Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2018 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population

  • Authors:
    • Xianhua Wang
    • Aiguo Ma
    • Xiuxia Han
    • Aishan Litifu
    • Feng Xue
  • View Affiliations / Copyright

    Affiliations: The School of Public Health, Qingdao University Medical College, Qingdao, Shandong 266021, P.R. China, Department of Respiratory Medicine, Xinjiang Uygur Autonomous Region Chest Hospital, Urumqi, Xinjiang, 830049, P.R. China, Department of Tuberculosis, Xinjiang Uygur Autonomous Region Center for Disease Control and Prevention, Xinjiang Uygur Autonomous Region, Urumqi, Xinjiang 830001, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3392-3398
    |
    Published online on: January 25, 2018
       https://doi.org/10.3892/etm.2018.5800
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Seven single-nucleotide polymorphism (SNP) sites located in ASAP1 gene have been found associated with tuberculosis (TB) susceptibility by genome-wide association studies in Russia. The case-control study was carried out to test whether these seven SNPs were associated with susceptibility to TB in a Chinese Xinjiang Muslim population. The seven SNPs were genotyped in a case-control design that included 780 Xinjiang Muslim subjects (400 TB patients and 380 controls). Multiplex PCR and direct sequencing were used to detect ASAP1 gene polymorphisms. Hardy-Weinberg equilibrium test was performed to test whether the sample was from genetic equilibrium population. The associations of SNPs with TB risk were determined by the distributions of allelic frequencies and different genetic models. Significant differences of the allelic distribution of rs4733781 and rs1017281 in ASAP1 gene were observed between control group and TB group. A allele of rs4733781 was associated with TB risk (TB vs. control, OR=1.242; 95% CI: 1.004-1.537, P=0.046); While in rs1017281 site, G allele was associated with increased risk for TB (TB vs. control, OR: 0.792, 95% CI: 0.643-0.976, P=0.028). The recessive model of rs4733781 (CC vs. AC+AA) in Xinjiang Muslim populations was associated with a lower TB risk [P=0.003, OR=0.51 (0.324-0.802)], while the recessive model of rs1017281 (GG vs. AG+AA) was associated with a higher TB risk [P=0.011, OR=1.792 (1.135-2.828)]. Using case-control analysis, we identified that two genetic polymorphism sites in the ASAP1 relate to host susceptibility of TB in a Chinese Xinjiang Muslim population.

Introduction

Tuberculosis (TB) is one of the public health emergencies all over the world and severely affects human health. TB is especially epidemic in China, which accounted for 12% of the global total cases in 2012 (1). According to 2010 National Technical Steering Group of the Epidemiological Sampling Survey for TB, the weighted prevalence of active, smear-positive, bacteriological positive pulmonary TB were 459/100,000, 66/100,000, 119/100,000, respectively (2). The geographical distribution of TB prevalence presented that it was relatively low in the eastern parts and high in the western parts, and the prevalence rates of active pulmonary TB, Mycobacterium-positive pulmonary TB and smear-positive pulmonary TB in Xinjiang Uygur autonomous region were all higher than that in other provinces (3,4), which demonstrated that Xinjiang bore a heavy burden of TB.

TB is caused by Mycobacterium tuberculosis (MTB), which has infected around a third of the world population (5), but only 10% of those infected progress to active disease in their lifetime, and up to 90% of infected people are asymptomatic with a latent infection (6). Susceptibility to TB varies between different people. Since 1890s, how genetic factors affect clinical outcomes with MTB infection was illustrated by a series of research. For example, several twin studies have found that concordance of TB was higher in monozygotic twins compared to dizygotic twins (7–9). Beyond that, adoption research, Genome-wide association studies, and case-control analysis have been performed to demonstrate that the associations between individual genetics and susceptibility to TB (10–12). These indicated that host genetic factors are important determinants of TB susceptibility.

The ASAP1 gene (known as AMAP1 or DDEF1), located at 8q24.1–8q24.2, encodes an Arf GTPase-activating protein (Arf GAP), which is a multifunctional scaffold protein that induces hydrolysis of GTP bound to the ADP ribosylation factor family GTP-binding (Arf) proteins (13–15). ASAP1 has been implicated in regulating cell motility and invasion (16,17). It was found to functionally link with the progression and metastasis of tumor cells, including ovary cancer (18), prostate cancer (19), and breast cancer (20,21). Curtis et al (14) found that the expression of ASAP1 gene in MTB-infected dendritic cells was dramatically reduced, which may impair DC migration, suggesting a potential mechanism that predisposes to TB.

