Open Access

Forkhead box P3 gene silencing inhibits the expression of chemokines and chemokine receptors associated with cell growth, migration, and apoptosis in hepatocellular carcinoma cells

  • Authors:
    • Xi Ou
    • Guang‑Tao Zhang
    • Pei‑Kai Tian
    • Jing‑Sen Chen
    • Ze‑Wei Lin
    • Yong Xie
    • Ai‑Hong Wang
    • Xiao‑Ping Liu
    • Ji‑kui Liu
  • View Affiliations

  • Published online on: June 10, 2019     https://doi.org/10.3892/etm.2019.7658
  • Pages: 1091-1098
  • Copyright: © Ou et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The aberrant expression of forkhead box P3 (FOXP3) leads to the formation of malignant tumors. FOXP3 expression levels are also elevated in hepatocellular carcinoma (HCC). The aim of the present study was to investigate the effects of FOXP3 silencing on cell proliferation, migration, apoptosis and chemokine/chemokine receptor expression in the MHCC‑97H HCC cell line. Three FOXP3 short hairpin (sh)RNA constructs were designed: Sh‑FOXP3‑1‑pGreenPuro, sh‑FOXP3‑2‑pGreenPuro, and sh‑FOXP3‑3‑pGreenPuro. MHCC‑97H cells were transfected with shRNA‑FOXP3, and the mRNA and protein expression levels of C‑X‑C motif chemokine (CXC) ligand 12 (CXCL12), CXCL11, CXC receptor 4 (CXCR4) and CXCR7 were measured. Cell Counting Kit‑8, terminal deoxynucleotidyl‑transferase‑mediated dUTP nick end labeling and Transwell assays were used to evaluate cell proliferation, apoptosis and migration, respectively. Of the three FOXP3 lentivirus carriers constructed, sh‑FOXP3‑1 significantly reduced FOXP3 expression levels and was chosen for further experiments. sh‑FOXP3‑1 inhibited cell proliferation, promoted apoptosis and inhibited cell migration compared with the negative control. The mRNA and protein expression levels of CXCL12, CXCL11, CXCR4 and CXCR7 were decreased significantly in response to FOXP3 silencing. FOXP3 silencing may therefore inhibit cell growth, induce apoptosis and inhibit migration in HCC cells, possibly by impairing the chemokine/chemokine receptor axes.

Introduction

Hepatocellular carcinoma (HCC), which often develops as a result of hepatitis and liver cirrhosis, is one of the most common types of cancer worldwide. The majority of patients are diagnosed at an advanced stage, which results in poor survival rates (1). The mortality rate for patients with HCC is second only to that of lung cancer (24).

Forkhead box P3 (FOXP3) is a member of the transcription factor fork head protein family, and it serves a vital role in the generation of regulatory T cells (Tregs), which function largely in immunosuppression (5,6). Aberrant FOXP3 expression leads to autoimmune disease and benign or malignant tumor formation. Previous studies regarding FOXP3 expression and function have been performed primarily in Tregs (7,8). However, FOXP3 expression levels are also elevated in a number of tumor cell types, including HCC (9,10). Additionally, the expression levels and cellular distribution of FOXP3 vary widely within the tumor and its microenvironment (1113). By inhibiting the secretion of certain cytokines, such as transforming growth factor (TGF)-β1, TGF-β2, and interleukin-10, FOXP3 controls the growth of melanoma tumors (14). FOXP3+ Tregs affect the development and progression of hepatocellular carcinoma (15,16). FOXP3 may also act as a tumor suppressor in HCC by regulating the TGF-β/Smad2/3 signaling pathway (17).

Chemokines are a superfamily of small-molecules that bind to G protein-coupled receptors on the cell membrane and promote cell migration through the guanine nucleotide binding protein-mediated signaling cascade (18). Chemokines are grouped into C-X-C motif chemokine (CXC), CX3C, CC and C families based on their amino acid sequences. CXC ligand (CXCL) 12 is a CXC chemotactic factor that was originally identified in bone marrow stroma and termed stromal cell-derived factor-1 (SDF-1) (19). CXC receptor (CXCR) 4 belongs to the G protein-coupled receptor family and selectively binds CXCL12 (18,19). The CXCL12/CXCR4 signaling pathway mediates proliferation, migration and migration in a variety of tumor cells, including lung (20) and gastric cancer (21), oral squamous cell carcinoma (22), and HCC (23,24). CXCR7 was originally cloned from the cDNA library of the dog thyroid, and was considered to be an orphan receptor (25); CXCL12 and CXCL11 were later identified as ligands of CXCR7 (26). Of note, the CXCL12/CXCR7 axis also serves as a therapeutic target in the control of cell survival, cell adhesion and tumor development (27).

