This article is mentioned in:

Introduction

Pamidronate (Pami) is a type of bisphosphonate (BP) agent, which is a pyrophosphate analogue, and successfully used in the management of several bone diseases, including Paget's disease, osteoporosis and hypercalcemia-associated cancer cell damage. Additionally, BPs decrease bone pain or fractures in the elderly or patients with cancer with cancer cells migrating to the bone (1). In vitro studies show that BPs, including clodronate, alendronate, zoledronate and Pami (2–5), have an effect on cancer cells by suppressing the proliferation and induction of apoptosis. Interestingly, BPs inhibit bone metastasis and prolong the survival rate in patients with cancer. A study on patients with estrogen receptor (ER)-positive breast cancer indicated that zoledronic acid in combination with a hormone antagonist improves disease-free survival (6). Various studies suggest that BPs could be an anticancer agent for patients with prostate cancer (7,8). Furthermore, BPs have beneficial effects on patients with prostate cancer who have cancer cells that migrate to the bones. Moreover, Pami inhibits PC-3 prostate cancer cells with high expression levels of Bcl-2 and anti-apoptotic protein (2). BPs have been demonstrated to have a high efficacy in cancer treatment in both in vitro and in vivo studies, and the deep effects of Pami on other cancer cells, including cholangiocarcinoma (CCA) cells, have been revealed.

The proposed mechanisms of BPs on cancer cells are indicated in several pathways and are important mechanisms in the inhibition of cell growth and migration (9–11). Furthermore, BPs decrease the gene-related cancer cell functions or replication (12,13). Interestingly, one action of BPs is elucidated by the reduction of enzymes in the mevalonate (MVA) pathway, which reduces MVA products, such as farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP) (14,15) by suppressing the farnesyl pyrophosphate synthase (FPPS) enzyme. FPP and GGPP are crucial for producing intracellular proteins, including Rho, Ras, Rap and Rac, which are involved in the signaling pathways of normal and cancer functions (16). For tumor cells, MVA products can control cell differentiation, growth, migration, invasion and angiogenesis. Iguchi et al (2) have demonstrated that Pami inhibits prostate cancer cell proliferation through decreasing the MVA pathway and blocking Rap1, which is accompanied by the suppression of Bcl-2 expression. This is consistent with the results of Zhang et al (17), who demonstrated that Pami showed less activity against cancer cells, with low levels of MVA products, such as N-Ras or H-Ras. Therefore, the inhibition of the MVA pathway may be useful for inhibiting cancer cell growth and migration.

CCA, or bile duct cancer, is an aggressive cancer and a significant public health problem in Southeast Asian Countries, particularly in the North-Eastern part of Thailand. Infection by Opisthorchis viverrini (OV) is the main risk factor of CCA (17). OV infection can induce long-term chronic inflammation. The accumulation of numerous inflammatory cytokines and growth factors can lead to uncontrollable cancer cell growth and metastasis (18). CCA is frequently identified at an aggressive stage (stages III or IV) that is unsuitable for surgical treatment. Furthermore, standard chemotherapeutic drugs display low efficacy, high toxicity and high drug resistance (19). Therefore, novel anticancer agents, such as BPs, with high efficiency for CCA and low toxicity are urgently required.

In the present study, KKU-100 cells were used to examine the effects of Pami on CCA cell death, migration and the MVA pathway. To measure the cell death by sulforhodamine B (SRB), colony formation and apoptosis, reactive oxygen species (ROS) production, caspase-3 activity and flow cytometry assays were used. To test the effects of Pami on MVA products, RT-qPCR and western blotting were used. Finally, to assess the migration effects, wound healing, Matrigel and gelatin zymography assays were used.