Genome-wide association study is an effective way (9) to screen for the genes exerting the best population-wide impact on susceptibility to a multifactorial disease (22). By using this method, Curtis et al identified a novel ASAP1 gene which was associated with susceptibility to TB (14). Eleven single-nucleotide polymorphisms (SNP)s were identified with significant association with susceptibility to MTB (P<5×10−8). Seven out of the most significantly associated ASAP1 SNPs were individually genotyped to replicate their discovery, the most significant association was at rs4733781 (P=2.6×10−11). Then the associations between ASAP1 SNPs and susceptibility to MTB were studied in Chinese population, but not in Xinjiang minorities (23,24). As far as we know, it is the first study which explored association between ASAP1 SNPs and susceptibility to MTB in Xinjiang Muslim populations.

Owing to population heterogeneity, different races have different causative polymorphisms (25). In this study, we selected a set of SNPs within the entire ASAP1 gene and used case-control analysis in Xinjiang Muslim populations to investigate whether ASAP1 SNP was associated with TB risk.

Materials and methods

Subject

In this study all the participants, including 400 TB patients and 380 control subjects, were of Xinjiang Muslim ethnicity. For TB patients, there were 322 Uyghur patients, 46 Kazak patients and 32 Hui nationality patients. Correspondingly, the Uyghur patients, Kazak patients and Hui nationality patients were 306, 44 and 30, respectively in the control group.

Eligible cases were adult patients who were newly diagnosed with active TB. These patients have evident lesions of TB through simple computed tomography, X-ray, and positive results of sputum smears and cultures for mycobacteria. Patients with HIV-infection, hepatitis virus infection, immunodeficiency disease, and other lung diseases were excluded from this cohort. Healthy controls were nationality-, age- and sex-matched Xinjiang minorities from Department of Respiratory Medicine, Xinjiang Uygur Autonomous Region Chest Hospital, the Xinjiang Uygur Autonomous Region, Urumqi, Xinjiang, China. The controls were negative both for history of TB and T-SPOT assay. All participants were BCG vaccinated.

Each patient and control enrolled in this study provided a written informed consent. The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the Ethics Committee of Department of Respiratory Medicine, Xinjiang Uygur Autonomous Region Chest Hospital.

Blood sample collection, DNA isolation, purification and quality test

Peripheral blood samples (10 ml) was collected from each participants and stored at −80°C. Genomic DNA was extracted from peripheral blood collected from 400 TB patients and 380 non-TB controls using a Genomic DNA Mini Preparation kit (Beyotime, Shanghai, China) according to the manufacturer's instructions. Then a reference gene ASAP1 was used for qualifying the extracted samples by polymerase chain reaction (PCR) and electrophoresis. Obvious imaging was regarded as qualified, or genomic DNA would be extracted again.

Gene polymorphism detection
SNP selection

According to Curtis et al (14), 7 polymorphic sites in ASAP1 gene were adopted in our study, including rs1017281, rs10956514, rs1469288, rs17285138, rs2033059, rs4733781, rs12680942. The details of primers are presented in Table I.

Table I.

Clinical characteristics of patients and controls.

Table I.

Clinical characteristics of patients and controls.

CharacteristicsTB patientsControlχ2P-value
Number400380
Age (years)55.4±12.455.7±12.1 0.675
Nationality 0.2810.869
  Uyghur322 (79.8%)306 (81.2%)
  Kazakhs46 (11.5%)44 (11.0%)
  Hui32 (8.8%)30 (7.9%)
Sex 0.6660.415
  Male237 (59.2%)236 (62.1%)
  Female163 (40.8%)144 (37.9%)
Family history of TB 1.3190.251
  Yes38 (9.5%)29 (7.2%)
  No362 (90.5%)371 (92.8%)

[i] TB, tuberculosis.

Primer design

After searching the whole ASAP1 gene sequence in Genebank, 7 primers pairs were designed and synthetized by Shanghai Biological Engineering Company (Table II).

Table II.

SNPs with their primers.

Table II.

SNPs with their primers.

