Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
November-2017 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Role of microRNA‑26a in the diagnosis of lower extremity deep vein thrombosis in patients with bone trauma

  • Authors:
    • Zi Li
    • Jiangdong Ni
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics, Xiangya Second Hospital of Central South University, Changsha, Hunan 410011, P.R. China
  • Pages: 5069-5074
    |
    Published online on: September 22, 2017
       https://doi.org/10.3892/etm.2017.5183
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study aimed to investigate the role and mechanism of action of microRNA (miR)‑26a in deep vein thrombosis (DVT). Peripheral blood was collected from 45 patients with DVT and 40 healthy controls. Levels of miR‑26a, chemokine C‑C motif ligand (CCL)2 mRNA and CCL7 mRNA were detected using reverse transcription‑quantitative polymerase chain reaction and the value of miR‑26a in the clinical diagnosis of DVT was assessed using receiver operating characteristic curve analysis. The correlation of miR‑26a with CCL2 and CCL7 levels was analyzed using Spearman's rank correlation. In addition, miR‑26a and protein kinase C δ (PRKCD) were overexpressed in human umbilical vein endothelial cells (HUVECs) and PRKCD expression was knocked down by small interfering (si)RNA. Western blotting was conducted to detect the expression of PRKCD and p65. Furthermore, a dual‑luciferase reporter gene assay was performed. The results of the current study demonstrated that the expression of miR‑26a was significantly downregulated in the peripheral blood of patients with DVT compared with healthy controls (P<0.05) and negatively correlated with CCL2 and CCL7 levels (P<0.05). Furthermore, it was demonstrated that miR‑26a markedly inhibited the expression of PRKCD, significantly decreased levels of CCL2 and CCL7 mRNA (P<0.05) and inhibited activation of the NF‑κB signaling pathway. Overexpression of PRKCD in HUVECs inhibited the effects of miR‑26a and markedly upregulated the phosphorylation of p65. The present study indicated that miR‑26a directly targets PRKCD mRNA and that miR‑26a may be a useful biomarker in the clinical diagnosis of DVT. Thus, the present findings suggest that miR‑26a regulates the NF‑κB signaling pathway by binding to PRKCD mRNA, inhibits the expression of CCL2 and CCL7 and reduces the risk of DVT.

Introduction

Deep vein thrombosis (DVT) is a type of venous thromboembolism disease that is common in the clinic and typically occurs following surgery for lower extremity bone trauma and other diseases, including diabetes and gestational hypertension (1,2). The incidence of DVT is >0.1% and has increased in recent years (3). The primary pathological characteristic of lower extremity venous thrombosis is abnormal blood coagulation in the lower extremity deep vein that obstructs the lumen and causes venous reflux obstacles (4). Lesions in the limb induce different degrees of swelling and pain and in some severe cases may cause limb gangrene. Following the detachment of thrombi, patients may experience pulmonary embolism and respiratory distress (5,6). Furthermore, DVT may progress to post-thrombotic syndrome, which seriously affects patient quality of life and may cause pain (7).

At present, early diagnosis of DVT is clinically significant for the treatment and prognosis of patients. The current gold standard for the clinical diagnosis of DVT is lower extremity venous imaging. However, this is a type of invasive examination and increases the risk of complications occurring, including thrombus detachment, allergic reactions and increased thrombosis severity, which limits its application in the clinic (8). Recent studies have demonstrated that biomarkers including C-reactive protein (CRP), D-dimer and interleukin (IL)-6, exhibit beneficial clinical value in the early diagnosis of DVT; however, these biomarkers are still not a substitute for lower extremity venous imaging (9–11). At present, the mechanism of DVT is unclear, which greatly limits screening for DVT diagnostic markers. Therefore, it is important to determine the mechanism of DVT in order to identify potential biomarkers.

Micro (mi)RNAs are endogenous, small noncoding RNAs that are approximately 20–22 nucleotides long and found in eukaryotes (12). Mature miRNA binds to the 3′-untranslated (UTR) region of its target mRNA, forming silencing complexes and inducing the degradation of target mRNA or inhibiting its translation (13,14). miRNAs are stable molecules that may be developed as biomarkers for various diseases and their levels are high in the peripheral blood (15). In addition, miRNAs are involved in almost all pathological and physiological processes in eukaryotic cells, including cancer, cardiovascular disease, Alzheimer's disease and inflammation (16–18).

