Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
July-2017 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2017 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

O6-methyl-guanine-DNA methyltransferase methylation and IDH1/2 mutation in small cell lung cancer

  • Authors:
    • Hongyang Lu
    • Jing Qin
    • Haimiao Xu
    • Na Han
    • Fajun Xie
    • Weimin Mao
  • View Affiliations / Copyright

    Affiliations: Zhejiang Key Laboratory of Diagnosis and Treatment Technology on Thoracic Oncology (Lung and Esophagus), Zhejiang Cancer Hospital, Hangzhou, Zhejiang 310022, P.R. China, Department of Thoracic Medical Oncology, Zhejiang Cancer Hospital, Hangzhou, Zhejiang 310022, P.R. China, Department of Pathology, Zhejiang Cancer Hospital, Hangzhou, Zhejiang 310022, P.R. China
  • Pages: 398-402
    |
    Published online on: May 18, 2017
       https://doi.org/10.3892/etm.2017.4476
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Small cell lung cancer (SCLC) is sensitive to first‑line chemotherapy and radiotherapy, but frequently recurs. Temozolomide is a chemotherapeutic drug suitable for the treatment of relapsed SCLC, particularly when brain metastases are present. The response of SCLC to temozolomide may be associated with the methylation status of O6‑methyl‑guanine‑DNA methyltransferase (MGMT). Isocitrate dehydrogenase (IDH) mutation is an independent prognostic factor of good outcome in gliomas and appears to be a significant marker of positive chemosensitivity in secondary glioblastoma. In order to identify the status of MGMT promoter methylation and IDH1/2 mutation of SCLC in China, 33 SCLC specimens from patients that underwent surgery were retrospectively collected in Zhejiang Cancer Hospital (Hangzhou, China) between 2008 and 2014. High‑resolution melting analysis and methylation‑specific polymerase chain reaction were used to detect MGMT promoter methylation, and polymerase chain reaction amplification and Sanger sequencing were utilized to detect IDH1/2 mutation. Of the 33 examined SCLC specimens, MGMT promoter methylation was detected in 17 patients (51.5%), and no IDH1/2 mutations were detected in the analyzed samples. These findings indicate that the IDH1/2 mutation may not be an ideal marker in SCLC patients treated with temozolomide. Future studies on the predictive and prognostic value of MGMT promoter methylation are urgently required for patients with relapsed SCLC treated with temozolomide in China.

Introduction

The prognosis of small cell lung cancer (SCLC) remains poor, although modest improvements in survival have been achieved. The proportion of SCLC among all histological types of lung cancer decreased from 17.26% in 1986 to 12.95% in 2002 (1). Although SCLC is sensitive to first-line chemotherapy and radiotherapy, the majority of patients experience relapse within 2 years and succumb to systemic metastasis. The 5-year survival rate of limited stage SCLC is 15% or less and the 2-year survival of extensive stage SCLC is 5.2–19.5% (1,2). Temozolomide, a chemotherapeutic drug, is a suitable option for relapsed SCLC, particularly when brain metastases are present (3,4), and it has been recommended for second-line treatment of SCLC in the National Comprehensive Cancer Network guidelines (5). In a phase II study of the efficacy of temozolomide in the treatment of SCLC, Pietanza et al (3) established the methylation status of the O6-methyl-guanine-DNA methyltransferase (MGMT) promoter in 27 patients, and found that the overall promoter methylation rate in those patients was 48%. A significantly greater proportion of cases with methylated MGMT exhibited a response to temozolomide compared with those with unmethylated MGMT (38 vs. 7%; P=0.08). These results suggest that the response to temozolomide treatment may be associated with the MGMT methylation status in SCLC (3). Temozolomide administered at a dose of 200 mg/m2/day for 5 days in 28-day cycles is tolerable and active in patients with relapsed SCLC (4). The incidence of mutations in the epidermal growth factor receptor in non-small cell lung cancer is higher in China than in the United States and European countries (6,7). The difference in MGMT methylation rates among China, the United States and European countries remains unknown and, to the best of our knowledge, there are currently no reports on the status of MGMT promoter methylation for SCLC in China.