SNP IDGeneSNPPrimer sequence (5′-3′)Annealing temperature (°C)Fragment size (bp)
rs10956514ASAP1A/G GGCCACTGGCAAAAATAAGC55320
AGTTGTCCAACTGCGGATAC
rs4733781ASAP1A/C CAAATGAACCCCCATAAAGG55238
CCAGTGGCTGCATCCTACAT
rs1017281ASAP1C/T TATCTAATGTGCAGGGGATTG55298
TCTCCCTTTTGCAGCTCACA
rs1469288ASAP1C/T TCCACACTGCTGAAAAATCTG55521
AAGGATGTGGGGAGTTGAGG
rs2033059ASAP1C/T ACATACGTGGTGGTTGACTG54393
TCCCAAAGCACAGAGGAAGA
rs12680942ASAP1A/G GCTGCTATAAAGACCCAGAAG56207
GGCCATTTCTCCAAAGCCTCT
rs17285138ASAP1A/T CTGACTTGGTGCCAGCCTAC54319
TGCTTTCCCAGAGCTTTCAG

[i] SNP, single-nucleotide polymorphism; ASAP1, Arf GTPase-activating protein-1.

Multiplex PCR amplification and product purification

SNPs were genotyped by multiplex PCR reaction using AmpliTaq Gold® 360 Master Mix (Applied Biosystems, Carlsbad, CA, USA), according to its protocol. The PCR reaction was designed to amplify fragments covering all 7 SNP loci. The PCR product was purified using PCR Clean Up kit (Beyotime) according to the protocol.

SNP detection

Polymorphic loci genotypes were detected using Sanger sequencing.

Statistical analysis

Statistical power was calculated by a post hoc power analysis by G*Power 3.1.9.2 software (Program written, conceptualized and designed by Franz, Universitat Kiel, Germany; freely available windows application software). The data were analyzed by SPSS 18.0 software (SPSS Inc., Chicago, IL). Continuous variables and categorical data were compared by χ2 test. Hardy-Weinberg equilibrium test was used to detect whether the two groups were in genetic equilibrium. Genotype frequency comparisons between groups were presented as odds ratio (OR) and 95% confidence interval (CI). Haploview 4.2 (26) was used to performed linkage disequilibrium analysis. The tests were 2-sided and P<0.05 was considered to indicate a statistically significant difference.

Results

General characteristic of TB patients and healthy controls

The clinical characteristics of the total TB patients and healthy controls are summarized in Table III. TB patients were age matched with healthy controls. The age distribution between the patients (55.4±12.4 years) and controls (55.7±12.1 years) was not significantly different based on Mann-Whitney U test (P=0.675), as the data were non-normally distributed (Table I). Patients were also gender-matched with controls, no significant difference of gender was found between the two groups (χ2=0.666, P=0.415). Nationality of objects display no difference between patients and controls (χ2=0.281, P=0.869). Among 400 TB patients, 38 persons had family history of TB, while there were 29 persons with family history of TB in control group, no significance was found between two groups (χ2=1.319, P=0.251). A post hoc power analysis showed that Power value equals 0.8620, meaning a high statistical effect (Fig. 1). The parameters used in power analysis were as follows: cases, 400; controls, 380; prevalence, 0.00178; odds ratio, 1.5070; minor allele frequency, 0.3536.

Figure 1.

Linkage disequilibrium (LD) patterns of seven SNPs among CHB (n=103). The left displays Pairwise D' and the right displays r2. Strong linkage disequilibrium is represented by a high percentage. The red squares without a number indicate 100%. The whole area was in strong linkage disequilibrium, can be used as a block.

Table III.

Genotyping of rs1469288, rs2033059, rs12680942, Rs17285138 in TB and control group in Xinjiang Muslin population.

Table III.

Genotyping of rs1469288, rs2033059, rs12680942, Rs17285138 in TB and control group in Xinjiang Muslin population.