In the present study, the diagnosis value of microRNA (miR)-26a in DVT was assessed. The role and mechanism of miR-26a in DVT was also analyzed and discussed.

Patients and methods

Patients

A total of 45 patients (27 males and 18 females; mean age, 53±8.63 years old) who had suffered from bone trauma were diagnosed with lower extremity DVT between May 2013 and April 2015 at the Xiangya Second Hospital of Central South University (Xiangya, China) and were enrolled in the present study. All patients were diagnosed by lower extremity venous imaging (19). Patients had experienced DVT for between 2 and 15 years. Clinical symptoms included pain and swelling of the lower limbs and difficulty walking. Among the 45 patients, 6 patients also had pulmonary embolism (PTE). For comparison, 40 healthy individuals were also enrolled. Peripheral whole blood was collected from the upper limb veins of 45 patients and 40 healthy individuals to extract total DNA. Prior written and informed consent was obtained from all individuals recruited in the current study and ethical approval was granted by the Ethics Review Board of Central South University.

Cell culture and reagents

Human umbilical vein endothelial cells (HUVECs) (Sciencell Research Laboratories, Inc., San Diego, CA, USA) were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (BD Biosciences, Franklin Lakes, NJ, USA) and cultured at 37°C in an atmosphere containing 0.5% CO2. TRIzol LS reagent and Lipofectamine 2000 transfection reagent were purchased from Invitrogen; Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Mouse anti-human GAPDH monoclonal antibody (AG019) and enhanced chemiluminescence substrate were purchased from Beyotime Institute of Biotechnology (Shanghai, China). Rabbit anti-human protein kinase C δ (PRKCD) polyclonal antibody (ab86800) and rabbit anti-nuclear factor (NF)-κB polyclonal antibody (ab16502) were purchased from Abcam (Cambridge, UK). The Takara PrimeScript RT and Regent SYBR PrimeScript RT-PCR kits were purchased from Takara Biotechnology Co., Ltd. (Dalian, China).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA from whole blood cells was extracted using TRIzol LS reagent. Reverse transcription was performed using a Takara PrimeScript RT kit according to the manufacturer's instructions. qPCR was performed to measure the levels of miR-26a, CCL2 mRNA and CCL7 mRNA and the Regent SYBR PrimeScript RT-PCR kit was used to perform qPCR following the manufacturer's instructions. U6 was used as a reference gene for miR-26a and GAPDH was used as a reference gene for CCL2 and CCL7. Primer sequences are listed in Table I. The reaction system consisted of the following: cDNA (2 µl), Buffer Mix (containing enzymes, 10 µl), forward primer (0.5 µl), reverse primer (0.5 µl) and 17 µl H2O. To detect miR-26a, CCL2 and CCL7, PCR was performed under the following cycling conditions: 95°C for 10 min, followed by 40 cycles of denaturing at 95°C for 30 sec and primer annealing at 60°C for 30 sec. Levels of miR-26a, CCL2 mRNA and CCL7 mRNA were calculated using the 2−ΔΔCq method (20).

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction.

PrimerDirectionPrimer sequences (5′-3′)
miR-26aForward CAAGUAAUCCAGGAUAGG
Reverse GGCCAACCGCGAGAAGATGTTTTTTTTT
CCL2ForwardCCA ACTCCTGCCTCCGCTCTA
Reverse TGCAGATCTGGGTTGTGGAG
CCL7Forward CTGACCCCACACAGAAGTGG
Reverse CCCCATGAGGTAGAGAAGGGA
U6Forward CTCGCTTCGGCAGCACA
Reverse AACGCTTCACGAATTTGCGT
GAPDHForward CGGAGTCAACGGATTTGGTCGTAT
Reverse AGCCTTCTCCATGGTGGTGAAGAC

[i] miR-26a, microRNA-26a; CCL, chemokine C-C motif ligand.

