Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF‑β1 and VEGF

  • Authors:
    • Daning Zhang
    • Haixiang Qin
    • Ying Leng
    • Xiangjun Li
    • Lei Zhang
    • Dan Bai
    • Yujun Meng
    • Jingyi Wang
  • View Affiliations / Copyright

    Affiliations: Department of Ophthalmology, Affiliated Hospital of Beihua University, Jilin 132011, P.R. China, Department of Legal Medical Experts, Public Security Bureau of Jilin City, Jilin 132011, P.R. China
  • Pages: 2337-2342
    |
    Published online on: July 17, 2018
       https://doi.org/10.3892/etm.2018.6451
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

In view of the high incidence of diabetic retinopathy and the functionality of long non‑coding RNA (lncRNA) maternally expressed gene 3 (MEG3) in different disease models, the present study aimed to investigate the role of MEG3 in diabetic retinopathy. In the study, patients with diabetic retinopathy, diabetic patients without retinopathy as well as healthy people were included. Fasting blood was extracted from each participant. Serum MEG3 levels were detected by everse transcription‑quantitative polymerase chain reaction (RT‑qPCR) and serum vascular endothelial growth factor (VEGF) and transforming growth factor‑β1 (TGF‑β1) levels were detected by ELISA. Also, the effects of high glucose treatment on the expression of MEG3 and VEGF and the effects of MEG3 overexpression on expression of VEGF and TGF‑β1 in high glucose‑treated ARPE‑19 cells were detected by RT‑qPCR and western blot analysis to determine the mRNA and protein levels, respectively. It was indicated that serum levels of MEG3 were significantly lower, while the serum levels of VEGF and TGF‑β1 were significantly higher in patients with diabetic retinopathy and diabetic patients without retinopathy compared with the healthy controls. Furthermore, slight differences were found between patients with diabetic retinopathy and diabetic patients without retinopathy; however, these differences were not significant. The findings indicated that high glucose upregulated the expression of VEGF mRNA and downregulated the expression of MEG3, MEG3 overexpression reduced the increased expression levels of VEGF and TGF‑β1 induced by high glucose treatment. Therefore, it was concluded that lncRNA MEG3 overexpression may inhibit the development of diabetic retinopathy by inhibiting TGF‑β1 and VEGF expression.

Introduction

With the development of modern society and changes in people's life style and diet structure, incidence of diabetes has been increased significantly during the last several decades (1). Besides diabetes itself, complications of this disease also seriously affects human health (2). As one of the common complications of diabetes, diabetic retinopathy, which is caused by the long-term hyperglycemia, is the most serious eye disease that may eventually lead to blindness (3). It has been reported that more than 80% of diabetic patients with a course of disease longer than 20 years will develop diabetic retinopathy (4). Although disease conditions in almost 90% of patients with diabetic retinopathy can been improved with proper treatment, blindness will happen in the remaining 10% due to unexplained reasons (5). Therefore, the identification of novel treatment targets for diabetic retinopathy is always needed to improve treatment outcomes of this disease.

Long non-coding RNA (lncRNA) refers to a group of RNA transcripts composed of more than 200 nucleotides that will not be translated into protein products (6). Since its discovery, lncRNAs have been proved to play pivotal roles in almost all important physiological processes in animal, plant and the human body (7). Besides that, lncRNAs also participate in the progression of various pathological conditions, including the development of human diseases, such as cancer (8), and heart diseases (9). Studies in last serval years also showed that the development of diabetic retinopathy also requires the participation of lncRNAs (10). As a tumor suppressor gene, functionality of lncRNA maternally expressed gene 3 (MEG3) has been widely studied in different types of human cancer (11,12). It has been reported that lncRNA MEG3 can suppress neovascularization, which is a key step of the development of diabetic retinopathy, indicating the potential inhibitory effects of MEG3 on diabetic retinopathy. However, functionality of MEG3 in diabetic retinopathy remains unclear.