Site/genotype/alleleSNPTB patientsControlOR (95% CI)P-value
rs1469288HWE(P) 0.20
  GenotypeAA203 (50.8%)194 (51.1%)
AG169 (42.4%)160 (42.2%)
GG28 (6.8%)26 (6.7%) 0.994
  AlleleA575 (71.9%)548 (72.1%)
G225 (28.1%)212 (27.9%)0.989 (0.793–1.233)0.919
rs2033059HWE(P) 0.45
  GenotypeCC130 (32.5%)108 (28.5%)
CT192 (48.0%)203 (53.3%)
TT  78 (19.5%)  69 (18.2%) 0.293
  AlleleC452 (56.5%)419 (55.1%)
T348 (43.5%)341 (44.9%)1.507 (0.866–1.291)0.586
rs12680942HWE(P) 0.99
  GenotypeAA132 (33.0%)110 (29.0%)
AG183 (45.9%)202 (53.0%)
GG  85 (21.2%)  68 (17.9%) 0.116
  AlleleA447 (55.9%)422 (55.5%)
G353 (44.1%)338 (44.5%)1.014 (0.83–1.239)0.89
rs17285138HWE(P) 0.09
  GenotypeAA126 (31.6%)105 (27.7%)
AT204 (51.0%)204 (53.6%)
TT  70 (17.4%)  71 (18.7%) 0.496
  AlleleA456 (57.0%)414 (54.5%)
T344 (43.0%)346 (45.5%)1.108 (0.907–1.353)0.315

[i] HWE(P), Hardy-Weinberg equilibrium P-value; OR, odds ratio; CI, confidence intervals.

Hardy-Weinberg equilibrium test

The rs10956514, rs1469288, rs2033059, rs4733781, rs1017281, rs17285138, rs12680942 SNPs were investigated in 400 pulmonary TB cases and 380 healthy controls in the Xinjiang Muslim population. rs10956514 site was not in Hardy-Weinberg equilibrium (P<0.05), so it was excluded from our research. The last six SNPs were in Hardy-Weinberg equilibrium in the control group and the pulmonary TB group (P>0.05) (Tables III and IV).

Table IV.

Genotyping of rs10956514, rs4733781, rs1017281 in TB and control group in Xinjiang Muslin population.

Table IV.

Genotyping of rs10956514, rs4733781, rs1017281 in TB and control group in Xinjiang Muslin population.

Site/genotype/alleleSNPTB patientsControlOR (95% CI)P-value
rs10956514HWE(P) 0.013
  GenotypeGG136 (34.0%)133 (35.0%)
GA207 (51.8%)199 (52.4%)
AA  57 (14.2%)  48 (12.6%) 0.799
  AlleleG479 (59.9%)465 (61.2%)
A321 (40.1%)295 (38.8%)0.947 (0.773–1.160)0.597
rs4733781HWE(P) 0.12
  GenotypeAA194 (48.6%)174 (45.8%)
AC173 (43.2%)149 (39.2%)
CC33 (8.2%)57 (15%) 0.012
  AlleleA561 (70.1%)497 (65.4%)
C239 (29.9%)263 (34.6%)1.242 (1.004–1.537)0.046
rs1017281HWE(P) 0.56
  GenotypeAA165 (41.2%)171 (45.0%)
AG187 (46.8%)177 (46.6%)
GG58 (12.0%)32 (8.4%) 0.034
  AlleleA517 (64.6%)519 (67.3%)
G283 (35.4%)241 (31.7%)0.792 (0.643–0.976)0.028

[i] HWE(P), Hardy-Weinberg equilibrium P-value; OR, odds ratio; CI, confidence intervals. Bold text, statistically significant.

Genotype frequency distribution of ASAP1 gene SNPs in the Xinjiang Muslim population

We used the case-control analysis to examine whether 7 polymorphisms in the ASAP1 gene were associated with susceptibility to TB in Xinjiang Muslim population. The genotype and allelic frequencies of ASAP1 7 SNPs are summarized in Tables III and IV. Two polymorphisms were associated with TB (P<0.05), while the other five SNPs showed no significance. For SNP rs4733781 the frequency of allele A in the pulmonary TB group was higher than that in the control group, and there was a significant difference between the two groups (P=0.046). While SNP rs1017281 was lower than that in the control group (Tables III and IV). The direction of effect for the associated alleles of rs4733781 and rs1017281 was the same as in Curtis et al (14).