Transfection in HUVECs

HUVECs were seeded in 24-well plates at a density of 2×105 cells/well 24 h at 37°C prior to transfection. Cells were transfected with 0.5 µg of GV227-PRKCD-Neo-EGFP and 25 pmol of miR-26a mimics (Hanbio, Shanghai, China). Transfection was performed using Lipofectamine 2000 according to the manufacturer's instructions and cells were harvested 48 h later.

PRKCD small interfering (si)RNA was purchased from Shanghai Genechem Co., Ltd. (Shanghai, China). PRKCD siRNA was transfected into HUVECs using Lipofectamine 2000 according to the manufacturer's instructions. Follow-up experiments were performed 48 h later. Cells were observed using an inverted fluorescent microscope (IX 73; Olympus Corp., Tokyo, Japan).

Western blot analysis

HUVECs were lysed in radio immunoprecipitation assay buffer (Beyotime Institute of Biotechnology). Protein was determined by BCA assay, and 20 µg protein was separated by 12.5% SDS-PAGE and subsequently transferred to polyvinylidene difluoride membranes. Membranes were blocked with 5% non-fat dry milk in Tris-buffered saline with Tween 20 for 1 h at room temperature and subsequently incubated with antibodies against PRKCD (1:800) or GAPDH (1:5,000) overnight at 4°C. Subsequently, membranes were incubated with a secondary antibody horseradish peroxidase-conjugated goat anti-mouse immunoglobulin (Ig)G antibody (cat. no. BS12478; 1:5,000; Bioworld Technology, Inc., St. Louis Park, MN, USA) for 1 h at room temperature and washed with PBST 5 min three times. The protein chemiluminescence was then detected using enhanced chemiluminescence substrate and analyzed by Quantity one V 4.6.2 (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Dual-luciferase reporter gene assay

The target gene of miR-26a was predicted using TargetScan (http://www.targetscan.org/). The miR-26a binding sequence and mutation region sequence in 3′-UTR of PRKCD were synthesized according to bioinformatic analysis (21) and then cloned into pMIR-REPORT plasmids (Thermo Fisher Scientific, Inc.). The two types of constructed plasmids and miR-26a mimics were respectively co-transfected into HEK293 cells using Lipofectamine 2000 (Thermo Fisher Scientific, Inc.). The fluorescence value of each group was detected 24 h later using the dual-luciferase reporter gene system (Promega Corporation; Madison, WI, USA) according to the manufacturer's instructions and was compared with Renilla luciferase activity for normalization.

Statistical analysis

Data were expressed as the mean + standard deviation. Statistical analyses were performed using the two-tailed Student's t-test (paired) and SPSS 16.0 software (SPSS, Inc., Chicago, IL, USA). The clinical value of miR-26a in the diagnosis of DVT was evaluated using a receiver operating characteristic (ROC) curve. In addition, Spearman's rank correlation analysis was conducted to determine the correlation between miR-26a and CCL2 and CCL7 levels. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of miR-26 in the peripheral blood of patients with DVT

The results of RT-qPCR indicated that levels of miR-26a were significantly downregulated in the peripheral blood of patients with DVT compared with normal controls (P<0.05; Fig. 1A). In addition, levels of miR-26a in the peripheral blood of patients with DVT complicated with pulmonary embolism (DVT + PTE) were significantly lower than in patients with DVT alone (P<0.05; Fig. 1B). These results demonstrate that the downregulated expression of miR-26a may be associated with DVT.

Figure 1.

Levels of miR-26 in the peripheral blood of patients with DVT. The expression of miR-26 was detected by reverse transcription-quantitative polymerase chain reaction. (A) Levels of miR-26 in the peripheral blood of patients with DVT compared with normal controls. (B) Levels of miR-26 in the peripheral blood of patients with DVT complicated by PTE, patients with DVT alone and normal controls. *P<0.05 vs. normal group; #P<0.05 vs. DVT group. (C) Receiver operating characteristic curve indicated the value of miR-26a in the clinical diagnosis of DVT. miR-26, microRNA-26; DVT, deep vein thrombosis; PTE, pulmonary thromboembolism.