In a study of the molecular mechanisms of HCC progression, MHCC-97H cells are frequently used, as they share pathological and genetic characteristics of malignant liver tumors (28). In the present study, MHCC-97H cells were transfected with FOXP3-short hairpin (sh)RNAs to detect changes in cell proliferation, apoptosis and migration. In addition, the effect of FOXP3 silencing on chemokine/chemokine receptor expression was investigated.

Materials and methods

Cell culture

MHCC97-H cells were obtained from the Cell Bank of The Chinese Academy of Sciences and cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS; cat. no. 04-007-1A; Biological Industries) and 100 U/ml penicillin and 100 µg/ml streptomycin (Beijing Solarbio Science & Technology Co., Ltd.) in 5% CO2 at 37°C. Cells were used for experiments at 60% confluence.

shRNA construction

The mRNA sequence of FOXP3 was obtained from the NCBI database (https://www.ncbi.nlm.nih.gov/gene/20371), and three shRNA sequences were designed accordingly (Table I). The sense strands included a BamHI restriction site and the antisense strands included an EcoRI restriction site. Double chains were formed and inserted into pGreenPuro vectors (cat. no. SI505A-1-SBI; System Biosciences). A total of three recombinant vectors were constructed: Sh-FOXP3-1-pGreenPuro, sh-FOXP3-2-pGreenPuro and sh-FOXP3-3. Single colonies were selected from plates harboring MHCC97-H cells with either sh-FOXP3-1-pGreenPuro, sh-FOXP3-2-pGreenPuro or sh-FOXP3-3-pGreenPuro. The vectors were prepared with a Plasmid Minipreparation kit (cat. no. KL060; Shanghai Kang Lang Biological technology Co., Ltd.) and detected using 2% agarose gel electrophoresis with ethidium bromide staining.

Table I.

Sequences of FOXP3 shRNAs.

Table I.

Sequences of FOXP3 shRNAs.

PrimerSequence (5′→3′)
sh-FOXP3-F1 GATCCGCCACATTTCATGCACCAGCTCTCGAGAGCTGGTGCATGAAATGTGGCTTTTTG
sh-FOXP3-R1 AATTCGCCACATTTCATGCACCAGCTCTCGAGAGCTGGTGCATGAAATGTGGCG
sh-FOXP3-F2 GATCCGCACTGACCAAGGCTTCATCTCTCGAGAGATGAAGCCTTGGTCAGTGCTTTTTG
sh-FOXP3-R2 AATTCGCACTGACCAAGGCTTCATCTCTCGAGAGATGAAGCCTTGGTCAGTGCG
sh-FOXP3-F3 GATCCGCATGTTTGCCTTCTTCAGAACTCGAGTTCTGAAGAAGGCAAACATGCTTTTTG
sh-FOXP3-R3 AATTCGCATGTTTGCCTTCTTCAGAACTCGAGTTCTGAAGAAGGCAAACATGCG
sh-NC-F GATCCTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTG
sh-NC-R AATTCAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAAG

[i] FOXP3, forkhead box P3; sh, short hairpin RNA. NC, Scrambled control; F, forward; R, reverse.

The experiments were performed in three groups: A control group, a scrambled negative control (NC) group, and a sh-FOXP3-1-pGreenPuro group. Using the Lipofectamine® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), DNA-liposome complexes were prepared at 4°C to a final volume of 1 µg/µl and added to MHCC97-H cells (1 µg/ml). Transfection was performed for 1 h at room temperature. Further experiments were performed 12, 24, 48 or 72 h post-transfection.

Reverse transcription quantitative-PCR (RT-qPCR)

Total RNA was extracted using an Ultrapure RNA extraction kit (CoWin Biosciences Co., Ltd.), and RNA purity was assessed by measuring optical density (OD) at 280/260 nm. Total RNA (1 µg) was reverse transcribed into cDNA using an Avian Myeloblastosis Virus Reverse-Transcriptase kit (cat. no. KL041; Shanghai Kang Lang Biological technology Co., Ltd.). qPCR was performed in 25 µl sample volumes including, 9.5 µl RNase-Free dH2O, 1 µl cDNA/DNA, 2 µl primers and 12.5 µl UltraSYBR Mixture (cat. no. 00081405; CWBIO Corporation) with the following thermocycling conditions: 35 cycles of denaturation at 94°C for 45 sec, annealing at 59°C for 45 sec and extension at 72°C for 60 sec. The 2−ΔΔcq method was used for quantification (29). The primers used are presented in Table II.