In this study, serum levels of MEG3 in patients with diabetic retinopathy, diabetic patients without retinopathy as well as healthy people were measured. Interactions between MEG3, and vascular endothelial growth factor (VEGF) and transforming growth factor-β1 (TGF-β1), which are two key players in diabetic retinopathy were explored. There report is as follow:

Materials and methods

Patients

A total of 33 patients with diabetic retinopathy were selected in Affiliated Hospital of Beihua University (Jilin, China) from January 2014 to January 2017. All those patients were diagnosed according to the diagnostic criteria established by Chinese Medical Association in 2014. Patients with other types of retinopathy were excluded. Those patients included 15 males and 17 females, and age ranged from 44 to 71 years, with an average age of 56±11.3 years. During the same time period, 28 diabetic patients without retinopathy were also selected. Those diabetic patients included 12 males and 16 females, and age ranged from 39 to 77 years, with an average age of 53±14.1 years. At the same time, 30 healthy people were selected as control group. Control group included 11 males and 19 females, and the age ranged from 40 to 72 years, with an average age of 54±13.7 years. No significant differences in age and gender were found among three groups. This study was approved by the Ethics Committee of Affiliated Hospital of Beihua University. All patients signed informed consent.

Preparation of serum samples

Fasting blood (20 ml) was extracted from each participant in the morning. Blood samples were kept at room temperature for 1 h, followed by centrifugation at 2,500 × g for 20 min to collect serum samples. Serum samples were stored at −80°C before use.

ELISA

Serum levels of VEGF and TGF-β1 were detected using corresponding ELISA kit provided by (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) according to the instructions.

Cell line and cell culture

Human retinal pigment epithelial cell line ARPE-19 was provided by American Type Culture Collection (Manassas, VA, USA). ARPE-19 cells were cultured under conditions recommended by ATCC. Cells were harvested at logarithmic growth phase.

Establishment of MEG3 overexpression cell line

MEG3 cDNA (V0728, GeneCopoeia) was inserted into pIRSE2-EGFP vector (Clontech Laboratories, Inc., Mountainview, CA, USA) to make MEG3 expression vector. Cells were cultured overnight to reach 80–90% confluent, and transfection was performed using Lipofectamine 2000 reagent (11668-019; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from serum and in vitro cultured cells using Trizol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA quality was checked using NanoDrop™ 2000 Spectrophotometers (Thermo Fisher Scientific, USA), and the ones with a A260/A280 ratio between 1.8 and 2.0 were used in reverse transcription to synthesize cDNA. Following primers were used in PCR reactions: 5′-GCATTAAGCCCTGACCTTTG-3′ (forward) and 5′-TCCAGTTTGCTAGCAGGTGA-3′ (reverse) for MEG3; 5′-AAATGCTTTCTCCGCTCTGA-3′ (forward) and 5′-CCCACTGAGGAGTCCAACAT-3′ (reverse) for VEGF; 5′-CCCAGCATCTGCAAAGCTC-3′ (forward) and 5′-GTCAATGTACAGCTGCCGCA-3′ (reverse) for TGF-β1; GACCTCTATGCCAACACAGT (forward) and AGTACTTGCGCTCAGGAGGA (reverse) for β-actin. PCR reaction conditions were as follow: 95°C for 40 sec, followed by 40 cycles of 95°C for 15 sec and 60°C for 45 sec. Obtained data were processed using 2−ΔΔCq method, and expression of each gene was normalized to endougenous control β-actin.

Western blot analysis

Total protein extraction from in vitro cultured cells was performed using cell lysis buffer (clontech, USA). Protein samples were quantified using BCA. Then 10% SDS-PAGE gel electrophoresis was carried out using 20 µg of protein from each sample. After gel transfer, PVDF membranes were blocked with 5% skimmed milk at room temperature for 1 h. After washing, membranes were incubated with primary antibodies including rabbit anti-VEGF antibody (1:2,000, ab46154; Abcam, Cambridge, UK), anti-TGF-β1 antibody (1:2,000, ab9758; Abcam), and anti-GAPDH antibody (1:1,000, ab9485; Abcam) overnight at 4°C. After washing, membranes were further incubated with anti-rabbit IgG-HRP secondary antibody (1:1,000, MBS435036; MyBioSource, Inc., San Diego, CA, USA) at room temperature for 1 h. After washing, signal detection was performed by ECL (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) method. Image J software was used to normalize relative expression level of each protein to GAPDH.

Statistical analysis

SPSS19.0 (SPSS, Inc., Chicago, IL, USA) was used. Normal distribution data were expressed as mean ± standard deviation), and comparisons among multiple groups were performed by one-way analysis of variance followed by the LSD test. P<0.05 was considered to indicate a statistically significant difference.