Associations between genetic model of SNPs and TB risk

In order to find the optimal genetic model, we built codominant, dominant, recessive and overdominant model of ASAP1 gene polymorphisms. rs4733781 site was found related to the occurrence of TB in the recessive model (CC vs. AA+AC: OR, 0.51; 95% CI: 0.324–0.802; P=0.003) and co-dominant model (AA vs. CC: OR, 1.926; 95% CI: 1.198–3.097; P=0.006). rs1017281 site was associated with TB in the recessive model (GG vs. AA+AG: OR, 1.792; 95% CI: 1.135–2.828; P=0.011) and co-dominant model (AA vs. GG: OR, 0.532; 95% CI: 0.329–0.826; P=0.01) (Tables V and VI).

Table V.

Association of ASAP1 SNP genotypes with pulmonary TB under different genotype models.

Table V.

Association of ASAP1 SNP genotypes with pulmonary TB under different genotype models.

ModelGenotypeCaseControlOR (95% CI)P-value
rs4733781 AA194 (48.6%)174 (45.8%)1
CodominantAC173 (43.2%)149 (39.2%)0.96 (0.712–1.296)0.791
CC33 (8.2%)57 (15%)1.926 (1.198–3.097)0.006
DominantAA194 (48.5%)174 (45.8%)
AC+CC206 (51.5%)206 (54.2%)1.115 (0.841–1.477)0.448
RecessiveCC33 (8.2%)  57 (15.0%)
AC+AA367 (91.8%)323 (85.0%)0.51 (0.324–0.802)0.003
OverdominantAA+CC227 (56.8%)231 (60.8%)
AC173 (43.2%)149 (39.2%)0.846 (0.636–1.126)0.252
rs1017281 AA165 (41.2%)171 (45.0%)1
CodominantAG187 (46.8%)177 (46.6%)0.913 (0.679–1.229)0.549
GG  58 (12.0%)32 (8.4%)0.532 (0.329–0.862)0.01
DominantAA165 (41.2%)171 (45.0%)
AG+GG235 (58.8%)209 (55.0%)0.858 (0.646–1.140)0.29
RecessiveGG  48 (12.0%)32 (8.4%)
AA+AG352 (88.0%)348 (91.0%)1.792 (1.135–2.828)0.011
OverdominantAA+GG213 (53.2%)203 (53.4%)
AG187 (46.8%)177 (46.6%)1.04 (0.786–1.375)0.785

[i] Bold text, statistically significant.

Table VI.

The data of D' and r2 among 7 SNPs of ASPAP1 gene in the Chinese Xinjiang Muslim population.

Table VI.

The data of D' and r2 among 7 SNPs of ASPAP1 gene in the Chinese Xinjiang Muslim population.

L1L2D'r^2
rs1469288rs101728111
rs1469288rs1095651410.979
rs1469288rs1268094211
rs1469288rs203305910.959
rs1469288rs473378111
rs1469288rs1728513810.979
rs1017281rs1095651410.979
rs1017281rs1268094211
rs1017281rs203305910.959
rs1017281rs473378111
rs1017281rs1728513810.979
rs10956514rs1268094210.979
rs10956514rs203305910.979
rs10956514rs473378110.979
rs10956514rs172851380.9790.958
rs12680942rs203305910.959
rs12680942rs473378111
rs12680942rs1728513810.979
rs2033059rs473378110.959
rs2033059rs1728513810.979
rs4733781rs1728513810.979
Linkage disequilibrium analysis

Haploview 4.2 was used to performed linkage disequilibrium analysis. As shown in Fig. 2, linkage disequilibrium patterns for the cluster of 7 SNPs in the ASAP1 gene genotyped in a Chinese Xinjiang Muslim population. The results showed that the whole areas were strong linkage disequilibrium and they can be used as a block. Therefore, rs4733781 and rs1017281 were linked together, they should be considered as one locus.

Figure 2.

Linkage disequilibrium analysis.

Discussion

Xinjiang Uygur Autonomous Region bears heavier tuberculosis (TB) burden than other areas in China (3). The selection of candidate genes and detection of their polymorphism sites have been considered breakthroughs of TB prevention and treatment. Curtis et al (14) found single-nucleotide polymorphisms of ASAP1 gene was associated with the susceptibility to TB in the Russian population (14), while Hu et al (23) and Miao et al (24) found no associations. This may be partly due to differences between populations and small statistical power of the follow-up studies to detect weak genetic effects. However, no case-control analysis has been reported in Xinjiang Muslim population to date. Hence, investigating the susceptibility genes in Xinjiang Muslim population may provide access to control TB in Xinjiang Uygur autonomous region.