Table II.

Primer sequences used for reverse transcription--quantitative PCR.

Table II.

Primer sequences used for reverse transcription--quantitative PCR.

GeneSequence (5′→3′)
FOXP3F: GTGGCATCATCCGACAAGG
R: AGCGTGGCGTAGGTGAAAG
CXCR4F: TAAAATCTTCCTGCCCACC
R: CGCCAACATAGACCACCTT
CXCR7F: CTCTTCGGCAGCATTTTCT
R: CGTGACGGTCTTCAGGTAGTA
CXCL11F: ATGTTCAAAAGAGGACGCTG
R: GTTACTTGGGTACATTATGGAGG
CXCL12F: ACTCCAAACTGTGCCCTTCA
R: CCACTTTAGCTTCGGGTCAAT
GAPDHF: GAAGGTCGGAGTCAACGGAT
R: CCTGGAAGATGGTGATGGG

[i] FOXP3, forkhead box P3; CXCR, C-X-C motif chemokine receptor; CXCL, C-X-C motif chemokine ligand; F, forward; R, reverse.

Western blotting

Following transfection, MHCC97-H cells (5×103/ml) were collected for western blot analysis. Protein was isolated using a protein isolation kit (ReadyPrep; GE Healthcare Life Sciences) and concentrations were quantified using a bicinchoninic acid assay (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol and 20 µg protein/lane was separated using SDS-PAGE on 10% gel. The proteins were transferred to a nitrocellulose membrane. Non-specific protein binding was blocked with 5% non-fat milk at room temperature for 2 h. The membranes were incubated with anti-GAPDH (1:1,000; cat. no. TA802519; OriGene Technologies, Inc.), anti-CXCR4 (1:500; cat. no. PA1237; Boster Biological Technology), anti-CXCR7 (1:500; cat. no. ab138509; Abcam), anti-CXCL11 (1:500; cat. no. abs139437; Absin Bioscience, Inc.) or anti-CXCL12 (1:500; cat. no. ab155090; Abcam) antibodies at 4°C overnight. The membranes were rinsed with 0.1% PBS + 0.1% Tween-20 and incubated with a horseradish peroxidase-labeled goat anti-rabbit immunoglobulin G (H+L) secondary antibody (1:100; ZB-2301; OriGene Technologies, Inc.) at room temperature for 2 h. The signal was detected using an Enhanced Chemiluminescence Detection kit (Thermo Fisher Scientific, Inc.) and ChemiDoc™ XRS system (Bio-Rad Laboratories, Inc.). Densitometry was performed using Quantity One software (version 1.4.6; Bio-Rad Laboratories, Inc.).

Cell Counting Kit (CCK)-8 assay

Following transfection for 12, 24, 48 and 72 h, 10 µl of media containing CCK-8 (Gibco; Thermo Fisher Scientific, Inc.) were added to each well (3×103/ml). An additional 4 h of incubation at 37°C was performed following each transfection at 12, 24, 48 and 72 h. OD was detected using a microplate reader (Thermo Fisher Scientific, Inc.) at 490 nm, and cell viability was determined based on the OD values.

Terminal deoxynucleotidyl-transferase-mediated dUTP nick end labeling (TUNEL)

MHCC97-H cells were fixed in 4% paraformaldehyde for 30 min at room temperature and incubated with PBS + 0.1% Tween-20 containing 0.3% Triton X-100 for 5 min at room temperature. TUNEL solution was added to each well and the cells were incubated at 37°C for 60 min. Nuclei were stained with DAPI (5 mg/ml) for 3 min at room temperature, following which slides were covered with mounting medium (cat. no. P0126; Beyotime Institute of Biotechnology). Images of the cells were captured using fluorescence microscopy at 5 fields of view.

Transwell assay

Following transfection, 3×103 MHCC97-H cells were seeded in the upper chamber of Transwell plates (Hyclone; GE Healthcare Life Sciences) with serum-free DMEM. The lower chamber contained DMEM with 10% FBS. At 48 h, the cells in the lower chamber were fixed with 4% paraformaldehyde at room temperature for 30 min and stained with 1% crystal violet (Beijing Solarbio Science & Technology Co., Ltd.) for 5 min at room temperature. Images were captured using a light microscope (Magnification, ×200). At least five random fields of view in each image were counted.