Mutations of isocitrate dehydrogenase (IDH)1 and IDH2 are the most frequent genomic alterations detected in gliomas, affecting 40% of these tumors, and are some of the earliest aberrations occurring in gliomagenesis (8). IDH mutations have been found to be independent prognostic factors of a good outcome for glioma, and IDH mutation appears to be a significant marker of chemosensitivity in secondary glioblastoma (8). A study of secondary glioblastomas indicated that the combined use of the IDH status and MGMT promoter status may be deserving and appropriate for examination as a stratification factor in clinical trials involving the use of temozolomide for the treatment of patients with secondary glioblastoma (9). However, prognostic and predictive values of IDH1/2 mutation for chemosensitivity in SCLC are unknown and further studies are required for clarification. Therefore, it would be valuable to elucidate the status of MGMT methylation and IDH1/2 mutation in SCLC patients treated with temozolomide.

In the present study, MGMT promoter methylation in resected SCLC specimens was detected by the use of polymerase chain reaction (PCR) amplification and Sanger sequencing. The IDH1/IDH2 mutation was identified by methylation-specific PCR (MSP) and high-resolution melting (HRM) analysis.

Materials and methods

Patient characteristics

A total of 33 SCLC specimens were retrospectively collected in Zhejiang Cancer Hospital (Hangzhou, China) between April 2008 and June 2014. All specimens were obtained from SCLC patients who underwent surgery. A total of 3 patients received pneumonectomy with lymph node dissection, 1 patient received wedge resection with lymph node dissection, and 29 patients received lobectomy with lymph node dissection. All patients were diagnosed with conventional SCLC, the pathological diagnosis of which was based on the standard criteria defined by WHO classification (10). The stage was classified according to seventh edition of the TNM classification for lung cancer as follows: IA, 9 cases; IB, 5 cases; IIA, 4 cases; IIB, 3 cases; IIIA, 11 cases; and IIIB, 1 case. The 33 specimens were obtained from 6 female and 27 male patients (age range, 38 to 77 years; median age, 58 years; body weight range, 44 to 80 kilograms; median body weight, 66 kilograms). There were 6 non-smokers, 2 light smokers (≤10 pack-years), 5 moderate smokers (10–20 pack-years) and 20 heavy smokers (≥20 pack-years). The median pack-years of smoking history was 30 (Table I). The present study was approved by the Ethics Committee of Zhejiang Cancer Hospital. The patient specimens were retrospectively collected and, as a number of patients were deceased, exempt written informed consent was also approved by the Ethics Committee of Zhejiang Cancer Hospital. A total of 21 patients signed the written informed consent prior to surgery to preserve their specimens in Biological Sample Bank of Zhejiang Cancer Hospital to be used for research.

Table I.

Clinical characteristics of the patients with small cell lung cancer.

Table I.

Clinical characteristics of the patients with small cell lung cancer.

CharacteristicsCases (n)
Sex
  Male27
  Female6
Location
  Right lung16
  Left lung17
Smoking
  Non-smoker6
  Light smoker (≤10 pack-years)2
  Moderate smoker (≤10 pack-years)5
  Heavy smoker smokers (≥20 pack-years)20
Stage
  IA9
  IB5
  IIA4
  IIB3
  IIIA11
  IIIB1
MSP and HRM analysis

DNA methylation pattern in the CpG island of the MGMT gene was determined by nested MSP of bisulphite-converted DNA. DNA bisulfite conversion was conducted using an EZ DNA methylation kit (Zymo Research Corporation, Irvine, CA, USA) following the manufacturer's protocol. DNA was treated with sodium bisulfite, to convert all unmethylated cytosine residues to uracil, whereas methylated cytosine remained unchanged. Bisulfite-converted DNA was stored at −70°C until use. The primer sequences used for nested MSP, methylated and unmethylated PCR are listed in Table II. For the first round of PCR amplification, 2 µl bisulfite-modified DNA was used in a final volume of 30 µl reaction mixture containing the template DNA (>50 ng), forward and reverse MGMT-outside primers and (0.5 pM), 2X SYBR premix (Bioer Technology Co., Ltd., Hangzhou, China). Amplification was completed in a Mx3000P Thermal Cycler (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA) under the following conditions: initial denaturation at 95°C for 3 min, 35 cycles each comprising denaturation at 94°C for 30 sec, annealing at 59°C for 30 sec and extension at 72°C for 30 sec, followed by a final extension at 72°C for 5 min. The resulting PCR products of MGMT served as a template for the second MSP. The PCR product from the first step was subjected to the second round of PCR with MGMT forward and reverse primers specific for methylated (MGMT-M) and unmethylated (MGMT-U) sequences of MGMT promoter (Table II). Amplification was completed under the following conditions: Initial denaturation at 95°C for 3 min, 40 cycles of denaturation each at 95°C for 30 sec, annealing at 59°C for 30 sec and extension at 72°C for 30 sec followed by final extension at 72°C for 4 min. The PCR products were subjected to HRM analysis using a Light Cycler Nano (Roche Diagnostics GmbH, Mannheim, Germany) according to its high resolution melting software in one cycle of 97°C for 1 min and a melting range temperature of 70–95°C, rising by 0.2°C per second.