Analysis of ROC curve

To determine the role of miR-26a in the diagnosis of DVT, a ROC curve was generated. The results of the ROC curve analysis revealed that the largest area under the curve (AUC) was 0.7136 (P<0.01; Fig. 1C), suggesting that miR-26a may be useful in the clinical diagnosis of DVT.

Correlation of CCL2 and CCL7 mRNA levels with miR-26a

CCL2 and CCL7 are important inflammatory chemokines that recruit monocytes to specified lesions, promote the release of local inflammatory factors and aggravate the inflammatory response (22,23). In the present study, the results from RT-qPCR suggested that levels of CCL2 and CCL7 mRNA were significantly increased in the peripheral blood of patients with DVT compared with the controls (P<0.05; Fig. 2A). Spearman's rank correlation analysis results indicated that the expression of miR-26a was negatively correlated with levels of CCL2 and CCL7 mRNA in the peripheral blood of patients with DVT (P<0.05; Fig. 2B and C, respectively). These results indicate that miR-26a may be involved in the regulation of CCL2 and CCL7 mRNA levels.

Figure 2.

Levels of CCL2 and CCL7 mRNA and their correlation with miR-26a. (A) Levels of CCL2 and CCL7 mRNA in the peripheral blood of patients with DVT and normal individuals were measured using reverse transcription-quantitative polymerase chain reaction. *P<0.05 vs. corresponding normal group. (B) Correlation of CCL-2 mRNA with miR-26. (C) Correlation of CCL-7 mRNA with miR-26. DVT, deep vein thrombosis; miR-26, microRNA-26; CCL, chemokine C-C motif ligand 2.

miR-26a-PRKCD-NF-κB signaling pathway regulates the expression of CCL2 and CCL7

Bioinformatics analysis revealed that there was a conservative binding domain of miR-26a in the 3′-UTR of PRKCD mRNA, indicating that miR-26a may regulate the expression of PRKCD. It has been demonstrated that PRKCD activates the NF-κB signaling pathway, promotes the expression and release of CCL2 and CCL7 and increases the local inflammatory response (24). Furthermore, it has been demonstrated that the inflammatory response is associated with the occurrence of DVT (25). Therefore, the effects of miR-26a on PRKCD, NF-κB-related protein and levels of CCL2 and CCL7 mRNA were examined in the current study (Fig. 3). The results determined that the expression of PRKCD was markedly decreased following the overexpression of miR-26a in HUVECs (Fig. 3A). In addition, levels of CCL2 and CCL7 mRNA were significantly decreased in miR-26a-overexpressed HUVECs compared with the control (P<0.05; Fig. 3B). The phosphorylation of p65 protein was markedly decreased in miR-26a-overexpressed HUVECs compared with the control (Fig. 3A), suggesting that the NF-κB signaling pathway was inactivated. However, overexpression of PRKCD in HUVECs attenuated the effects of miR-26a on p65 phosphorylation (Fig. 3D). Green fluorescence indicated the transfection efficiency (Fig. 3C). These results suggest that miR-26a may suppress the expression of PRKCD and inhibit the NF-κB signaling pathway, thus inhibiting CCL2 and CCL7 expression.

Figure 3.

miR-26a regulates the expression of PRKCD, CCL2, CCL7 and p65. (A) Effect of miR-26a on the expression of PRKCD and p-p65 was assessed using western blotting. GAPDH was used as an internal control. (B) The effect of miR-26a on the levels of CCL2 and CCL7 mRNA was detected by RT-qPCR. (C) Fluorescence was detected following transfection with PRKCD expression vector. Magnification, ×400. (D) Effect of PRKCD overexpression on the phosphorylation of p65 was detected by western blotting. (E) Effect of PPKCD knockdown on the expression of p65 and p-p65 was assessed by western blotting. GAPDH was used as an internal control. (F) Effect of PRKCD knockdown on the levels of CCL2 and CCL7 mRNA was detected by RT-par. *P<0.05 vs. NC. NC, negative control; p-p65, phosphorylated p65; miR-26, microRNA-26; CCL, chemokine C-C motif ligand 2; PRKCD, protein kinase C δ; GFP, green fluorescent protein; siR, small interfering RNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