Statistical analysis

Data are presented as the mean ± standard deviation with six independent replicates. Statistical analyses were performed using SPSS software (version 17; SPSS, Inc.) and data were analyzed by one-way analysis of variance followed by a Bonferroni post-hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Characterization of FOXP3 shRNAs

Vectors were detected by 2% agarose gel electrophoresis (Fig. 1). The band sizes reflected the predicted sizes of the constructs.

Transfection with either one of the three sh-FOXP3 sequences reduced FOXP3 mRNA and protein expression levels in MHCC97-H cells (Fig. 2). The sh-FOXP3-1 shRNA exhibited the strongest reduction of FOXP3 mRNA and protein expression levels. Therefore, sh-FOXP3-1 was selected for further experiments.

FOXP3 silencing inhibits cell proliferation in MHCC97-H cells

The OD of MHCC-97H cells treated with sh-FOXP3-1 was significantly lower compared with the negative control group following transfection for 12, 24, 48 and 72 h (Fig. 3), which suggested that FOXP3 silencing may inhibit cell proliferation in MHCC97-H cells. The OD values at 72 h were: Control, 0.96; NC, 0.96; sh-FOXP3-1, 0.42 [F(2, 15)=20.5; overall comparison between the 3 groups, P<0.0001].

FOXP3 silencing promotes apoptosis in MHCC97-H cells

The results of the TUNEL assay revealed that the number of apoptotic cells following treatment with sh-FOXP3-1 was significantly higher compared with that in the negative control group (Fig. 4). The percentages of apoptotic cells in each group were: Control, 4.0%; NC, 11.0%; sh-FOXP3-1, 26.6% [F(2, 15)=20.5; P<0.05). These data suggested that FOXP3 silencing may promote apoptosis in MHCC97-H cells.

FOXP3 silencing inhibits the migration of MHCC97-H cells

The rate of migration of cells transfected with sh-FOXP3-1 was significantly lower compared with the negative control group (Fig. 5). The number of invasive cells was: Control, 936; NC, 923; sh-FOXP3-1, 96 [F(2, 15)=473, P<0.05). These data suggest that FOXP3 silencing may inhibit migration in MHCC97-H cells.

FOXP3 silencing reduces the expression of chemokines and their receptors in MHCC97-H cells

The mRNA expression levels of CXCL12, CXCL11, CXCR4 and CXCR7 were reduced in cells transfected with sh-FOXP3-1 compared with the negative control group (P<0.05; Fig. 6). Similarly, the protein levels of CXCL12, CXCL11, CXCR4, and CXCR7 were reduced in cells treated with sh-FOXP3-1 compared with the NC group (P<0.05; Fig. 7).

Discussion

HCC is primarily treated with radiotherapy and liver transplantation; however, the rates of recurrence are ~54% at a median time of 22 months from primary resection (30,31). FOXP3, a nuclear transcription factor linked to the X chromosome that belongs to the forkhead/winged helix transcription factor family, was originally identified by cloning the Scurfin gene. The head domain of FOXP3 binds to DNA-specific loci to regulate the activation and expression of its target genes (5,6). FOXP3 consists of 431 amino acids and its functional structure includes a forkhead DNA binding zone at the C terminal, a C2H2 zinc finger structure at the N terminal, and a leucine zipper sequence (32). In humans, FOXP3 is primarily responsible for the immunosuppressive function of Tregs, and is frequently used as a Treg-specific marker. It serves an important role in regulating the growth and function of CD4+ CD25+ Tregs, as well as maintaining immune tolerance and the stability of the immune responses by inducing the development of CD4+ CD25+ Tregs, controlling the production of CD4+ Tregs and determining Treg inhibitory function (33).

FOXP3 is expressed in various types of tumor cells (34). The expression pattern of FOXP3, including expression levels, subcellular localization and subtypes, in tumor cells is different compared with that in normal cells or Tregs (34). Cunha et al (35) highlighted the complexity of FOXP3 expression in tumor cells, as well as the diverse roles it serves in tumor progression. Wang et al (36) previously characterized 10 HCC cell lines with high expression levels of FOXP3. Niu et al (37) demonstrated that melanoma cells underwent immune escape by expressing FOXP3. Silencing of FOXP3 by FOXP3-siRNA has been demonstrated to mitigate the expression of B7-H1 and TGF-β, whereas FOXP3 overexpression increased the expression of these molecules (38). Co-culturing FOXP3+ melanoma cells with CD4+ CD25 Tregs strongly inhibited the proliferation of T cells, which was partially reversed by the specific silencing of FOXP3 and effectively enhanced by FOXP3 overexpression (39). Therefore, FOXP3 not only serves an important role in Treg function, but may also modulate tumor cell behavior directly.

