Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2020 Volume 20 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2020 Volume 20 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Expression profiles of long non‑coding RNAs during fetal lung development

  • Authors:
    • Jin-Xin Shen
    • Zhi-Dan Bao
    • Wen Zhu
    • Cheng-Ling Ma
    • Yan-Qing Shen
    • Qing Kan
    • Xiao-Guang Zhou
    • Yang Yang
    • Xiao-Yu Zhou
  • View Affiliations / Copyright

    Affiliations: Department of Neonatology, Children's Hospital of Nanjing Medical University, Nanjing, Jiangsu 210008, P.R. China, Department of Neonatology, The Affiliated Jiangyin Hospital of Southeast University Medical School, Jiangyin, Jiangsu 214400, P.R. China
  • Article Number: 144
    |
    Published online on: October 5, 2020
       https://doi.org/10.3892/etm.2020.9273
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

With advances in neonatology, a greater percentage of premature infants now survive and consequently, diseases of lung development, including bronchopulmonary dysplasia and neonatal respiratory distress syndrome, have become more common. However, few studies have addressed the association between fetal lung development and long non‑coding RNA (lncRNA). In the present study, right lung tissue samples of fetuses at different gestational ages were collected within 2 h of the induction of labor in order to observe morphological discrepancies. An Affymetrix Human GeneChip was used to identify differentially expressed lncRNAs. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses were performed. A total of 687 lncRNAs were identified to be differentially expressed among three groups of fetal lung tissue samples corresponding to the three embryonic periods. A total of 34 significantly upregulated and 12 significantly downregulated lncRNAs (fold-change, ≥1.5; P<0.05) were detected at different time points (embryonic weeks 7‑16, 16‑25 and 25‑28) of fetal lung development and compared with healthy tissues Expression changes in lncRNAs n340848, n387037, n336823 and ENST00000445168 were validated by reverse transcription‑quantitative PCR and the results were consistent with the GeneChip results. These novel identified lncRNAs may have roles in fetal lung development and the results of the present study may lay the foundation for subsequent in‑depth studies into lncRNAs in fetal lung development and subsequent clarification of the pathogenesis of neonatal pulmonary diseases.

Introduction

Long non-coding RNAs (lncRNAs) are characterized by their length (>200 nucleotides), intron/exon structure, the presence of a 3' untranslated region and termination region, and a limited coding potential supported by the absence of open reading frames (1). Biochemically, lncRNAs are thought to mediate local gene expression as cis-regulatory elements, affect transcription of multiple genes as trans-regulatory elements and act as a scaffold for chromatin structure maintenance (2,3). In terms of function, lncRNAs have been reported to participate in numerous biological processes, including X chromosome inactivation, genomic imprinting, cell cycle regulation and the regulation of stem cell pluripotency (4,5). Additionally, the molecular functions of lncRNAs have been highlighted to have roles in various diseases, particularly those relevant to endocrinology, reproduction, metabolism, immunology, neurobiology, muscle biology and cancer (6-9).

Several studies have investigated the association between neonatal lung diseases and lncRNAs. Cheng et al (10) reported 9 lncRNAs that were potentially associated with bronchopulmonary dysplasia (BPD) and these data may provide novel insight into the biological roles of lncRNAs in the pathogenesis of BPD. Numerous lncRNAs are significantly differentially expressed in various lung diseases. For instance, metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) has been reported to have an important role in lung cancer progression (11-13). Although the loss of MALAT1 does not affect lung development (14), a previous study indicated that the upregulation of MALAT1 may protect preterm infants with BPD by inhibiting apoptosis (15). Deletions of chromosomes encompassing other lncRNAs may cause lethal lung developmental disorders (16). Szafranski et al (17) demonstrated that deletion of a small non-coding methylated region at 16q24.1, included in lncRNA genes, caused the lethal lung developmental disorder alveolar capillary dysplasia with misalignment of pulmonary veins with parent-of-origin effects in a human model. These data indicated that lncRNAs may regulate fetal lung development.