Table II.

Sequences of primers for MGMT detection.

Table II.

Sequences of primers for MGMT detection.

PrimerDirectionSequence of primers
MGMT-OForward GYGTTTYGGATATGTTGGGATAGTT
MGMT-OReverse AAACTCCRCACTCTTCCRAAAAC
MGMT-MForward TTTCGACGTTCGTAGGTTTTCGC
MGMT-MReverse GCACTCTTCCGAAAACGAAACG
MGMT-UForward TTTGTGTTTTGATGTTTGTAGGTTTTTGT
MGMT-UReverse AACTCCACACTCTTCCAAAAACAAAACA

[i] MGMT, O6-methyl-guanine-DNA methyltransferase; O, outside; M, methylated; U, unmethylated.

IDH1 and IDH2 mutation detection

Mutational analyses of IDH1 (R132) and IDH2 (R172) were performed using PCR amplification and Sanger sequencing. The genomic DNA was extracted from paraffin-embedded tumor tissue using an EASYspin FFPE DNA isolation kit (Aidlab Biotechnologies Co., Ltd., Beijing, China) according to the protocol of the manufacture. The primer sequences used for PCR are provided in Table III. PCR amplification was performed using a Mx3000P Thermal Cycler (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA) under the following conditions: 95°C for 2 min, then 40 cycles of 94°C for 30 sec, 57°C for 30 sec and 72°C for 30 sec. The final elongation step was at 72°C for 5 min. The PCR products were sequenced using an Applied Biosystems 3500 sequencer using IDH1/2 forward primer (Table III).

Table III.

Sequences of primers for IDH1/2 detection.

Table III.

Sequences of primers for IDH1/2 detection.

PrimerDirectionSequence of primers
IDH1Forward CTCCTGATGAGAAGAGGGTTG
IDH1Reverse TGGAAATTTCTGGGCCATG
IDH2Forward TGGAACTATCCGGAACATCC
IDH2Reverse AGTCTGTGGCCTTGTACTGC

[i] IDH, isocitrate dehydrogenase.

Statistical analysis

SPSS 15.0 software (SPSS, Inc., Chicago, IL, USA) was used for the Chi-square analysis. P<0.05 was considered to indicate a statistically significant difference.

Results and Discussion

MGMT promoter methylation was detected in 17 patients and the MGMT promoter methylation rate in SCLC was 51.5% in the present cohort. No significant difference was observed between patients with MGMT methylation and without MGMT methylation in terms of age, sex and smoking history (Table IV). Furthermore, no IDH1/2 mutation was detected in the 33 examined SCLC specimens (Figs. 1 and 2).

Figure 1.

Normal (unmutated) sequence of isocitrate dehydrogenase 1 (R132). Mutation was expected to be in isocitrate dehydrogenase 1 (R132): ATAGGTCGTCATGCTT. No isocitrate dehydrogenase 1 mutation was detected in the 33 examined small cell lung cancer specimens.

Figure 2.

Normal (unmutated) sequence of isocitrate dehydrogenase 2 (R172). Mutation was expected to be in isocitrate dehydrogenase 2 (R172): TGGCAGGCACGCCC. No isocitrate dehydrogenase 2 mutation was detected in the 33 examined small cell lung cancer specimens.

Table IV.

Clinical features of 33 patients with small cell lung cancer with and without O6-methyl-guanine-DNA methyltransferase methylation.

Table IV.

Clinical features of 33 patients with small cell lung cancer with and without O6-methyl-guanine-DNA methyltransferase methylation.