In the present study, three shRNAs were constructed to silence FOXP3 expression in HCC cells; sh-FOXP3-1 exhibited the strongest silencing effects in an HCC cell line. The results indicated that silencing of FOXP3 expression may inhibit the proliferation of HCC cells. Apoptosis was also promoted in response to sh-FOXP3-1, whereas migration was inhibited. Collectively, these data demonstrate that the silencing of FOXP3 in tumor cells may regulate HCC proliferation, migration and apoptosis.

Compared with CXCL12/CXCR4, the CXCL12/CXCR7 signaling has a more pronounced effect on HCC progression (40). Downregulation of CXCR7 results in the reduction of HCC cell proliferation, as well as the inhibition of lung metastasis (41). Sutton et al (42) demonstrated that CXCL12 stimulates the proliferation, migration and migration of HCC cells, and that the combination of CXCL12 and CXCR4 induces the aggregation and redistribution of cytoskeletal proteins, which enhances the rates of migration and migration. In addition, CXCR7 binds CXCL11 and CXCL12 with high affinity, thus serving important roles in the progression of HCC (43). In the present study, the mRNA and protein levels of CXCL12, CXCL11, CXCR4 and CXCR7 were significantly decreased in MHCC97-H cells treated with sh-FOXP3-1 compared with the control groups. These results suggested that FOXP3 may serve an important role in the growth and metastasis of HCC, potentially through the chemokine/chemokine receptor axis. This may be one of the primary mechanisms underlying the FOXP3 silencing-mediated regulation of tumor growth, inhibition of oncogene transcription and induction of tumor suppressor gene expression.

FOXP3 binds to the transcription sites of the CXCR4 and CXCR7 genes (44); CXCR4 and CXCR7 are associated with tumor migration and metastasis (24). Overbeck-Zubrzycka et al (45) have demonstrated that FOXP3 affects tumor migration and metastasis by modulating the CXCL12/CXCR4 pathway. In the present study, FOXP3 silencing prevented tumor migration potentially through inhibition of CXCR7. Pre-clinical studies have also demonstrated that CXCL12/CXCR4 and CXCL12/CXCR7 inhibitors display potent anti-tumor properties (46), which suggests that chemokines and their receptors represent new potential targets for cancer therapy.

In the present study, FOXP3 silencing inhibited the expression of chemokines and chemokine receptors associated with cell proliferation, migration and apoptosis in an HCC cell line. However, a direct link between tumor progression and the activities of chemokines and chemokine receptors in response to FOXP3 silencing has not been established. Future studies will focus on detecting the downstream molecules of chemokines and their receptors that are regulated by FOXP3.

In conclusion, FOXP3 silencing may inhibit the expression of chemokines and chemokine receptors, including CXCL12/CXCR4, CXCL12/CXCR7 and CXCL11/CXCR7, and may be associated with the inhibition of cell proliferation and migration, as well as the induction of apoptosis. The inhibition of chemokine and chemokine receptor expression may represent an important mechanism underlying the effects of FOXP3 silencing in HCC cells.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Science and Technology Development Fund Project of Shenzhen (grant nos. JCYJ20150403091443302 and JCYJ20160428164539088), the Sanming Project of Medicine in Shenzhen (grant no. SZSM201612021), the Science and Technology Developing Project of Guangdong Province (grant no. 2017B090904010) and Research Foundation of Peking University Shenzhen Hospital (grant no. JCYJ2018002).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

XO, XL and JL conceived and designed the study. XO, GZ, PT, JC, ZL, YX, AW and XL performed the experiments. XO, XL and JL wrote the paper. All authors read and approved the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Singh AK, Kumar R and Pandey AK: Hepatocellular carcinoma: Causes, mechanism of progression and biomarkers. Curr Chem Genom Transl Med. 12:9–26. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Glantzounis GK, Kyrochristos ID, Ziogas DE, Lykoudis EG and Roukos DH: Novel translational therapeutic strategy by sequencing primary liver cancer genomes. Future Oncol. 13:1049–1052. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Yang B, Petrick JL, Kelly SP, Graubard BI, Freedman ND and McGlynn KA: Adiposity across the adult life course and incidence of primary liver cancer: The NIH-AARP cohort. Int J Cancer. 141:271–278. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Lan L, Zhao F, Cai Y, Wu RX and Meng Q: Epidemiological analysis on mortality of cancer in China, 2015. Zhonghua Liu Xing Bing Xue Za Zhi. 39:32–34. 2018.(In Chinese). PubMed/NCBI