Materials and methods

Cell cultures and cell death

Human CCA KKU-100 cells were provided by the Faculty of Medicine, Khon Kaen University. The cells were cultured in DMEM supplemented with penicillin (100 U/ml), streptomycin (100 mg/ml) and 10% FBS. Cell death was examined by SRB assays as previously described (20). Cells were exposed to various concentrations of 0–1,000 µM Pami or 0.25% dimethyl sulfoxide (DMSO) for 24 to 48 h and then fixed with 10% trichloroacetic acid (TCA), stained with 0.4% SRB and washed and solubilized in 10 mM Tris base buffer. The optical density was measured at 540 nm and compared with the control groups.

Colony formation

KKU-100 cell colony formation was examined using a colony formation assay as previously described (20). Briefly, KKU-100 cells were exposed to various concentration of 0–100 µM Pami or 0.25% DMSO for 24 h. The DMEM medium was refreshed and cells were allowed to grow for 15 days. Next, the cells were washed with PBS buffer, fixed with absolute methanol, stained with 0.5% crystal violet, washed and dried. The colonies were counted and compared with the control groups.

ROS generation

ROS production was assessed using a DHE-fluorescent probe, as previously described (20). KKU-100 cells were exposed to various concentrations of 0–250 µM Pami or 0.25% DMSO with 25 µM DHE-fluorescent probes in the dark for 90 min. The fluorescent intensity for the excitation wavelength was read at 518 nm and for the emission wavelength at 605 nm. The intensity was calculated and compared with the untreated groups.

Caspase-3 activity

Caspase-3 activity was examined with a caspase-3 assay kit, as previously described (20). Briefly, KKU-100 cells were exposed to various concentrations of 0–250 µM Pami or 0.25% DMSO for 24 h and then caspase-3 activity was determined. The caspase-3 activity was calculated from the fluorescent intensity and compared with the untreated groups.

Apoptosis

Apoptosis was tested by flow cytometry, as previously described with some modifications (21). Briefly, KKU-100 cells were exposed to various concentration of 0–250 µM Pami or 0.25% DMSO for 24 h, stained with 5 µl propidium iodide (PI) and 5 µl Annexin V FITC and then incubated for 15 min in the dark. Apoptosis was measured by flow cytometry and compared with the control groups.

Wound healing

Migration was investigated using a wound healing assay, as previously described (20). KKU-100 cells were scratched with 0.2 ml tips and incubated with various concentrations of 0–50 µM Pami or 0.25% DMSO for 48 h. Then, the cancer cells were fixed and stained with 0.5% crystal violet. The wound distance was calculated and compared with the control groups.

Matrigel migration

Migration was tested with a Matrigel migration assay, as previously described (22). KKU-100 cells were exposed to various concentrations of 0–100 µM Pami or 0.25% DMSO for 24 h and, the next day, the inserted well was removed, washed and stained with 0.5% crystal violet. The migration of the cells was compared with the control groups.

Gelatin zymography

Migration was assessed by a gelatin zymography assay, as previously described (23). KKU-100 cells were exposed to various concentrations of 0–50 µM Pami or 0.25% DMSO for 24 h, the medium was collected and the protein concentration was measured. The protein was loaded onto 10% SDS-PAGE gels with 0.01% gelatin (w/v). The gels were incubated with developing buffer overnight and stained with 0.5% Coomassie brilliant blue R-250 until a clear band was observed. The band density was calculated and compared with that of the control groups.

Reverse transcription-quantitative (RT-q)PCR

Gene expression levels were assessed by RT-qPCR, as previously described (23,24). Briefly, KKU-100 cells were exposed to 250 µM Pami or 0.25% DMSO for 24 h. Afterwards, cellular RNA was extracted and transcribed intro complementary DNA using the iScript™ cDNA Synthesis kit (cat. no. 1708898; Bio-Rad Laboratories, Inc.) at 42°C for 60 min. Rac1 and RhoA gene expression were examined by RT-qPCR and primers for the target genes are shown in Table I. A final reaction volume of 20 µl was prepared containing SsoFast™ EvaGreen Supermix with low Rox (Bio-Rad Laboratories, Inc.), and primers for the target gene and the internal control β-actin. The PCR conditions were as follows: Denaturation at 95°C for 3 min and amplification by cycling 40 times at 95°C for 15 sec and 60°C for 30 sec. Expression was detected using a CFX96 Touch™ real-time PCR Detection system (Bio-Rad Laboratories, Inc.). Differences in gene expression levels were calculated using the 2−ΔΔCq method (24) for relative quantification and expressed as the fold change relative to the untreated control. Assays assessing target gene expression were performed in triplicate.