Clinical featuresMethylationWithout methylationP-value
Patients1716–
Median age (years)55600.58
Sex (female/male)4/133/130.935
Smoking history (median pack-years)23400.29

Temozolomide is an alkylating agent that is widely used in the chemotherapy of cancer (11,12). The enzyme MGMT, via its dealkylating effect, repairs potentially tumorigenic DNA mismatches caused by environmentally induced alkylation, but also acts against the effects of alkylating molecules that are administered in the chemotherapy of different types of cancer (13). MGMT is the primary mediator of the alkylator resistance of glioma cells. Epigenetic silencing of the MGMT gene in glioma cells by promoter methylation compromises the DNA repair mechanism and thus increases chemosensitivity to alkylating drugs. Therefore, MGMT promoter methylation is a strong prognostic biomarker in pediatric and adult patients with glioblastoma that are treated with temozolomide (14). There have been few investigations on MGMT in SCLC, despite the use of temozolomide in relapsed SCLC. The response of SCLC to temozolomide may be associated with MGMT methylation (3). The rate of MGMT promoter methylation was 51.5% in the present study, which was close to that reported by Pietanza et al (48%) (3) and Miglio et al (35.2%) (15). In the study conducted by Miglio et al (15), results from methylation analysis were obtained in 54 samples (54/56) and failed in two bronchial washes. The MGMT promoter was methylated in 35.2% of the cases without any significant difference between histological and cytological samples (37.9 vs. 32%) (15). All specimens in the current study were collected from surgery, and they may better reflect the respective pathological characteristics. However, it is very difficult to obtain tissues from surgery because only ~5% of SCLC patients with a TNM stage of T1-2N0M0 are suitable for surgery. In MGMT promoter methylation detection, cytological samples may be a substitution for histological samples. These results indicate that the rate of MGMT promoter methylation in patients with SCLC from China may be higher than that in those from the USA and European countries. This difference may be attributable to different ethnicities, specimen sources and limited sample quantity. Elucidation of the predictive prognostic value of MGMT promoter methylation in patients with relapsed SCLC treated with temozolomide in China is required.

IDH occurs in three isoforms: IDH1, located in the cytoplasm; IDH2, located in the mitochondria; and IDH3, which functions as part of the tricarboxylic acid cycle. IDH catalyzes the conversion of isocitrate to α-ketoglutarate (α-KG). Mutations in the active site of IDH1 at position R132 and an analogous mutation in the IDH2 gene at position R172 have been identified (16). IDH1 catalyzes the oxidative decarboxylation of isocitrate to α-KG and in parallel converts nicotinamide adenine dinucleotide phosphate (NADP+) to NADPH. The mutant IDH1 acquires novel enzyme activity, converting α-KG to D-2-hydroxyglutarate, an action that is competitive and inhibitory to that of α-KG. As a result, the activity of α-KG-dependent enzyme is reduced (17). IDH2 is a mitochondrial NADP-dependent isocitrate dehydrogenase identified to be a tumor suppressor in different types of tumors (18). The prognosis of Grade II and III glioma was improved in patients with an IDH mutation, compared with those without the mutation (19,20). The IDH mutation was associated with a higher response rate to temozolomide therapy (21). The IDH1 mutation caused cell cycle arrest at the G1 stage and a reduction of proliferation and invasion ability, while raising sensitivity to chemotherapy (22). No IDH1/2 mutations in SCLC were detected in the current study, which may be due to the limited sample quantity, as all samples were acquired from surgical specimens and only ~5% of SCLC patients with a TNM stage of T1-2N0M0 were suitable for surgery. The IDH1/2 mutation may not be an ideal marker in SCLC patients treated with temozolomide.

In conclusion, findings from the present study suggest that the rate of MGMT promoter methylation in patients with SCLC from China may be higher than those from the USA and European countries. Future studies on the predictive and prognostic value of MGMT promoter methylation are urgently required to aid in the treatment for relapsed patients with SCLC that have been treated with temozolomide.

Acknowledgements

The present study was supported by Zhejiang Province Medical Science Fund Project of China (grant no. 2015ZHA006) and the 1022 Talent Training Program of Zhejiang Cancer Hospital.