As the survival rate increases among preterm infants, respiratory distress syndrome (RDS) and BPD are becoming more and more common (18). One widely accepted cause of BPD is insufficient fetal lung development during pregnancy (19). Additionally, a lack of a pulmonary surfactant synthesized by type II alveolar epithelial cells is acknowledged as a major cause of RDS (20). Consequently, there may be a close association between neonatal respiratory diseases and lung development.

Fetal lung development is a complex and continuous process. The development of lung structure includes the embryonic, fetal and postnatal stages (21). Fetal embryonic lung development may be divided into the pseudo-glandular period (7-16 weeks of gestation), canalicular period (16-25 weeks of gestation) and terminal saccular period (25 weeks to full term gestation) (22). Different stages of lung development have different characteristics (23). During the terminal saccular period, with the appearance of alveolar septum, capillaries, elastic fibers and collagen fibers, terminal vesicles become alveolar (21). Alveolar maturation begins at 30 weeks of gestation. Lung potential gas volume and surface area increase from 25 weeks of gestation to full term (24). Increased alveoli, lung volume and surface area provide the anatomical potential for gas exchange and, therefore, provide the basis for fetal survival following birth (25-27). In the present study, three periods of fetal lung development, divided by gestational week, were investigated through the examination of morphological and lncRNA expression changes in three groups of fetal lung tissue samples. An Affymetrix Human GeneChip was employed to assess the differential expression of lncRNAs between three phases of fetal lung development. Bioinformatics methods were also used to analyze the potential functions and pathways associated with the protein-coding genes associated with the differentially expressed lncRNA. These data may provide a theoretical basis for the prevention and treatment of neonatal lung developmental diseases, including RDS and BPD.

Materials and methods

Patients and samples

The present study protocol was approved by the Ethics Committee of Nanjing Maternal and Child Health Care Hospital, Nanjing, China [approval no. (2014) 74]. All of the patients included provided written informed consent to participate in the current study. Abortion was most commonly induced due to personal or social factors, rather than due to congenital problems.

The inclusion criteria were as follows: i) Gestational age of the fetus at the time-point of abortion was 7-28 weeks; ii) fetal abortion was performed due to personal or social factors; iii) pregnant females were aged 20-35 years; and iv) pregnant females provided written informed consent.

The exclusion criteria were as follows: i) Pregnant females with a history of hypertension or diabetes, or kidney, heart, connective tissue or autoimmune diseases; ii) pregnant females with a known history of exposure to radioactivity, toxic substances or drugs; iii) maternal use of glucocorticoids (e.g., dexamethasone, prednisone or beclomethasone) prior to abortion; iv) pregnant females with signs of infection, including positive amniotic fluid culture, increased C-reactive protein or procalcitonin; and v) previously detected chromosomal abnormalities or congenital malformations of the fetus.

Abortion procedure

Procedures took place between August 2014 and February 2015 at Nanjing Maternity and Child Health Care Hospital. Physicians explained the medical method and possible adverse reactions of abortion to the pregnant females who then provided voluntary written informed consent. Females at 8-13 weeks of gestation took mifepristone (200 mg orally), then misoprostol (400 µg sublingually) followed by mifepristone (200 mg orally) after 24-48 h. If the abortion was not complete, repeated misoprostol was taken sublingually every 3 h and up to 4 doses were administered until complete abortion. For females at 14-28 weeks of gestation, amniocentesis was performed prior to the intra-amniotic injection of 0.5% rivanol solution (100 mg) to induce contractions and initiate labor. The pregnant females took mifepristone (25 mg orally), which was used to soften the cervix (28-30). Fetal right-lung tissue samples were collected within 2 h of labor. Fetal lungs were isolated and were divided into three groups according to the fetal gestational age. These groups were termed S1 (embryonic week, 7-16), S2 (embryonic week, 16-25) and S3 (embryonic week, 25-28). A total of 10 samples were collected at S1 (mean age, 27.2±1.56 years; mean fetal gestational age, 13.57±0.73 weeks) 14 samples at S2 (mean age, 25.5±0.84 years; mean fetal gestational age, 20.73±0.72) and 12 samples at S3 (mean age, 25.92±1.13 years; mean fetal gestational age, 26.75±0.23 weeks). The median overall gestational age was 21.35 weeks with a range of 15.58-26.18 weeks.