Table I. Primer sequences for Rac1, RhoA and β-actin.

Table I.

Primer sequences for Rac1, RhoA and β-actin.

Gene	Primer sequences (5′-3′)
Rac1	Forward: ATGTCCGTGCAAAGTGGTATC
	Reverse: CTCGGATCGCTTCGTCAAACA
RhoA	Forward: GGAAAGCAGGTAGAGTTGGCT
	Reverse: GGCTGTCGATGGAAAAACACAT
β-actin	Forward: GTGACGTTGACATCCGTAAAGA
	Reverse: GCCGGACTCATCGTACTCC

Western blotting

Protein expression levels were assessed by western blotting, as previously described (23). Briefly, KKU-100 cells were exposed to 250 µM Pami or 0.25% DMSO for 24 h, the cell pellet was collected, the cells were lysed and the protein concentration was measured. The protein was loaded onto a 12% SDS-PAGE gel, which was blocked and incubated with primary antibodies against Rac1 (1:1,000 dilution), RhoA (1:1,000 dilution) and beta-actin (1:2,500 dilution). Membranes were exposed to the secondary antibody (1:2,500 dilution) the following day. The ECL substrate was used to detect the band intensity and this was compared with the control groups.

Statistical analysis

Data from three independent experiments were statistically compared using Student's t-test and one-way ANOVA followed by Tukey's post hoc test. The significance was set at 0.05 compared with the control by using SigmaStat software version 3.5 (Systat Software Inc.), and the IC50 values calculations and statistical analyses were performed using Prism 5 software (GraphPad Software, Inc.).

Results

Pami induces cell death and inhibits colony formation

The results from the SRB assay indicated that Pami suppressed CCA cells at 24 and 48 h (Fig. 1A and B). Notably, at doses between 100 and 1,000 µM Pami exhibited significant effects compared with the control groups. Compared with the incubation time point, a significant difference was identified in IC50 values of 444.67±44.05 µM for 24 h and IC50 values of 147.33±17.01 µM for 48 h for Pami effects. Accordingly, for growth inhibition, colony formation was repressed in a concentration-dependent manner with the lower concentration at IC50 values of 5.36±0.31 µM when compared with the growth inhibition (Fig. 1C and D).

Figure 1. Effect of Pami on CCA cell growth. KKU-100 cells were incubated with Pami and cytotoxicity was assessed for (A) 24 and (B) 48 h. Sulforhodamine B and colony formation assays were also performed and presented as (C) representative images and (D) a bar graph. Data are presented as the mean ± standard error. *P<0.05 vs. 0 µM; ӾP<0.05 vs. 5 µM; ᶲP<0.05 vs. 10 µM; #P<0.05 vs. 25 µM; †P<0.05 vs. 50 µM; ‡P<0.05 vs. 100 µM. CCA, cholangiocarcinoma; Pami, pamidronate.

Pami induces cell apoptosis

The data indicated that Pami stimulated intracellular ROS generation after incubation for 90 min (Fig. 2A) when compared with control group. Correlating with the caspase-3 activity, Pami induced caspase-3 activity in a dose-dependent way at 24 h and showed significant levels between the control groups at 100–250 µM (Fig. 2B). Testing cancer cell apoptosis by flow cytometry, Pami caused significant induction of CCA apoptosis and necrosis (Fig. 2C and D).