Results

Serum levels of MEG3 in three groups

As shown in Fig. 1, serum levels of MEG3 were significantly lower in patients with diabetic retinopathy and diabetic patients than in healthy control (P<0.05). Serum levels of MEG3 were slightly lower in patients with diabetic retinopathy than in diabetic patients, but the difference was not statistically significant.

Figure 1.

Serum levels of MEG3 in three groups. *P<0.05 as indicated. DR, patients with diabetic retinopathy; D, diabetic patients; HC, healthy control; MEG3, maternally expressed gene 3.

Serum levels of VEGF and TGF-β1 in three groups

VEGF and TGF-β1 play pivotal roles in the development of diabetic retinopathy. Therefore, serum levels of VEGF and TGF-β1 were detected by ELISA and compared among groups. As shown in Fig. 2A, serum levels of VEGF were significantly higher in patients with diabetic retinopathy and diabetic patients without retinopathy than in healthy controls (P<0.05). In addition, serum levels of VEGF were slightly higher in patients with diabetic retinopathy than in diabetic patients, but the difference was not statistically significant. Similarly, serum levels of TGF-β1 were significantly higher in patients with diabetic retinopathy and diabetic patients without retinopathy than in healthy control (P<0.05), but no significant differences in serum levels of TGF-β1 were found between patients with diabetic retinopathy and diabetic patients.

Figure 2.

Serum levels of VEGF and TGF-β1 in three groups. Serum levels of (A) VEGF and (B) TGF-β1 in three groups. *P<0.05 as indicated. DR, patients with diabetic retinopathy; D, diabetic patients; HC, healthy control. TGF-β1, transforming growth factor-β1; VEGF, vascular endothelial growth factor.

Glucose regulates the expression of VEGF, TGF-β1 and MEG3 in the ARPE-19 cell line

In this study, two different concentrations (15 and 30 mM) of d-glucose were used to treat ARPE-19 cells, and 5 mM d-glucose was used as control. Expression of VEGF, TGF-β1 and MEG3 in ARPE-19 cells was detected by qRT-PCR. As shown in Fig. 3, d-glucose treatment significantly increased the serum level of VEGF (Fig. 3A) and TGF-β1 (Fig. 3B) in a dose and time-dependent manner (P<0.05). In contrast, d-glucose treatment significantly decreased the serum level of MEG3 in a dose and time-dependent manner (P<0.05; Fig. 3C).

Figure 3.

Glucose regulates the expression of VEGF, TGF-β1 and MEG3 in the ARPE-19 cell line. Serum levels of (A) VEGF, (B) TGF-β1 and (C) MEG3 in ARPE-19 cells treated with different concentrations of d-glucose at different time points. *P<0.05 as indicated. VEGF, vascular endothelial growth factor; TGF-β1, transforming growth factor-β1; MEG3, maternally expressed gene 3.

MEG3 overexpression reduced the increased VEGF expression in the ARPE-19 cell line induced by glucose

In this study, expression level of VEGF was increased for more than 5-fold after treatment with 30 mM d-glucose for 48 h. Previous studies have shown that MEG3 expression level is negatively correlated with the expression of VEGF, indicating that MEG3 may negatively regulate the expression of VEGF. In this study, MEG3 overexpression ARPE-19 cell line was established (Fig. 4A) and incubated with 30 mM d-glucose for 4 h to explore the effects of MEG3 overexpression on VEGF expression. As shown in Fig. 4, MEG3 overexpression significantly reduced the 30 mM d-glucose-induced increased expression level of VEGF at both mRNA (Fig. 4B) and protein levels (Fig. 4C).

Figure 4.

MEG3 overexpression reduces the increased expression level of VEGF in ARPE-19 cells induced with glucose. (A) MEG3 expression in cells with different treatments. (B) MEG3 overexpression reduced the increased serum level of VEGF mRNA. (C) MEG3 overexpression reduced the increased serum level of VEGF protein. *P<0.05 as indicated. C, control; G, 30 mM d-glucose; NC, negative control; O, MEG3 overexpression. VEGF, vascular endothelial growth factor; MEG3, maternally expressed gene 3.