5 

Sakaguchi S, Yamaguchi T, Nomura T and Ono M: Regulatory T cells and immune tolerance. Cell. 133:775–787. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Bennett CL, Christie J, Ramsdell F, Brunkow ME, Ferguson PJ, Whitesell L, Kelly TE, Saulsbury FT, Chance PF and Ochs HD: The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat Genet. 27:20–21. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Malik S and Awasthi A: Transcriptional control of Th9 cells: Role of foxo1 in interleukin-9 induction. Front Immunol. 9:9952018. View Article : Google Scholar : PubMed/NCBI

8 

Wada M, Tsuchikawa T, Kyogoku N, Abiko T, Miyauchi K, Takeuchi S, Kuwatani T, Shichinohe T, Miyahara Y, Kageyama S, et al: Clinical implications of CD4+CD25+Foxp3+Regulatory T cell frequencies after CHP--MAGE-A4 cancer vaccination. Anticancer Res. 38:1435–1444. 2018.PubMed/NCBI

9 

Lin SZ, Chen KJ, Xu ZY, Chen H, Zhou L, Xie HY and Zheng SS: Prediction of recurrence and survival in hepatocellular carcinoma based on two cox models mainly determined by FoxP3+ regulatory T cells. Cancer Prev Res (Phila). 6:594–602. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Triulzi T, Tagliabue E, Balsari A and Casalini P: FOXP3 expression in tumor cells and implications for cancer progression. J Cell Physiol. 228:30–35. 2013. View Article : Google Scholar : PubMed/NCBI

11 

McInnes N, Sadlon TJ, Brown CY, Pederson S, Beyer M, Schultze JL, McColl S, Goodall GJ and Barry SC: FOXP3 and FOXP3-regulated microRNAs suppress SATB1 in breast cancer cells. Oncogene. 31:1045–1054. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Merlo A, Casalini P, Carcangiu ML, Malventano C, Triulzi T, Mènard S, Tagliabue E and Balsari A: FOXP3 expression and overall survival in breast cancer. J Clin Oncol. 27:1746–1752. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Ebert LM, Tan BS, Browning J, Svobodova S, Russell SE, Kirkpatrick N, Gedye C, Moss D, Ng SP, MacGregor D, et al: The regulatory T cell-associated transcription factor FoxP3 is expressed by tumor cells. Cancer Res. 68:3001–3009. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Chen DJ, Li XS, Zhao H, Shi XL, Zhang HH, Fan ZY, Yao YM and DU N: Inhibitory effect of lentiviral-mediated RNA on the expression of Foxp3 protein in melanoma cells. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 28:337–339. 2012.(In Chinese). PubMed/NCBI

15 

Kobayashi N, Hiraoka N, Yamagami W, Ojima H, Kanai Y, Kosuge T, Nakajima A and Hirohashi S: FOXP3+ regulatory T cells affect the development and progression of hepatocarcinogenesis. Clin Cancer Res. 13:902–911. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Wang WH, Jiang CL, Yan W, Zhang YH, Yang JT, Zhang C, Yan B, Zhang W, Han W, Wang JZ and Zhang YQ: FOXP3 expression and clinical characteristics of hepatocellular carcinoma. World J Gastroenterol. 16:5502–5509. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Shi JY, Ma LJ, Zhang JW, Duan M, Ding ZB, Yang LX, Cao Y, Zhou J, Fan J, Zhang X, et al: FOXP3 Is a HCC suppressor gene and Acts through regulating the TGF-β/Smad2/3 signaling pathway. BMC Cancer. 17:6482017. View Article : Google Scholar : PubMed/NCBI