Figure 2. Effect of Pami on ROS production, caspase-3 levels and apoptosis. KKU-100 cells were incubated with Pami and evaluated for ROS production, caspase-3 levels and apoptosis with a (A) DHE-fluorescent probe, (B) caspase-3 assay kit and flow cytometry for (C) control and (D) treatment groups. Data are presented as the mean ± standard error. *P<0.05 vs. 0 µM; #P<0.05 vs. 50 µM. Pami, pamidronate; ROS, reactive oxygen species.

Pami decreases MVA product expression levels

When exploring the Rac1 and RhoA gene expression with RT-qPCR, after CCA cells were exposed to Pami, the Pami effects modulated the Rac1 gene expression more than the RhoA gene expression, and the Rac1 gene expression was induced following incubation with Pami for 24 h, whereas RhoA gene expression was not altered (Fig. 3A and B). When determining the protein expression by western blotting, the Rac1 protein levels were decreased at 24 h incubation, but RhoA protein levels were increased (Fig. 3C-E).

Figure 3. Effect of Pami on Rac1 and RhoA gene and protein expression. Following incubation with 250 µM Pami, reverse transcription-quantitative PCR was performed to detect the gene and protein expression of (A) Rac1 and (B) RhoA in KKU-100 cells. (C) Western blotting was performed and the expression of (D) Rac1 and (E) RhoA was semi-quantified. Data are presented as the mean ± standard error. *P<0.05 vs. control. Pami, pamidronate.

Pami reduces migration

The results showed that Pami blocked wound healing effects after cells were scratched with a 0.2 ml pipette tip (Fig. 4A and B) and then lead to the inhibition of CCA cell migration (Fig. 4C and D) to the bottom of the Transwell chamber. Next, to explore the mechanism associated with the blocking of the CCA migration, a gelatin zymography assay was used. The results showed that Pami strongly decreased both MMP2 and MMP9 expression levels, which were secreted in the culture media, especially the MMP9 levels (Fig. 4E-G).

Figure 4. Effect of Pami on CCA cell migration. Following incubation with Pami, a wound healing assay was performed using KKU-100 cells. (A) Distance of wound healing, (B) relative closure of the scratch, (C) cell migration to the bottom chamber and (D) migrated cells are presented. (E) Gel zymography and the expression of (F) MMP9 and (G) MMP2 were also assessed. Data are presented as mean the ± standard error. *P<0.05 vs. control; #P<0.05 vs. 10 µM; †P<0.05 vs. 25 µM; ‡P<0.05 vs. 50 µM. CCA, cholangiocarcinoma; Pami, pamidronate.

Discussion

The present study demonstrated that BPs can directly suppress cancer cell growth, induce apoptosis and inhibit cell migration, which was associated with the MVA pathway in CCA cell lines. The MVA pathway serves a crucial role in the cancer process and the biology that controls the intracellular pathway in tumors, such as cell proliferation, growth, invasion and migration, as well as resistance to chemotherapeutic agents. Therefore, the MVA pathway is of interest if it can be inhibited or reduced by drugs or natural products. The present study reported that Pami inhibited CCA cell growth in SRB and colony formation assays, which was accompanied by induction of CCA cell apoptosis as examined by ROS generation, caspase-3 activity and apoptosis by flow cytometry. Furthermore, Pami was revealed to modulate the MVA pathway and suppress Rac1 protein expression levels 24 h after incubation. Finally, Pami also decreased the CCA cell migration by inhibiting wound healing and the invasion in the Matrigel assay, as well as reducing MMP2 and MMP9 levels. The data demonstrated that Pami acted against CCA cells with effects on growth inhibition, apoptotic induction and migratory suppression. Pami may be useful against CCA cells.