MEG3 overexpression reduced the increased TGF-β1 expression in the ARPE-19 cell line induced by glucose

It is well known that high glucose can induced the expression of TGF-β1 (13). In this study, expression level of TGF-β1 mRNA was increased for more than 7-fold after treatment with 30 mM D-glucose for 48 h (Fig. 5A), and expression level of TGF-β1 protein was increased for more than 4-fold (Fig. 5B). MEG3 overexpression significantly reduced the increased expression levels of TGF-β1 induced by treatment with 30 mM d-glucose for 48 h at both mRNA and protein levels. TGF-β1 plays pivotal roles in the pathogenesis of diabetic retinopathy. Those data suggest that MEG3 overexpression may improve diabetic retinopathy by inhibiting TGF-β1 expression.

Figure 5.

MEG3 overexpression reduced the increased expression level of TGF-β1 in ARPE-19 cell induced by glucose. (A) MEG3 overexpression reduced the increased serum level of TGF-β1 mRNA. (B) MEG3 overexpression reduced the increased serum level of TGF-β1 protein. *P<0.05 as indicated. C, control; G, 30 mM d-glucose; NC, negative control; TGF-β1, transforming growth factor-β1; MEG3, maternally expressed gene 3.

Discussion

At present, diabetes affects more than 350 million people worldwide, and the incidence of this disease is still increasing (1). Incidence of diabetes in China was used to be low, while with the changes in people's life style and popularization of western dining culture, more and more people are suffering from this disease now (14). As a type of chronic metabolic disease, diabetes also induces the occurrence of many types of complications during its long-term course of disease (2), severely impairing people's quality of life. As one of the most common complications of diabetes, diabetic retinopathy may cause reduced vision, visual symptoms or even blindness by damaging small blood vessels in the retina (3). Oxidative stress and high blood glucose level now are considered to be major causes of diabetic retinopathy (15). Besides that, reduced levels of endostatin, which is an anti-angiogenic protein, have also been proved to contribute to the development of this disease (13). In spite of the progresses that have been made in understanding the mechanism of diabetic retinopathy, pathogenesis of this disease still hasn't been fully elucidated, leading to poor treatment outcomes in some extreme cases.

LnRNAs now are considered to be major plays in the development of various human diseases. A recent study has shown that the development of diabetic retinopathy is accompanied with the changes in genome-wide expression profile of lncRNA (10), and the expression level of lncRNA MALAT1, which play critical roles in vascularization and angiogenic response of endothelial cells, can reflect the severity of this disease (10). In another study, lncRNA ANRIL has been proved to participate in the pathogenesis of diabetic retinopathy by affecting expression of vascularization-related factors (16). LncRNA MEG3 plays a role as tumor suppressor gene in development of different types of cancer (11). In the study of ischemic brain injury, Liu et al reported that reduced expression level of MEG3 is responsible for accelerated angiogenesis (17), which is also a key step for the development of diabetic retinopathy, indicating the possible involvement of MEG3 in this disease. In this study, serum levels of MEG3 were significantly lower in patients with diabetic retinopathy and diabetic patients without retinopathy than in healthy control. In addition, although no significant differences were found, serum levels of MEG3 were slightly lower in patients with diabetic retinopathy than in diabetic patients without retinopathy. Those data suggest that, downregulation of MEG3 may participate in the development of diabetic retinopathy as well as other complications of diabetes.

Vascular endothelial growth factor (VEGF), which is a key player in neovascularization, is closely correlated with the development of diabetic retinopathy (18), and anti-VEGF therapy has been widely used in treatment of diabetic retinopathy (18). TGF-β1 is also a critical component of the pathogenesis of diabetic nephropathy (19). Consistent with previous studies, in this study, expression levels of VEGF and TGF-β1 were significantly increased in ARPE-19 cells after treatment with high glucose. In contrast, expression level of MEG3 was significantly decreased after high glucose treatment. In the study of osteoarthritis, Su et al found that expression level of MEG3 was negatively correlated with expression level of VEGF (20), indicating the potential interactions between them. In another study, Mondal found that MEG3 could also interact with TGF-β1 to achieve its biological functions (21). In this study, MEG3 overexpression significantly reduced the increased expression levels of VEGF and TGF-β1 induced by high glucose treatment. Those results suggest that lncRNA MEG3 overexpression may improve the conditions of diabetic retinopathy by inhibiting the expression of VEGF and TGF-β1. It's worth to note that we also performed electrophoretic mobility shift assay (EMSA) to investigate the interactions of MEG3 with VEGF and TGF-β1. However, no obvious RNA-protein binding was observed, indicating that MEG3 may indirectly regulates expression of VEGF and TGF-β1.

