± standard error of the mean. Statistical comparisons were analyzed using Student's unpaired t-test with SPSS 19.0 software (IBM SPSS, Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.
Results
Demonstration of gene transfer
At an MOI of 20, the transfection rate of the cMSCs was 95±3.7%, which was confirmed by confocal laser microscope images in at least two different random fields. The mHCN4-GFP-transfected cMSCs in groups A and B expressed GFP and HCN4 protein (Fig. 1).
Characteristics of If in transfected cMSCs
The If characteristics were recorded in whole cell patch-clamp mode. The mHCN4-GFP transfected cMSCs in group A showed a time and voltage dependent inward current (Fig. 2A). The current amplitude was −1,081.5±15.4 pA at −160 mV command voltage, and the current density was −45.6±7.7 pA/pF at the same voltage. The V1/2 was −101.2±4.6 mV, the time constant of activation was 324±41 msec at −160 mV, similar to values for HCN4 expression in cardiac myocytes (14). The voltage protocol (Fig. 2D) enabled the measurement of the reversal potential (Fig. 2E), which was −26.4±3.8 mV. The detection rate of this inward current was 76% (16/21). It was also investigated whether Cs+, a specific pacemaker current blocker, was able to block this expressed current. This inward current was blocked following the external addition of 4 mmol/l Cs+ (Fig. 2B), consistent with Cs+ inhibition of If as previously reported (3–5).
Under the same recording conditions, the detection rate of the If current was similar in the EPCS inductive group B (77%, 17 of 22). The channel activation curve shifted to right (Fig. 2F), which indicated that the current curve depicted a positive forward reaction. The V1/2 changed to −92.4±4.8 from −101.2±4.6 mV (P<0.05; Table I), while the absolute values of If channel reversal potential increased (−28.9±3.0 vs. −26.4±3.8 mV, P<0.05). The time constant of activation decreased to 251±44 msec at −160 mV (P<0.05).
Table I.Comparative data measured for If in mHCN4-transfected canine mesenchymal stem cells in groups A and B. |
Expression of gap junction proteins
For consistent comparisons in mHCN4 transfected cMSCs with or without EPCS induction, the gap junctions between adjacent cells were analyzed using TEM (Fig. 3). Following EPCS induction, the cMSCs showed an increased expression of gap junctions as Fig. 3B. In addition, the mRNA and protein expression levels of Cx43 and Cx45 in each group were evaluated using RT-qPCR and western blot analyses. As shown in Fig. 4, the mRNA expression levels of HCN4, Cx43 and Cx45 were significantly increased in EPCS inductive group B compared with group A (P<0.05). The protein expression levels of HCN4, Cx43 and Cx45 were also upregulated in group B, as shown in Fig. 5.
Discussion
Due to the limited ethical restrictions and immune privilege, MSCs are currently the optimal candidate for biological pacemaker reconstruction (3–5). In our previous studies, we demonstrated that mHCN4-transfected cMSCs can express HCN4 protein stably and produce an If pacemaker current in vitro and in vivo (3,4). Wen et al previously reported that cMSCs are able to differentiate into cardiomyocytes by treatment with EPCS (10). The aim of the present study was to investigate the effects of EPCS on the If channel reconstructed in mHCN4-transfected cMSCs.
The HCN gene family is responsible for the generation of the pacemaker If current. The isoform HCN4 has been demonstrated to be important for the proper function of pacemaking (3). The heart is the largest source of bioelectricity in the human body, and numerous studies have investigated the effects of applying electrical stimulation signals to heart (6–10). In cardiac tissue engineering studies, biomimetic systems mimicking electrical signals in native heart have been used to enhance functional coupling of the cells and to increase the amplitude of synchronous construct contractions (6–10). An electric stimulation system had been designed in the Department of Cardiology at Southwest Hospital, Third Military Medical University to deliver electrical signals mimicking those in the native heart. This EPCS system had been shown to be safe for use in cMSCs, and successfully promoted the cardiogenesis of cMSCs in our previous study (10). The present study demonstrated that mHCN4-expressing cMSCs are capable of generating a time- and voltage- dependent inward current. This current is quite sensitive to extracellular Cs+ and has similar channel kinetic characteristics as physiological HCN4 If current (14). Following EPCS conduction, the channel activation curve shifted to the right and the time constant of activation decreased. TEM images showed more gap junctions in the EPCS inductive group. Therefore, it was hypothesized that these changes in the If current may be associated with the variation of gap junctions.