siR-PRKCD inhibits the activation of NF-κB

To further determine the effect of PRKCD on the NF-κB signaling pathway, PRKCD expression was reduced by siRNA. Western blotting indicated that the expression of PRKCD was markedly decreased following the transfection of siR-PRKCD (Fig. 3E). Similarly, the phosphorylation of p65 was markedly downregulated following a decrease in the expression of PRKCD (Fig. 3E), suggesting that the NF-κB signaling pathway was inhibited. Furthermore, levels of CCL2 and CCL7 mRNA were significantly decreased in siR-PRKCD-treated HUVECs compared with the control (P<0.05; Fig. 3F). These results suggest that PRKCD regulates the NF-κB signaling pathway and decreases the expression of CCL2 and CCL7.

Dual-luciferase reporter gene assay

The results of the dual-luciferase reporter gene assay (Fig. 4) demonstrated that fluorescence was significantly reduced following co-transfection of miR-26a mimic and luciferase reporter gene plasmid pMIR-REPORT-wild-type (P<0.01; Fig. 4B). However, there was no difference in fluorescence following co-transfection of miR-26a mimic and pMIR-REPORT-mutant (Fig. 4B). These results suggest that miR-26a is able to bind the specific domain in the 3′-UTR of PRKCD mRNA.

Figure 4.

Identification of the miR-26a target gene using a dual-luciferase reporter gene assay. (A) Wild-type and mutant PRKCD sequences. (B) Fluorescence intensity changed when miR-26a mimic cells were co-transfected with pMIR-REPORT-wild-type or pMIR-REPORT-mutant type. *P<0.05 vs. NC. PRKCD, protein kinase C δ; NC, negative control.

Discussion

In the present study, the expression of miR-26a was significantly downregulated in the peripheral blood of patients with DVT. The AUC of the ROC curve was 0.7136, suggesting that miR-26a may be valuable in the clinical diagnosis of DVT. Furthermore, the results of the present study indicated that miR-26a targeted PRKCD mRNA and inhibited the activation of the NF-κB signaling pathway, thus downregulating the expression of CCL2 and CCL7 mRNA and attenuating the local inflammatory response. Therefore, it was hypothesized that the reduction of miR-26a levels may increase levels of inflammatory cytokines in the peripheral blood of patients with bone trauma and increase the risk of DVT.

DVT is a common clinical disease and its incidence, morbidity and mortality rates have increased in recent years (26). Clinical manifestations of DVT are primarily lower limb swelling, ulceration and necrosis, which may seriously limit patient quality of life (27). Detachment of thrombi may cause pulmonary embolism and lead to patient mortality (21). Inflammation is a major of the risk factors of DVT (28,29). Various studies have demonstrated that levels of inflammatory cytokines and chemokines are increased in the peripheral blood of patients with DVT. Du and Tan (10) identified that certain inflammatory factors including IL-6, CRP and NF-κB are closely associated with DVT. Krieger et al (30) suggested that changes in CRP levels and the erythrocyte sedimentation coefficient may induce acute lower extremity DVT. miRNAs are post-transcription regulating factors and therefore may serve an important role in inflammation. It was reported by Sawant et al (31) that miR-21 targets B-cell lymphoma 6 mRNA and promotes the differentiation of T helper 2 cells. Lu et al (32) demonstrated that miR-376b regulates the expression of IL-6. Furthermore, it was determined that miR-26a is involved in the differentiation of T cells and regulation of the NF-κB signaling pathway (33). The present study indicated that levels of miR-26a were significantly downregulated in the peripheral blood of patients with DVT and negatively correlated with CCL2 and CCL7 expression. Additionally, bioinformatics analysis identified that miR-26a regulated the expression of PRKCD. Previous results demonstrated that PRKCD activates the NF-κB signal pathway and promotes the expression and release of inflammatory cytokines (23). Therefore, it was hypothesized that the downregulation of miR-26a in the peripheral blood of patients with DVT may be associated with inflammation.