In the present study, we tested association of ASAP1 gene polymorphism and TB susceptibility in Xinjiang Muslim population by SNP genotyping. Our data suggested that ASAP1 rs4733781 and rs1017281 polymorphisms were associated with TB susceptibility in Xinjiang Muslim population (P=0.046 and P=0.028). While no significant associations were found in rs10956514, rs1469288, rs2033059, rs12680942 and rs17285138. In contrast to our findings, Hu et al (23) and Miao et al (24) found that ASAP1 gene polymorphism was not associated with TB susceptibility in Chinese population and Tibetan population. As known, there are ethnic variations of the allelic frequency distribution in the investigated polymorphism markers (25). In addition, numerous gene studies indicated that the risk variants of genetic heterogeneity and ethnicity specificity was associated with TB (27,28). An explanation for these divergent results may involve whether polymorphism itself acts functionally and confers a truly altered susceptibility to TB disease or the associated allele was an unknown disease susceptibility allele in linkage disequilibrium. In this regard, it is necessary to note that excessive reduction of ASAP1 expression results in the impaired migration of Mycobacterium tuberculosis (MTB)-infected DCs, which may contribute to TB pathogenesis (14). Other co-variables may not be excluded, such as socio-economic factors, nutritional status, and interactions between genes (29). Therefore, in-depth study on the function of these sites is needed. In addition, in light of marginal P-values of associations between ASAP1 SNPs and TB susceptibility (P=0.046 and P=0.028), multiple corrections should be considered in our later work, such as nationality, age, sex, smoking and family history. An independent Uyghur sample will be a good option to get converse results.

Regarding different genotype models, our results demonstrated that a trend of higher rs4733781 A allele and rs1017281 G allele in TB group compared to controls. Different genotype models revealed that subjects with rs4733781 A and rs1017281 G could be more susceptible to TB while subjects with rs4733781 T and rs1017281 A could be more resistant. The recessive model of rs4733781 (CC vs. AC+AA) in Xinjiang Muslim populations tended to be related with a lower TB risk [P=0.003, OR=0.51 (0.324–0.802)], while the recessive model of rs1017281 (GG vs. AA+AG) seemed to be related with a higher TB risk [P=0.011, OR=1.792 (1.135–2.828)].Additionally, the linkage disequilibrium analysis showed that rs4733781 and rs1017281 were linked together, they should be considered one locus. Next, profound studies will be performed to explore the potential functional roles of these two SNPs to help understand major findings. Do they participate in the immunoreaction caused by TB? What is the exact mechanism? Much work remains to be done.

In conclusion, ASAP1 rs4733781 and rs1017281 polymorphism may be a genetic factor for susceptibility to MTB among the Xinjiang Muslim populations. Further investigations of the functional role of SNP rs4733781 and rs1017281 and the genomic surrounding region are warranted.

Acknowledgements

Not applicable.

Funding

The study was supported by the National Natural Science Foundation of China (81673160) and The Xinjiang Uygur Autonomous Region Natural Science Foundation (2016D01B015) and The Xinjiang Uygur Autonomous Region Natural Science Foundation (2017D01A25).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

XW contributed to the conception of the study; AM and XH contributed significantly to analysis and manuscript preparation; AL performed the data analyses and wrote the manuscript; FX helped perform the analysis with constructive discussions. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the Ethics Committee of Department of Respiratory Medicine, Xinjiang Uygur Autonomous Region Chest Hospital. Each patient and control enrolled in this study provided a written informed consent.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Zumla A, George A, Sharma V, Herbert RH, Oxley A and Oliver M: Baroness Masham of Ilton: The WHO 2014 global tuberculosis report - further to go. Lancet Glob Health. 3:e10–e12. 2015. View Article : Google Scholar : PubMed/NCBI

2 

National Technical Steering Group of the Epidemiological Sampling Survey for Tuberculosis, . Implementing Office of the Epidemiological Sampling Survey for Tuberculosis: The prevalence of pulmonary tuberculosis in a national survey across China in 2010. Zhonghua Jie He He Hu Xi Za Zhi. 35:665–668. 2012.(In Chinese). PubMed/NCBI