Gap junctions can establish communication channels between adjacent cells and allow direct intercellular transfer of ions, small molecules and electrical coupling (15). Gap junctions are composed of Cx protein subunits, and there are 21 members in the Cx gene family in the human genome and 20 members in the mouse to date (16). Cx40, Cx43 and Cx45 are expressed in cardiac tissues with distinct distributions. Cx45 is predominantly expressed in SAN, and is able to assemble gap junction channels with low conduction. By contrast, Cx40 and Cx43 are primarily expressed in working myocardium and can form gap junction channels with high conduction. Notably, a number of studies have suggested that Cx43 may also be expressed in SAN (16,17). Mutations in Cx43 may result in cardiac malformations and related to atrial fibrillation and sudden infant death syndrome (18,19). Recently, Yamada et al reported that Cx45 expression was markedly increased in patients with heart failure, and the upregulation of Cx45 in cardiac myocytes may lead to increased arrhythmias in the failing heart, which may impact the downregulation of Cx43 (20,21).
In the present study, the expression fold changes of Cx43 and Cx45 were evaluated in mHCN4 genetically modified cMSCs in vitro. The mRNA and protein expression levels of Cx43 and Cx45 were detected in mHCN4-transfected cMSCs. Following EPCS induction, the expression of Cx43, Cx45 and HCN4 were significantly increased. Under the same conditions, reduced Cx43 expression and barely detectable Cx45 expression were detected in GFP-transfected cMSCs, indicating that mHCN4 is able to promote the expression of gap junction proteins, and that EPCS enhanced this effect. Collectively, the present results indicate that the activation and amplification of mHCN4 may promote the cardiac differentiation progress of cMSCs. In our previous study, we performed preliminary experiments using fluorescence recovery after photo bleaching to determine whether mHCN4-transfected cMSCs could form functional gap junctions (22). The average fluorescence recovery rate of mHCN4-transfected cMSCs co-cultured with neonatal rat atrial cells was obviously increased compared with those of GFP-transfected cMSCs co-cultured with neonatal rat atrial cells, and it was same as cultured neonatal rat atrial cells (data not shown). These results suggest that mHCN4-transfected cMSCs are able to assemble functional gap junctions, which is consistent with the findings of Valiunas et al (23).
In conclusion, the present results suggest that mHCN4-transfected cMSCs are able to generate pacemaker If current, and that EPCS enhanced this effect. In addition to the increased gap junctions and upregulated Cx43 and Cx45 expression, we infer that EPCS may promote the If current reconstructed in mHCN4 genetically modified cMSCs via the incremental gap junctions assembled by Cx43 and Cx45. In addition, this study may provide a reference for the future studies involving biological pacemaker reconstruction in canines, and may assist in the future development of gene-targeted and regenerative therapeutic remedies for SAN dysfunction in humans.
Acknowledgements
This study was supported by the National Natural Science Foundation of China (grant no. 81270246).
References
Van Mierop LH and Gessner IH: The morphologic development of the sinoatrial node in the mouse. Am J Cardiol. 25:204–212. 1970. View Article : Google Scholar : PubMed/NCBI | |
Miake J, Marbán E and Nuss HB: Biological pacemaker created by gene transfer. Nature. 419:132–133. 2002. View Article : Google Scholar : PubMed/NCBI | |
Tong S, Yao Q, Wan Y, Zhou J, Shu M, Zhong L, Li Y, Zhang Q, Yindai J and Song Z: Development of functional I f channels in mMSCs after transfection with mHCN4: Effects on cell morphology and mechanical activity in vitro. Cardiology. 112:114–121. 2009. View Article : Google Scholar : PubMed/NCBI | |
Nong Y, Zhang C, Wei L, Zhang Z, Cheng J, Wen L and Song Z: In situ investigation of allografted mouse HCN4 gene-transfected rat bone marrow mesenchymal stromal cells with the use of patch-clamp recording of ventricular slices. Cytotherapy. 15:905–919. 2013. View Article : Google Scholar : PubMed/NCBI | |