To investigate this hypothesis, miR-26a was overexpressed in HUVECs and the expression of PRKCD was markedly decreased. In addition, levels of CCL2 and CCL7 mRNA were significantly decreased. The results from western blotting suggested that miR-26a was able to inhibit activation of the NF-κB signaling pathway. Reduction of PRKCD expression by siRNA also attenuated activation of the NF-κB signaling pathway. A previous study demonstrated that activation of NF-κB promoted the expression and release of CCL2 and CCL7 (34). CCL2 and CCL7 are able to recruit inflammatory cells to specific lesions, promote the release of local inflammatory factors and aggravate the inflammatory response (35). The results of the dual-luciferase reporter gene assay conducted in the current study indicated that miR-26a was able to bind to the 3′-UTR of PRKCD, demonstrating that PRKCD is a target gene of miR-26a. This suggests that the downregulation of miR-26a increased PRKCD expression, activating the NF-κB signaling pathway and promoting the expression of CCL2 and CCL7.

In conclusion, the current study demonstrated that miR-26a may be valuable in the clinical diagnosis of DVT as novel biomarker. miR-26a may inactivate the NF-κB signaling pathway by binding PRKCD mRNA and may reduce the risk of DVT by inhibiting the inflammatory response.

References

1 

van Hylckama Vlieg A and Baglin TP: The risk of a first and a recurrent venous thrombosis associated with an elevated D-dimer level and an elevated thrombin potential: Results of the THE-VTE study: Reply. J Thromb Haemost. 13:2286–2287. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Van der Hulle T, den Exter PL, Planquette B, Meyer G, Soler S, Monreal M, Jiménez D, Portillo AK, O'Connell C and Liebman HA: Risk of recurrent venous thromboembolism and major hemorrhage in cancer-associated incidental pulmonary embolism amongst treated and untreated patients: A pooled analysis of 926 patients. J Thromb Haemost. 14:105–113. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Hossam Abdel-Hamid, Jonathan Miles, Richard W J. Carrington, Alister Hart, Alex Loh, John A and Skinner: Combined vascular and orthopedic approach for a pseudotumor causing deep vein thrombosis after metal-on-metal hip resurfacing arthroplasty. Case Rep Orthop. 2015:9262632015.PubMed/NCBI

4 

Hattab Y, Küng S, Fasanya A, Ma K, Singh AC and DuMont T: Deep venous thrombosis of the upper and lower extremity. Crit Care Nurs Q. 40:230–236. 2017. View Article : Google Scholar : PubMed/NCBI

5 

Cho SY, Youn HJ, Park MY, Shim BJ, Lee SJ, Kim JH, Park JK, Oh CY, Ahn SH and Cho WH: Post-operative multiple thrombosis associated with patent foramen ovale: Embolic stroke, right atrial thrombi, pulmonary embolism and deep vein thrombosis. J Cardiovasc Ultrasound. 23:177–180. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Ahn S, Kim MH, Jun KW, Hwang JK, Park SC, Moon IS and Kim JI: The incidence and risk factors of deep vein thrombosis after kidney transplantation in Korea: Single center experience. Clin Transplant. 29:1181–1186. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Alderman BE, de Boisanger J and Bottomley T: Hypoplasia of the inferior vena cava in a young man presenting with extensive deep venous thrombosis. BMJ Case Rep 2015. pii bcr2015211849. 2015. View Article : Google Scholar

8 

Park SI, Lee M, Lee MS, Kim MD, Won JY and Lee DY: Single-session aspiration thrombectomy of lower extremity deep vein thrombosis using large-size catheter without pharmacologic thrombolysis. Cardiovasc Intervent Radiol. 37:412–419. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Gholami K, Talasaz AH, Entezari-Maleki T, Salarifar M, Hadjibabaie M, Javadi MR, Dousti S, Hamishehkar H and Maleki S: The effect of high-dose vitamin D3 on soluble p-selectin and hs-crp level in patients with venous thromboembolism: A randomized clinical trial. Clin Appl Thromb Hemost. 22:483–489. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Du T and Tan Z: Relationship between deep venous thrombosis and inflammatory cytokines in postoperative patients with malignant abdominal tumors. Braz J Med Biol Res. 47:1003–1007. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Entezari-Maleki T, Talasaz A Hajhossein, Salarifar M, Hadjibabaie M, Javadi MR, Bozorgi A, Jenab Y, Boroumand MA and Gholami K: Plasma VITAMIN D status and its correlation with risk factors of thrombosis, P-selectin and hs-CRP level in patients with venous thromboembolism; the first study of Iranian population. Iran J Pharm Res. 13:319–327. 2014.PubMed/NCBI