3 

Li XX, Zhang H, Jiang SW, Liu XQ, Fang Q, Li J, Li X and Wang LX: Geographical distribution regarding the prevalence rates of pulmonary tuberculosis in China in 2010. Zhonghua Liu Xing Bing Xue Za Zhi. 34:980–984. 2013.(In Chinese). PubMed/NCBI

4 

Wubuli A, Xue F, Jiang D, Yao X, Upur H and Wushouer Q: Socio-demographic predictors and distribution of pulmonary tuberculosis (TB) in Xinjiang, China: A spatial analysis. PLoS One. 10:e01440102015. View Article : Google Scholar : PubMed/NCBI

5 

Siroka A, Ponce NA and Lönnroth K: Association between spending on social protection and tuberculosis burden: A global analysis. Lancet Infect Dis. 16:473–479. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Png E, Alisjahbana B, Sahiratmadja E, Marzuki S, Nelwan R, Balabanova Y, Nikolayevskyy V, Drobniewski F, Nejentsev S, Adnan I, et al: A genome wide association study of pulmonary tuberculosis susceptibility in Indonesians. BMC Med Genet. 13:52012. View Article : Google Scholar : PubMed/NCBI

7 

Comstock GW: Tuberculosis in twins: A re-analysis of the Prophit survey. Am Rev Respir Dis. 117:621–624. 1978.PubMed/NCBI

8 

Varpela E: Studies on tuberculosis in twins. Duodecim. 73:242–250. 1957.(In Finnish). PubMed/NCBI

9 

Rubinstein U, Schachter J, Sharon N, Talnir R and Amir J: Tuberculosis in a pair of twins - the use of molecular biology methods for the detection of the source of infection. Harefuah. 146:170–172, 248. 2007.(In Hebrew). PubMed/NCBI

10 

Khor CC, Vannberg FO, Chapman SJ, Guo H, Wong SH, Walley AJ, Vukcevic D, Rautanen A, Mills TC, Chang KC, et al: CISH and susceptibility to infectious diseases. N Engl J Med. 362:2092–2101. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Garzón MC, Angée DY, Llerena C, Orjuela DL and Victoria JE: Surveillance of Mycobacterium tuberculosis resistance to antituberculosis drugs. Biomedica. 28:319–326. 2008.(In Spanish). View Article : Google Scholar : PubMed/NCBI

12 

Ladefoged K, Rendal T, Skifte T, Andersson M, Søborg B and Koch A: Risk factors for tuberculosis in Greenland: Case-control study. Int J Tuberc Lung Dis. 15:44–49. 2011.PubMed/NCBI

13 

Nie Z and Randazzo PA: Arf GAPs and membrane traffic. J Cell Sci. 119:1203–1211. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Curtis J, Luo Y, Zenner HL, Cuchet-Lourenço D, Wu C, Lo K, Maes M, Alisaac A, Stebbings E, Liu JZ, et al: Susceptibility to tuberculosis is associated with variants in the ASAP1 gene encoding a regulator of dendritic cell migration. Nat Genet. 47:523–527. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Tien DN, Kishihata M, Yoshikawa A, Hashimoto A, Sabe H, Nishi E, Kamei K, Arai H, Kita T, Kimura T, et al: AMAP1 as a negative-feedback regulator of nuclear factor-κB under inflammatory conditions. Sci Rep. 4:50942014. View Article : Google Scholar : PubMed/NCBI

16 

Oda A, Wada I, Miura K, Okawa K, Kadoya T, Kato T, Nishihara H, Maeda M, Tanaka S, Nagashima K, et al: CrkL directs ASAP1 to peripheral focal adhesions. J Biol Chem. 278:6456–6460. 2003. View Article : Google Scholar : PubMed/NCBI

17 

Nie Z, Hirsch DS, Luo R, Jian X, Stauffer S, Cremesti A, Andrade J, Lebowitz J, Marino M, Ahvazi B, et al: A BAR domain in the N terminus of the Arf GAP ASAP1 affects membrane structure and trafficking of epidermal growth factor receptor. Curr Biol. 16:130–139. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Hou T, Yang C, Tong C, Zhang H, Xiao J and Li J: Overexpression of ASAP1 is associated with poor prognosis in epithelial ovarian cancer. Int J Clin Exp Pathol. 7:280–287. 2013.PubMed/NCBI