Jun C, Zhihui Z, Lu W, Yaoming N, Lei W, Yao Q and Zhiyuan S: Canine bone marrow mesenchymal stromal cells with lentiviral mHCN4 gene transfer create cardiac pacemakers. Cytotherapy. 14:529–539. 2012. View Article : Google Scholar : PubMed/NCBI | |
Hart RA and Gandhi OP: Comparison of cardiac-induced endogenous fields and power frequency induced exogenous fields in an anatomical model of the human body. Phys Med Biol. 43:3083–3099. 1998. View Article : Google Scholar : PubMed/NCBI | |
Tandon N, Cannizzaro C, Chao PH, Maidhof R, Marsano A, Au HT, Radisic M and Vunjak-Novakovic G: Electrical stimulation systems for cardiac tissue engineering. Nat Protoc. 4:155–173. 2009. View Article : Google Scholar : PubMed/NCBI | |
Radisic M, Marsano A, Maidhof R, Wang Y and Vunjak-Novakovic G: Cardiac tissue engineering using perfusion bioreactor systems. Nat Protoc. 3:719–738. 2008. View Article : Google Scholar : PubMed/NCBI | |
Radisic M, Park H, Chen F, Salazar-Lazzaro JE, Wang Y, Dennis R, Langer R, Freed LE and Vunjak-Novakovic G: Biomimetic approach to cardiac tissue engineering: Oxygen carriers and channeled scaffolds. Tissue Eng. 12:2077–2091. 2006. View Article : Google Scholar : PubMed/NCBI | |
Wen L, Zhang C, Nong Y, Yao Q and Song Z: Mild electrical pulse current stimulation upregulates S100A4 and promotes cardiogenesis in MSC and cardiac myocytes coculture monolayer. Cell Biochem Biophys. 65:43–55. 2013. View Article : Google Scholar : PubMed/NCBI | |
Zhao Q, Wang H, Yang M, Yang D, Zuo Y and Wang J: Expression of a tumor-associated gene, LASS2, in the human bladder carcinoma cell lines BIU-87, T24, EJ and EJ-M3. Exp Ther Med. 5:942–946. 2013.PubMed/NCBI | |
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
Gonen-Korkmaz C, Sevin G, Gokce G, Arun MZ, Yildirim G, Reel B, Kaymak A and Ogut D: Analysis of tumor necrosis factor α-induced and nuclear factor κB-silenced LNCaP prostate cancer cells by RT-qPCR. Exp Ther Med. 8:1695–1700. 2014.PubMed/NCBI | |
Stieber J, Herrmann S, Feil S, Löster J, Feil R, Biel M, Hofmann F and Ludwig A: The hyperpolarization-activated channel HCN4 is required for the generation of pacemaker action potentials in the embryonic heart. Proc Natl Acad Sci USA. 100:15235–15240. 2003. View Article : Google Scholar : PubMed/NCBI | |
Söhl G and Willecke K: Gap junctions and the connexin protein family. Cardiovasc Res. 62:228–232. 2004. View Article : Google Scholar : PubMed/NCBI | |
Kwong KF, Schuessler RB, Green KG, Laing JG, Beyer EC, Boineau JP and Saffitz E: Differential expression of gap junction proteins in the canine sinus node. Circ Res. 82:604–612. 1998. View Article : Google Scholar : PubMed/NCBI | |
Verheule S, van Kempen MJ, Postma S, Rook MB and Jongsma HJ: Gap junctions in the rabbit sinoatrial node. Am J Physiol Heart Circ Physiol. 280:H2103–H2115. 2001.PubMed/NCBI | |
Van Norstrand DW, Asimaki A, Rubinos C, Dolmatova E, Srinivas M, Tester DJ, Saffitz JE and Duffy HS: Connexin43 mutation causes heterogeneous gap junction loss and sudden infant death. Circulation. 125:474–481. 2012. View Article : Google Scholar : PubMed/NCBI | |
Salameh A, Blanke K and Daehnert I: Role of connexins in human congenital heart disease: The chicken and egg problem. Front Pharmacol. 4:702013. View Article : Google Scholar : PubMed/NCBI | |
Yamada KA, Rogers JG, Sundset R, Steinberg TH and Saffitz J: Up-regulation of connexin45 in heart failure. J Cardiovasc Electrophysiol. 14:1205–1212. 2003. View Article : Google Scholar : PubMed/NCBI | |
Betsuyaku T, Nnebe NS, Sundset R, Patibandla S, Krueger CM and Yamada KA: Overexpression of cardiac connexin45 increases susceptibility to ventricular tachyarrhythmias in vivo. Am J Physiol Heart Circ Physiol. 290:H163–H171. 2006. View Article : Google Scholar : PubMed/NCBI | |
Qin Y, Zhiyuan S, Shifei T and Zewen W: Study of differentiation of rat mesenchymal stem cells with mHCN4 gene into spontaneous cardiomyocyte-like cells in vitro. Zhong Guo Xin Zang Qi Bo Yu Xin Dian Sheng Li Za Zhi. 21:55–58. 2007. | |
Valiunas V, Doronin S, Valiuniene L, Potapova I, Zuckerman J, Walcott B, Robinson RB, Rosen MR, Brink PR and Cohen IS: Human mesenchymal stem cells make cardiac connexins and form functional gap junctions. J Physiol. 555:617–626. 2004. View Article : Google Scholar : PubMed/NCBI |