12 

Stypińska B and Paradowska-Gorycka A: Cytokines and MicroRNAs as candidate biomarkers for systemic lupus erythematosus. Int J Mol Sci. 16:24194–24218. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Zhu W, Qian J, Ma L, Ma P, Yang F and Shu Y: MiR-346 suppresses cell proliferation through SMYD3 dependent approach in hepatocellular carcinoma. Oncotarget. May 22–2017.doi: 10.18632/oncotarget.18060. (Epub ahead of print).

14 

Iwakawa HO and Tomari Y: The functions of MicroRNAs: mRNA decay and translational repression. Trends Cell Biol. 25:651–665. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Huang YK and Yu JC: Circulating microRNAs and long non-coding RNAs in gastric cancer diagnosis: An update and review. World J Gastroenterol. 21:9863–9886. 2015. View Article : Google Scholar : PubMed/NCBI

16 

He Y, Lin J, Kong D, Huang M, Xu C, Kim TK, Etheridge A, Luo Y, Ding Y and Wang K: Current state of circulating MicroRNAs as cancer biomarkers. Clin Chem. 61:1138–1155. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Libânio D, Dinis-Ribeiro M and Pimentel-Nunes P: Helicobacter pylori and microRNAs: Relation with innate immunity and progression of preneoplastic conditions. World J Clin Oncol. 6:111–132. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Sakimoto T and Ishimori A: Anti-inflammatory effect of topical administration of tofacitinib on corneal inflammation. Exp Eye Res. 145:110–117. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Schaefer JK, Jacobs B, Wakefield TW and Sood SL: New biomarkers and imaging approaches for the diagnosis of deep venous thrombosis. Curr Opin Hematol. 24:274–281. May;2017. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-tie quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Kim JH, Jeon S and Shin BA: MicroRNA-29 family suppresses the invasion of HT1080 human fibrosarcoma cells by regulating matrix metalloproteinase 2 expression. Chonnam Med J. 53:161–167. May;2017. View Article : Google Scholar : PubMed/NCBI

22 

Bardina SV, Michlmayr D, Hoffman KW, Obara CJ, Sum J, Charo IF, Lu W, Pletnev AG and Lim JK: Differential roles of chemokines CCL2 and CCL7 in monocytosis and leukocyte migration during west nile virus infection. J Immunol. 195:4306–4318. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Cummings R, Zhao Y, Jacoby D, Spannhake EW, Ohba M, Garcia JG, Watkins T, He D, Saatian B and Natarajan V: Protein kinase Cdelta mediates lysophosphatidic acid-induced NF-kappaB activation and interleukin-8 secretion in human bronchial epithelial cells. J Biol Chem. 279:41085–41094. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Abdalla G, Matuk R Fawzi, Venugopal V, Verde F, Magnuson TH, Schweitzer MA and Steele KE: The diagnostic accuracy of magnetic resonance venography in the detection of deep venous thrombosis: A systematic review and meta-analysis. Clin Radiol. 70:858–871. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Friedmann DP, Liolios AM, Wu DC, Goldman MP and Eimpunth S: A randomized, double-blind, placebo-controlled study of the effect of a high-potency topical corticosteroid after sclerotherapy for reticular and telangiectatic veins of the lower extremities. Dermatol Surg. 41:1158–1163. Oct;2015. View Article : Google Scholar : PubMed/NCBI

26 

Gómez-Outes A, Suárez-Gea ML, Lecumberri R, Terleira-Fernández AI and Vargas-Castrillón E: Direct oral anticoagulants in the treatment of venous thromboembolism, with a focus on patients with pulmonary embolism: An evidence-based review. Vasc Health Risk Manag. 10:627–639. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Olszewski WL, Zaleska M, Stelmach E, Swoboda-Kopec E, Jain P, Agrawal K, Gogia S, Gogia A, Andziak P and Durlik M: Cryptic bacteria of lower limb deep tissues as a possible cause of inflammatory and necrotic changes in ischemia, venous stasis and varices and lymphedema. Surg Infect (Larchmt). 16:313–322. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Saghazadeh A, Hafizi S and Rezaei N: Inflammation in venous thromboembolism: Cause or consequence? Int Immunopharmacol. 28:655–665. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Jenkins JS and Michael P: Deep venous thrombosis: An interventionalist's approach. Ochsner J. 14:633–640. 2014.PubMed/NCBI