18 

Nagasawa T: CXC chemokine ligand 12 (CXCL12) and its receptor CXCR4. J Mol Med. 92:433–439. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Liu X, Dai LI and Zhou R: Association between preeclampsia and the CXC chemokine family (Review). Exp Ther Med. 9:1572–1576. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Zhou XM, He L, Hou G, Jiang B, Wang YH and Zhao L: Clinicopathological significance of CXCR4 in non-small cell lung cancer. Drug Des Devel Ther. 9:1349–1358. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Izumi D, Ishimoto T, Miyake K, Sugihara H, Eto K, Sawayama H, Yasuda T, Kiyozumi Y, Kaida T, Kurashige J, et al: CXCL12/CXCR4 activation by cancer-associated fibroblasts promotes integrin β1 clustering and invasiveness in gastric cancer. Int J Cancer. 138:1207–1219. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Rave-Frank M, Tehrany N, Kitz J, Leu M, Weber HE, Burfeind P, Schliephake H, Canis M, Beissbarth T, Reichardt HM and Wolff HA: Prognostic value of CXCL12 and CXCR4 in inoperable head and neck squamous cell carcinoma. Strahlenther Onkol. 192:47–54. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Fontanella R, Pelagalli A, Nardelli A, D'Alterio C, Ieranò C, Cerchia L, Lucarelli E, Scala S and Zannetti A: A novel antagonist of CXCR4 prevents bone marrow-derived mesenchymal stem cell-mediated osteosarcoma and hepatocellular carcinoma cell migration and invasion. Cancer Lett. 370:100–107. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Shi JY, Yang LX, Wang ZC, Wang LY, Zhou J, Wang XY, Shi GM, Ding ZB, Ke AW, Dai Z, et al: CC chemokine receptor-like 1 functions as a tumour suppressor by impairing CCR7-related chemotaxis in hepatocellular carcinoma. J Pathol. 235:546–558. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Hao M, Zheng J, Hou K and Wang J, Chen X, Lu X, Bo J, Xu C, Shen K and Wang J: Role of chemokine receptor CXCR7 in bladder cancer progression. Biochem Pharmacol. 84:204–214. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Benredjem B, Girard M, Rhainds D, St-Onge G and Heveker N: Mutational analysis of atypical chemokine receptor 3 (ACKR3/CXCR7) interaction with its chemokine ligands CXCL11 and CXCL12. J Biol Chem. 292:31–42. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Burns JM, Summers BC, Wang Y, Melikian A, Berahovich R, Miao Z, Penfold ME, Sunshine MJ, Littman DR, Kuo CJ, et al: A novel chemokine receptor for SDF-1 and I-TAC involved in cell survival, cell adhesion, and tumor development. J Exp Med. 203:2201–2213. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Li Y, Lu Z, Liang Z, Ji D, Zhang P, Liu Q, Zheng X and Yao Y: Metastasis-associated in colon cancer-1 is associated with poor prognosis in hepatocellular carcinoma, partly by promoting proliferation through enhanced glucose metabolism. Mol Med Rep. 12:426–434. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Wiedmann MW and Mossner J: Molecular targeted therapy of hepatocellular carcinoma-results of the first clinical studies. Curr Cancer Drug Targets. 11:714–733. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Tabrizian P, Jibara G, Shrager B, Schwartz M and Roayaie S: Recurrence of hepatocellular cancer after resection: Patterns, treatments, and prognosis. Ann Surg. 261:947–955. 2015. View Article : Google Scholar : PubMed/NCBI

32 

Lopes JE, Torgerson TR, Schubert LA, Anover SD, Ocheltree EL, Ochs HD and Ziegler SF: Analysis of FOXP3 reveals multiple domains required for its function as a transcriptional repressor. J Immunol. 177:3133–3142. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Rudensky AY: Regulatory T cells and Foxp3. Immunol Rev. 241:260–268. 2011. View Article : Google Scholar : PubMed/NCBI

34 

Grimmig T, Kim M, Germer CT, Gasser M and Waaga-Gasser AM: The role of FOXP3 in disease progression in colorectal cancer patients. Oncoimmunology. 2:e245212013. View Article : Google Scholar : PubMed/NCBI

35 

Cunha LL, Morari EC, Nonogaki S, Soares FA, Vassallo J and Ward LS: Foxp3 expression is associated with aggressiveness in differentiated thyroid carcinomas. Clinics. 67:483–488. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Wang L, Mei M, Sun X, et al: Expression and significance of Foxp3 in hepatocellular carcinoma. Shandong Med J. 48:8–11. 2010.(In Chinese).