19 

Lin D, Watahiki A, Bayani J, Zhang F, Liu L, Ling V, Sadar MD, English J, Fazli L, So A, et al: ASAP1, a gene at 8q24, is associated with prostate cancer metastasis. Cancer Res. 68:4352–4359. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Sabe H, Hashimoto S, Morishige M, Ogawa E, Hashimoto A, Nam JM, Miura K, Yano H and Onodera Y: The EGFR-GEP100-Arf6-AMAP1 signaling pathway specific to breast cancer invasion and metastasis. Traffic. 10:982–993. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Onodera Y, Hashimoto S, Hashimoto A, Morishige M, Mazaki Y, Yamada A, Ogawa E, Adachi M, Sakurai T, Manabe T, et al: Expression of AMAP1, an ArfGAP, provides novel targets to inhibit breast cancer invasive activities. EMBO J. 24:963–973. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Bellamy R: Susceptibility to mycobacterial infections: The importance of host genetics. Genes Immun. 4:4–11. 2003. View Article : Google Scholar : PubMed/NCBI

23 

Hu X, Peng W, Chen X, Zhao Z, Zhang J, Zhou J, Cai B, Chen J, Zhou Y, Lu X, et al: No significant effect of ASAP1 gene variants on the susceptibility to tuberculosis in Chinese population. Medicine (Baltimore). 95:e37032016. View Article : Google Scholar : PubMed/NCBI

24 

Miao R, Ge H, Xu L, Sun Z, Li C, Wang R, Ding S, Yang C and Xu F: Genetic variants at 18q11.2 and 8q24 identified by genome-wide association studies were not associated with pulmonary tuberculosis risk in Chinese population. Infect Genet Evol. 40:214–218. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Yim JJ and Selvaraj P: Genetic susceptibility in tuberculosis. Respirology. 15:241–256. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Barrett JC, Fry B, Maller J and Daly MJ: Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics. 21:263–265. 2005. View Article : Google Scholar : PubMed/NCBI

27 

Delgado JC, Baena A, Thim S and Goldfeld AE: Ethnic-specific genetic associations with pulmonary tuberculosis. J Infect Dis. 186:1463–1468. 2002. View Article : Google Scholar : PubMed/NCBI

28 

El Baghdadi J, Remus N, Benslimane A, El Annaz H, Chentoufi M, Abel L and Schurr E: Variants of the human NRAMP1 gene and susceptibility to tuberculosis in Morocco. Int J Tuberc Lung Dis. 7:599–602. 2003.PubMed/NCBI

29 

Perrin P: Human and tuberculosis co-evolution: An integrative view. Tuberculosis (Edinb). 95 Suppl 1:S112–S116. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang X, Ma A, Han X, Litifu A and Xue F: ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population. Exp Ther Med 15: 3392-3398, 2018.
APA
Wang, X., Ma, A., Han, X., Litifu, A., & Xue, F. (2018). ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population. Experimental and Therapeutic Medicine, 15, 3392-3398. https://doi.org/10.3892/etm.2018.5800
MLA
Wang, X., Ma, A., Han, X., Litifu, A., Xue, F."ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population". Experimental and Therapeutic Medicine 15.4 (2018): 3392-3398.
Chicago
Wang, X., Ma, A., Han, X., Litifu, A., Xue, F."ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population". Experimental and Therapeutic Medicine 15, no. 4 (2018): 3392-3398. https://doi.org/10.3892/etm.2018.5800
Copy and paste a formatted citation
x
Spandidos Publications style
Wang X, Ma A, Han X, Litifu A and Xue F: ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population. Exp Ther Med 15: 3392-3398, 2018.
APA
Wang, X., Ma, A., Han, X., Litifu, A., & Xue, F. (2018). ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population. Experimental and Therapeutic Medicine, 15, 3392-3398. https://doi.org/10.3892/etm.2018.5800
MLA
Wang, X., Ma, A., Han, X., Litifu, A., Xue, F."ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population". Experimental and Therapeutic Medicine 15.4 (2018): 3392-3398.
Chicago
Wang, X., Ma, A., Han, X., Litifu, A., Xue, F."ASAP1 gene polymorphisms are associated with susceptibility to tuberculosis in a Chinese Xinjiang Muslim population". Experimental and Therapeutic Medicine 15, no. 4 (2018): 3392-3398. https://doi.org/10.3892/etm.2018.5800
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team