Pami suppressed the MVA pathway and downregulated the downstream protein targets of MVA products, including Rac and Rho, which control cell growth, proliferation and migration (17). According to the results of the present study, Pami modulated Rac1 and RhoA gene and protein expression levels. Especially, Pami suppressed Rac1 protein expression, which may have upregulated Rac1 gene expression at 24 h. Rac1 and RhoA are Rho GTPase family members that regulate actin dynamics and cell proliferation (24). Rac1 regulates multiple signaling pathways that control cytoskeleton organization, transcription and cell growth (25). Direct inhibition of Rac1 activity induces cell cycle arrest and apoptosis in human breast cancer cells (26), as well as CCA (27). Miller et al (27) found that simvastatin is a HMG-CoA reductase enzyme inhibitor that is important for inhibition of the MVA pathway, it decreases Rac1 activity in CCA cells (Mz-ChA-1 cells) and causes induction of CCA cell death by increasing levels of cleaved caspase-3 and reducing p-ERK levels (28). Similar to these results, Pami suppressed Rac1 protein expression and further induced CCA cell death and apoptosis by activating ROS formation and inducing caspase-3 activity. However, our previous study showed that Pami suppresses Rac1 and RhoA gene expression in MCF-7 breast cancer cells following incubation for 24 h (data not shown). Therefore, the bisphosphonate on the MVA products both in gene and protein expression are required to explore the time and concentration for each cancer cell type in further experiments. Data indicated that the inhibition of the MVA pathway was associated with CCA cell death and apoptosis. Further experiments are required to explore the dose and incubation time associated with Rac1 and RhoA levels.

Regarding CCA cell apoptosis, at a dose of 250 µM, Pami caused a significant induction of apoptosis through ROS formation and caspase-3 activity. The data revealed that Pami in the dose range 50–250 µM induced ROS formation and also significantly stimulated caspase-3 activity at doses of 100–250 µM. In the present study, only 250 µM Pami was used to study apoptosis by flow cytometry as it showed higher effects in terms of activating CCA cell apoptosis. Riebeling et al (29) reported that 100 µM Pami stimulates melanoma cell apoptosis through caspase-3 overexpression and DNA fragmentation. Additionally, low doses of Pami (1–20 µM) reduce MVA products, including Ras, RhoA and ROCK-1, and are associated with the induction of cleaved caspase-3 and −9, and the reduction of antiapoptotic protein Bcl-2 (30). Pami exhibited high efficacy in accelerating CCA cell apoptosis.

Regarding CCA cell metastasis, it was revealed that Pami inhibited CCA cell migration in a dose-dependent manner by reducing MMP2 and MMP expression levels. Metastasis is the important step where tumor cells migrate from the original site to a distant site and contribute to secondary tumors. Lai et al (31) demonstrated that alendronate may decrease MMP2 gene and protein expression and further correlated with inhibiting the invasion of chondrosarcoma cells. Furthermore, four types of BPs, such as zoledronate, clodronate, Pami and alendronate, at non-cytotoxic doses suppressed MMP1, −2, −3, −8, −9, −12, −13 and −20 (32) as in these migration results. Interestingly, 10 µM Pami decreased the invasion, migration and RhoA gene and protein expression in breast cancer cells by downregulating the Serpin-A1 gene (33). Similarly, Wada et al (30) indicated that Pami can suppress membrane RhoA and lead to inhibited hepatocellular carcinoma (HCC) motility. Moreover, Pami potentiated the effects of statins on the reduction of tumor cell adhesion to collagen IV and fibronectin and suppression of the migration and invasiveness of tumor cells (34). BPs can be applied for antiinvasive and anti-metastatic activities, which may inhibit cancer metastasis including CCA.

The current in vitro study presents a first report of Pami efficacy on CCA cells by inhibiting growth, inducing apoptosis and suppressing migration. Further in vivo studies are essential to examine these effects and establish the safety and efficacy of the Pami studied in this model before treating patients with CCA.

Acknowledgements

Not applicable.

Funding

The present study was financially supported by the Thailand Research Fund (grant no. MRG6080071).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

BB, LS and AP performed the experiments and analyzed the data. BB and VK guided the experiments, designed the study and wrote the manuscript. All authors gave final approval of the version to be published. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References