In conclusion, serum levels of MEG3 were significantly reduced, while serum of VEGF and TGF-β1 were significantly increased in patients with diabetic retinopathy and diabetic patients without retinopathy compared with healthy controls. High glucose treatment upregulated the expression of VEGF mRNA and downregulated the expression of MEG3. MEG3 overexpression reduced the increased expression levels VEGF and TGF-β1 induced by high glucose. Our study first reported that lncRNA MEG3 is involved in the pathogenesis of diabetic retinopathy, and it may serve as a promising target for the treatment of this disease. However, this study is still limited by small sample size. In addition, all participants in this study are Asian, and the effects caused by ethnicity cannot be excluded. Therefore, further studies are still needed to confirm the conclusions in this study. Besides that, due to the limited resources, deeper investigations were not performed. We will solve those problems in our future study.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

DZ, YL and JW designed the experiments. DZ, HQ and LY performed the experiments. XL, LZ, DB and YM analyzed the data. YL wrote the manuscript. All authors have read and approved the final submitted manuscript.

Ethics approval and consent to participate

This study was approved by the Ethics Committee of Affiliated Hospital of Beihua University. All patients signed informed consent.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Imamura F, O'Connor L, Ye Z, Mursu J, Hayashino Y, Bhupathiraju SN and Forouhi NG: Consumption of sugar sweetened beverages, artificially sweetened beverages, and fruit juice and incidence of type 2 diabetes: Systematic review, meta-analysis, and estimation of population attributable fraction. BMJ. 351:h35762015. View Article : Google Scholar : PubMed/NCBI

2 

Nathan DM; DCCT/EDIC Research Group, : The diabetes control and complications trial/epidemiology of diabetes interventions and complications study at 30 years: Overview. Diabetes Care. 37:9–16. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Leasher JL, Bourne RRA, Flaxman SR, Jonas JB, Keeffe J, Naidoo K, Pesudovs K, Price H, White RA, Wong TY, et al: Global estimates on the number of people blind or visually impaired by diabetic retinopathy: A meta-analysis from 1990 to 2010. Diabetes Care. 39:1643–1649. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Kertes PJ and Johnson TM: Evidence-based eye care. Lippincott Williams & Wilkins; Philadelphia, PA: 2007

5 

Tapp RJ, Shaw JE, Harper CA, de Courten MP, Balkau B, McCarty DJ, Taylor HR, Welborn TA and Zimmet PZ; AusDiab Study Group, : The prevalence of and factors associated with diabetic retinopathy in the Australian population. Diabetes Care. 26:1731–1737. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Perkel JM: Visiting ‘noncodarnia’. Biotechniques. 54:301, 303–304. 2013. View Article : Google Scholar

7 

Hung T and Chang HY: Long noncoding RNA in genome regulation: prospects and mechanisms. RNA Biol. 7:582–585. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Yang G, Lu X and Yuan L: LncRNA: A link between RNA and cancer. Biochim Biophys Acta. 1839:1097–1109. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Kumarswamy R, Bauters C, Volkmann I, Maury F, Fetisch J, Holzmann A, Lemesle G, de Groote P, Pinet F and Thum T: Circulating long noncoding RNA, LIPCAR, predicts survival in patients with heart failure. Circ Res. 114:1569–1575. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Jaé N and Dimmeler S: Long noncoding RNAs in diabetic retinopathy. Circ Res. 116:1104–1106. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Qin R, Chen Z, Ding Y, Hao J, Hu J and Guo F: Long non-coding RNA MEG3 inhibits the proliferation of cervical carcinoma cells through the induction of cell cycle arrest and apoptosis. Neoplasma. 60:486–492. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Zhou Y, Zhang X and Klibanski A: MEG3 noncoding RNA: A tumor suppressor. J Mol Endocrinol. 48:R45–R53. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Ha H, Yu MR and Lee HB: High glucose-induced PKC activation mediates TGF-beta 1 and fibronectin synthesis by peritoneal mesothelial cells. Kidney Int. 59:463–470. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Guariguata L, Whiting DR, Hambleton I, Beagley J, Linnenkamp U and Shaw JE: Global estimates of diabetes prevalence for 2013 and projections for 2035. Diabetes Res Clin Pract. 103:137–149. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Lopez-Galvez MI, Lavado FM and Pastor JC: Diabetic retinopathy: An overview. Handbook of Nutrition, Diet and the Eye. Academic Press; New York, NY: pp. 41–51. 2014, View Article : Google Scholar