37 

Niu J, Jiang C, Li C, Liu L, Li K, Jian Z and Gao T: Foxp3 expression in melanoma cells as a possible mechanism of resistance to immune destruction. Cancer Immunol Immunother. 60:1109–1118. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Geng Y, Wang H, Lu C, Li Q, Xu B, Jiang J and Wu C: Expression of costimulatory molecules B7-H1, B7-H4 and Foxp3+ Tregs in gastric cancer and its clinical significance. Int J Clin Oncol. 20:273–281. 2015. View Article : Google Scholar : PubMed/NCBI

39 

Fu S, Zhang N, Yopp AC, Chen D, Mao M, Chen D, Zhang H, Ding Y and Bromberg JS: TGF-beta induces Foxp3 + T-regulatory cells from CD4+CD25-precursors. Am J Transplant. 4:1614–1627. 2004. View Article : Google Scholar : PubMed/NCBI

40 

Zheng K, Li HY, Su XL, Wang XY, Tian T, Li F and Ren GS: Chemokine receptor CXCR7 regulates the invasion, angiogenesis and tumor growth of human hepatocellular carcinoma cells. J Exp Clin Cancer Res. 29:312010. View Article : Google Scholar : PubMed/NCBI

41 

Xue TC, Chen RX, Han D, Chen J, Xue Q, Gao DM, Sun RX, Tang ZY and Ye SL: Down-regulation of CXCR7 inhibits the growth and lung metastasis of human hepatocellular carcinoma cells with highly metastatic potential. Exp Ther Med. 3:117–123. 2012. View Article : Google Scholar : PubMed/NCBI

42 

Sutton A, Friand V, Brulé-Donneger S, Chaigneau T, Ziol M, Sainte-Catherine O, Poiré A, Saffar L, Kraemer M, Vassy J, et al: Stromal cell-derived factor-1/chemokine (C-X-C motif) ligand 12 stimulates human hepatoma cell growth, migration, and invasion. Mol Cancer Res. 5:21–33. 2007. View Article : Google Scholar : PubMed/NCBI

43 

Monnier J, Boissan M, L'Helgoualc'h A, Lacombe ML, Turlin B, Zucman-Rossi J, Théret N, Piquet-Pellorce C and Samson M: CXCR7 is up-regulated in human and murine hepatocellular carcinoma and is specifically expressed by endothelial cells. Eur J Cancer. 48:138–148. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Zheng Y and Rudensky AY: Foxp3 in control of the regulatory T cell lineage. Nat Immunol. 8:457–462. 2007. View Article : Google Scholar : PubMed/NCBI

45 

Overbeck-Zubrzycka D, Ali S, Kirby J and Lennard T: FOXP3 transcription factor regulates metastatic spread of breast cancer via control of expression of CXCR4 chemokine receptor. Br J Surg. 98:842011.PubMed/NCBI

46 

Duda DG, Kozin SV, Kirkpatrick ND, Xu L, Fukumura D and Jain RK: CXCL12 (SDF1alpha)-CXCR4/CXCR7 pathway inhibition: An emerging sensitizer for anticancer therapies? Clin Cancer Res. 17:2074–2080. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

August-2019
Volume 18 Issue 2

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Ou X, Zhang GT, Tian PK, Chen JS, Lin ZW, Xie Y, Wang AH, Liu XP and Liu Jk: Forkhead box P3 gene silencing inhibits the expression of chemokines and chemokine receptors associated with cell growth, migration, and apoptosis in hepatocellular carcinoma cells. Exp Ther Med 18: 1091-1098, 2019.
APA
Ou, X., Zhang, G., Tian, P., Chen, J., Lin, Z., Xie, Y. ... Liu, J. (2019). Forkhead box P3 gene silencing inhibits the expression of chemokines and chemokine receptors associated with cell growth, migration, and apoptosis in hepatocellular carcinoma cells. Experimental and Therapeutic Medicine, 18, 1091-1098. https://doi.org/10.3892/etm.2019.7658
MLA
Ou, X., Zhang, G., Tian, P., Chen, J., Lin, Z., Xie, Y., Wang, A., Liu, X., Liu, J."Forkhead box P3 gene silencing inhibits the expression of chemokines and chemokine receptors associated with cell growth, migration, and apoptosis in hepatocellular carcinoma cells". Experimental and Therapeutic Medicine 18.2 (2019): 1091-1098.
Chicago
Ou, X., Zhang, G., Tian, P., Chen, J., Lin, Z., Xie, Y., Wang, A., Liu, X., Liu, J."Forkhead box P3 gene silencing inhibits the expression of chemokines and chemokine receptors associated with cell growth, migration, and apoptosis in hepatocellular carcinoma cells". Experimental and Therapeutic Medicine 18, no. 2 (2019): 1091-1098. https://doi.org/10.3892/etm.2019.7658