Glossary

Abbreviations

Abbreviations:

SCLC

small cell lung cancer

MGMT

O6-methyl-guanine-DNA methyltransferase

IDH

isocitrate dehydrogenase

PCR

polymerase chain reaction

HRM

high-resolution melting

MSP

methylation-specific polymerase chain reaction

α-KG

α-ketoglutarate

NADP

nicotinamide adenine dinucleotide phosphate

References

1 

Govindan R, Page N, Morgensztern D, Read W, Tierney R, Vlahiotis A, Spitznagel EL and Piccirillo J: Changing epidemiology of small-cell lung cancer in the United States over the last 30 years: Analysis of the surveillance, epidemiologic, and end results database. J Clin Oncol. 24:4539–4544. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Chen J, Jiang R, Garces YI, Jatoi A, Stoddard SM, Sun Z, Marks RS, Liu Y and Yang P: Prognostic factors for limited-stage small cell lung cancer: A study of 284 patients. Lung Cancer. 67:221–226. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Pietanza MC, Kadota K, Huberman K, Sima CS, Fiore JJ, Sumner DK, Travis WD, Heguy A, Ginsberg MS, Holodny AI, et al: Phase II trial of temozolomide in patients with relapsed sensitive or refractory small cell lung cancer, with assessment of methylguanine-DNA methyltransferase as a potential biomarker. Clin Cancer Res. 18:1138–1145. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Zauderer MG, Drilon A, Kadota K, Huberman K, Sima CS, Bergagnini I, Sumner DK, Travis WD, Heguy A, Ginsberg MS, et al: Trial of a 5-day dosing regimen of temozolomide in patients with relapsed small cell lung cancers with assessment of methylguanine-DNA methyltransferase. Lung Cancer. 86:237–240. 2014. View Article : Google Scholar : PubMed/NCBI

5 

National Comprehensive Cancer Network, . NCCN Clinical Practice Guidelines in OncologySmall Cell Lung Cancer version 2.2017. Fort Washington; PA: 2016

6 

Wu YL, Zhong WZ, Li LY, Zhang XT, Zhang L, Zhou CC, Liu W, Jiang B, Mu XL, Lin JY, et al: Epidermal growth factor receptor mutations and their correlation with gefitinib therapy in patients with non-small cell lung cancer: A meta-analysis based on updated individual patient data from six medical centers in mainland China. J Thorac Oncol. 2:430–439. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Shigematsu H, Lin L, Takahashi T, Nomura M, Suzuki M, Wistuba II, Fong KM, Lee H, Toyooka S, Shimizu N, et al: Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst. 97:339–346. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Wang XW, Ciccarino P, Rossetto M, Boisselier B, Marie Y, Desestret V, Gleize V, Mokhtari K, Sanson M and Labussière M: IDH mutations: genotype-phenotype correlation and prognostic impact. Biomed Res Int. 2014:5402362014.PubMed/NCBI

9 

SongTao Q, Lei Y, Si G, YanQing D, HuiXia H, XueLin Z, LanXiao W and Fei Y: IDH mutations predict longer survival and response to temozolomide in secondary glioblastoma. Cancer Sci. 103:269–273. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Travis WD, Brambilla E, Burke AP, Marx A and Nicholson AG: Introduction to The 2015 World Health Organization Classification of Tumors of the Lung, Pleura, Thymus, and Heart. J Thorac Oncol. 10:1240–1242. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Taylor JW and Schiff D: Treatment considerations for MGMT-unmethylated glioblastoma. Curr Neurol Neurosci Rep. 15:5072015. View Article : Google Scholar : PubMed/NCBI

12 

Wang Y, Chen X, Zhang Z, Li S, Chen B, Wu C, Wang L, Zhang X, Wang J, Chen L and Jiang T: Comparison of the clinical efficacy of temozolomide (TMZ) versus nimustine (ACNU)-based chemotherapy in newly diagnosed glioblastoma. Neurosurg Rev. 37:73–78. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Cabrini G, Fabbri E, Lo Nigro C, Dechecchi MC and Gambari R: Regulation of expression of O6-methylguanine-DNA methyltransferase and the treatment of glioblastoma (Review). Int J Oncol. 47:417–428. 2015.PubMed/NCBI