16 

Thomas AA, Feng B and Chakrabarti S: ANRIL: A Regulator of VEGF in Diabetic Retinopathy. Invest Ophthalmol Vis Sci. 58:470–480. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Liu J, Li Q, Zhang KS, Hu B, Niu X, Zhou SM, Li SG, Luo YP, Wang Y and Deng ZF: Downregulation of the long non-coding RNA Meg3 promotes angiogenesis after ischemic brain injury by activating notch signaling. Mol Neurobiol. 54:8179–8190. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Simó R, Sundstrom JM and Antonetti DA: Ocular anti-VEGF therapy for diabetic retinopathy: The role of VEGF in the pathogenesis of diabetic retinopathy. Diabetes Care. 37:893–899. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Goldfarb S and Ziyadeh FN: TGF-beta: A crucial component of the pathogenesis of diabetic nephropathy. Trans Am Clin Climatol Assoc. 112:27–33. 2001.PubMed/NCBI

20 

Su W, Xie W, Shang Q and Su B: The long noncoding RNA MEG3 is downregulated and inversely associated with VEGF levels in osteoarthritis. Biomed Res Int. 2015:3568932015. View Article : Google Scholar : PubMed/NCBI

21 

Mondal T, Subhash S, Vaid R, Enroth S, Uday S, Reinius B, Mitra S, Mohammed A, James AR, Hoberg E, et al: MEG3 long noncoding RNA regulates the TGF-β pathway genes through formation of RNA-DNA triplex structures. Nat Commun. 6:77432015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang D, Qin H, Leng Y, Li X, Zhang L, Bai D, Meng Y and Wang J: LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF‑β1 and VEGF. Exp Ther Med 16: 2337-2342, 2018.
APA
Zhang, D., Qin, H., Leng, Y., Li, X., Zhang, L., Bai, D. ... Wang, J. (2018). LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF‑β1 and VEGF. Experimental and Therapeutic Medicine, 16, 2337-2342. https://doi.org/10.3892/etm.2018.6451
MLA
Zhang, D., Qin, H., Leng, Y., Li, X., Zhang, L., Bai, D., Meng, Y., Wang, J."LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF‑β1 and VEGF". Experimental and Therapeutic Medicine 16.3 (2018): 2337-2342.
Chicago
Zhang, D., Qin, H., Leng, Y., Li, X., Zhang, L., Bai, D., Meng, Y., Wang, J."LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF‑β1 and VEGF". Experimental and Therapeutic Medicine 16, no. 3 (2018): 2337-2342. https://doi.org/10.3892/etm.2018.6451
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang D, Qin H, Leng Y, Li X, Zhang L, Bai D, Meng Y and Wang J: LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF‑β1 and VEGF. Exp Ther Med 16: 2337-2342, 2018.
APA
Zhang, D., Qin, H., Leng, Y., Li, X., Zhang, L., Bai, D. ... Wang, J. (2018). LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF‑β1 and VEGF. Experimental and Therapeutic Medicine, 16, 2337-2342. https://doi.org/10.3892/etm.2018.6451
MLA
Zhang, D., Qin, H., Leng, Y., Li, X., Zhang, L., Bai, D., Meng, Y., Wang, J."LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF‑β1 and VEGF". Experimental and Therapeutic Medicine 16.3 (2018): 2337-2342.
Chicago
Zhang, D., Qin, H., Leng, Y., Li, X., Zhang, L., Bai, D., Meng, Y., Wang, J."LncRNA MEG3 overexpression inhibits the development of diabetic retinopathy by regulating TGF‑β1 and VEGF". Experimental and Therapeutic Medicine 16, no. 3 (2018): 2337-2342. https://doi.org/10.3892/etm.2018.6451
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team