30 

Krieger E, Van der Loo B, Amann-Vesti BR, Rousson V and Koppensteiner R: C-reactive protein and red cell aggregation correlate with late venous function after acute deep venous thrombosis. J Vasc Surg. 40:644–649. 2004. View Article : Google Scholar : PubMed/NCBI

31 

Sawant DV, Wu H, Kaplan MH and Dent AL: The Bcl6 target gene microRNA-21 promotes Th2 differentiation by a T cell intrinsic pathway. Mol Immunol. 54:435–442. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Lu S, Jiao H, Xu J, Zheng Y, Sun Y and Chen H: Downregulation of IL6 targeted MiR-376b may contribute to a positive IL6 feedback loop during early liver regeneration in mice. Cell Physiol Biochem. 37:233–242. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Xie Q, Wei M, Kang X, Liu D, Quan Y, Pan X, Liu X, Liao D, Liu J and Zhang B: Reciprocal inhibition between miR-26a and NF-κB regulates obesity-related chronic inflammation in chondrocytes. Biosci Rep. 35:pii e002042015.

34 

Bauer D, Redmon N, Mazzio E, Taka E, Reuben JS, Day A, Sadrud-Din S, Flores-Rozas H, Soliman KF and Darling-Reed S: Diallyl disulfide inhibits TNFα induced CCL2 release through MAPK/ERK and NF-Kappa-B signaling. Cytokine. 75:117–126. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Gao X, Huang W, Zhang X, Du S, Wang J, Wang W, Zhou M, Chen S, Li X and Jonas JB: Chemokine (C-C motif) ligand 2 and chemokine (C-C motif) ligand 7 in angle-closure glaucoma. Acta Ophthalmol. 94:e220–e224. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li Z and Ni J: Role of microRNA‑26a in the diagnosis of lower extremity deep vein thrombosis in patients with bone trauma. Exp Ther Med 14: 5069-5074, 2017.
APA
Li, Z., & Ni, J. (2017). Role of microRNA‑26a in the diagnosis of lower extremity deep vein thrombosis in patients with bone trauma. Experimental and Therapeutic Medicine, 14, 5069-5074. https://doi.org/10.3892/etm.2017.5183
MLA
Li, Z., Ni, J."Role of microRNA‑26a in the diagnosis of lower extremity deep vein thrombosis in patients with bone trauma". Experimental and Therapeutic Medicine 14.5 (2017): 5069-5074.
Chicago
Li, Z., Ni, J."Role of microRNA‑26a in the diagnosis of lower extremity deep vein thrombosis in patients with bone trauma". Experimental and Therapeutic Medicine 14, no. 5 (2017): 5069-5074. https://doi.org/10.3892/etm.2017.5183
Copy and paste a formatted citation
x
Spandidos Publications style
Li Z and Ni J: Role of microRNA‑26a in the diagnosis of lower extremity deep vein thrombosis in patients with bone trauma. Exp Ther Med 14: 5069-5074, 2017.
APA
Li, Z., & Ni, J. (2017). Role of microRNA‑26a in the diagnosis of lower extremity deep vein thrombosis in patients with bone trauma. Experimental and Therapeutic Medicine, 14, 5069-5074. https://doi.org/10.3892/etm.2017.5183
MLA
Li, Z., Ni, J."Role of microRNA‑26a in the diagnosis of lower extremity deep vein thrombosis in patients with bone trauma". Experimental and Therapeutic Medicine 14.5 (2017): 5069-5074.
Chicago
Li, Z., Ni, J."Role of microRNA‑26a in the diagnosis of lower extremity deep vein thrombosis in patients with bone trauma". Experimental and Therapeutic Medicine 14, no. 5 (2017): 5069-5074. https://doi.org/10.3892/etm.2017.5183
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team