14 

Wick W, Weller M, van den Bent M, Sanson M, Weiler M, von Deimling A, Plass C, Hegi M, Platten M and Reifenberger G: MGMT testing-the challenges for biomarker-based glioma treatment. Nat Rev Neurol. 10:372–385. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Miglio U, Mezzapelle R, Paganotti A, Veggiani C, Mercalli F, Mancuso G, Gaudino E, Rena O, Buosi R and Boldorini R: Frequency of O6-methylguanine-DNA methyltransferase promoter methylation in cytological samples from small cell lung cancer. Diagn Cytopathol. 43:947–952. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Ohka F, Ito M, Ranjit M, Senga T, Motomura A, Motomura K, Saito K, Kato K, Kato Y, Wakabayashi T, et al: Quantitative metabolome analysis profiles activation of glutaminolysis in glioma with IDH1 mutation. Tumour Biol. 35:5911–5920. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Stein EM: IDH2 inhibition in AML: Finally progress? Best Pract Res Clin Haematol. 28:112–115. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Tian GY, Zang SF, Wang L, Luo Y, Shi JP and Lou GQ: Isocitrate Dehydrogenase 2 Suppresses the Invasion of Hepatocellular Carcinoma Cells via Matrix Metalloproteinase 9. Cell Physiol Biochem. 37:2405–2414. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Wang J, Zhao YY, Li JF, Guo CC, Chen FR, Su HK, Zhao HF, Long YK, Shao JY, To SS and Chen ZP: IDH1 mutation detection by droplet digital PCR in glioma. Oncotarget. 6:39651–39660. 2015.PubMed/NCBI

20 

Xia L, Wu B, Fu Z, Feng F, Qiao E, Li Q, Sun C and Ge M: Prognostic role of IDH mutations in gliomas: A meta-analysis of 55 observational studies. Oncotarget. 6:17354–17365. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Houillier C, Wang X, Kaloshi G, Mokhtari K, Guillevin R, Laffaire J, Paris S, Boisselier B, Idbaih A, Laigle-Donadey F, et al: IDH1 or IDH2 mutations predict longer survival and response to temozolomide in low-grade gliomas. Neurology. 75:1560–1566. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Wang JB, Dong DF, Wang MD and Gao K: IDH1 overexpression induced chemotherapy resistance and IDH1 mutation enhanced chemotherapy sensitivity in Glioma cells in vitro and in vivo. Asian Pac J Cancer Prev. 15:427–432. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lu H, Qin J, Xu H, Han N, Xie F and Mao W: O6-methyl-guanine-DNA methyltransferase methylation and IDH1/2 mutation in small cell lung cancer. Exp Ther Med 14: 398-402, 2017.
APA
Lu, H., Qin, J., Xu, H., Han, N., Xie, F., & Mao, W. (2017). O6-methyl-guanine-DNA methyltransferase methylation and IDH1/2 mutation in small cell lung cancer. Experimental and Therapeutic Medicine, 14, 398-402. https://doi.org/10.3892/etm.2017.4476
MLA
Lu, H., Qin, J., Xu, H., Han, N., Xie, F., Mao, W."O6-methyl-guanine-DNA methyltransferase methylation and IDH1/2 mutation in small cell lung cancer". Experimental and Therapeutic Medicine 14.1 (2017): 398-402.
Chicago
Lu, H., Qin, J., Xu, H., Han, N., Xie, F., Mao, W."O6-methyl-guanine-DNA methyltransferase methylation and IDH1/2 mutation in small cell lung cancer". Experimental and Therapeutic Medicine 14, no. 1 (2017): 398-402. https://doi.org/10.3892/etm.2017.4476
Copy and paste a formatted citation
x
Spandidos Publications style
Lu H, Qin J, Xu H, Han N, Xie F and Mao W: O6-methyl-guanine-DNA methyltransferase methylation and IDH1/2 mutation in small cell lung cancer. Exp Ther Med 14: 398-402, 2017.
APA
Lu, H., Qin, J., Xu, H., Han, N., Xie, F., & Mao, W. (2017). O6-methyl-guanine-DNA methyltransferase methylation and IDH1/2 mutation in small cell lung cancer. Experimental and Therapeutic Medicine, 14, 398-402. https://doi.org/10.3892/etm.2017.4476
MLA
Lu, H., Qin, J., Xu, H., Han, N., Xie, F., Mao, W."O6-methyl-guanine-DNA methyltransferase methylation and IDH1/2 mutation in small cell lung cancer". Experimental and Therapeutic Medicine 14.1 (2017): 398-402.
Chicago
Lu, H., Qin, J., Xu, H., Han, N., Xie, F., Mao, W."O6-methyl-guanine-DNA methyltransferase methylation and IDH1/2 mutation in small cell lung cancer". Experimental and Therapeutic Medicine 14, no. 1 (2017): 398-402. https://doi.org/10.3892/etm.2017.4476
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team