The right lungs were washed with PBS and cut into several parts (2x4x6 mm), all of which were kept for histological examination. A 5 mg sample of each of the lungs was cut into small pieces in homogenization buffer (Trevigen, Inc.). The lungs were homogenized with a Sonifier (Branson Ultrasonics Corporation) with an amplitude of 14 microns for 10 sec. The cell supernatant was obtained by centrifugation at 12,000 x g for 15 min at 4˚C. Total RNA from the right lungs was isolated from the supernatant using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. RNA quality and quantity were measured on a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). A total of 1 µg of total RNA was taken from each sample and subjected to 1.5% agarose gel electrophoresis (120 V) for 15 min to determine the integrity of 28 and 18s ribosomal RNA under a gel imager (Bio-Rad Laboratories, Inc.) and to ensure that there were no residual RNA enzymes.

Histology

Lung tissues were fixed with 4% buffered paraformaldehyde at 4˚C overnight, dehydrated [50% ethanol for 2 h, 70% ethanol for 2 h, 85% ethanol for 2 h, 95% ethanol for 2 h, anhydrous ethanol for 1.5 h and anhydrous ethanol (fresh configuration) II for 1.5 h] and embedded in paraffin. Sections with a thickness of 3-4 µm were prepared for H&E staining and immunohistochemistry. Sections were dewaxed with xylene and rehydrated in a graded series of ethanol/water solutions. The sections were then stained with hematoxylin for 5 min, differentiated with 1% ethanol hydrochloride for 3 sec and transferred to eosin solution for 2 min. All procedures were performed at room temperature. The sections were then dehydrated and mounted. A total of three sections were randomly selected from each sample and a total of 108 H&E-stained sections were taken for image analysis, which was performed under a light microscope (BX51; Olympus Corporation) at magnifications of x200 and x400 to observe changes in fetal lung development between groups S1, S2 and S3.

Affymetrix Human GeneChip analysis

The GeneChip® Human Transcriptome Array 2.0 (Affymetrix Inc.) serves as an advanced and comprehensive gene expression profiling tool for whole-transcript coverage available on any microarray platform (31). Probes are distributed across the full length of a gene, including specific probes covering splice junctions, providing a more complete and accurate picture of overall gene expression with additional capacity for transcript isoform analysis. In brief, following the extraction of total RNA, 10 µg of RNA was used to synthesize double-stranded complementary (c)DNA using an Ambion WT expression kit (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The cDNA was then fragmented and labelled with the Affymetrix GeneChip WT terminal labelling kit (Affymetrix Inc.), according to the manufacturer's protocol. The fragmented cDNA was hybridized using the GeneChip hybridization, wash and stain kit (Affymetrix Inc.), according to the manufacturer's protocol. Hybridization was performed at 65˚C with rotation for 16 h in an Affymetrix GeneChip Hybridization Oven 645 (Affymetrix Inc.). The GeneChip arrays were washed and stained on an Affymetrix Fluidics Station 450 (Affymetrix Inc.), followed by scanning on a GeneChip Scanner 3000 (Affymetrix Inc.). The microarray analysis was performed by Genminix Informatics Co., Ltd.

Reverse transcription-quantitative PCR (RT-qPCR)

A total of 0.1 g of lung tissue was homogenized in a homogenizer (Kinematica AG). Total RNA was isolated from fetal lungs using TRIzol® reagent. cDNA was synthesized with the Transcriptor First Strand cDNA Synthesis kit (Roche Diagnostics Co., Ltd.), according to the manufacturer's protocol. An aliquot of 1 µg total RNA was added to each reaction mixture. RT-qPCR was performed on an ABI 7500 thermal cycler (Applied Biosystems; Thermo Fisher Scientific, Inc.) with SYBR Green (Roche Diagnostics Co., Ltd.). The thermocycling conditions were as follows: 95˚C for 5 min, followed by 40 cycles of 95˚C for 20 sec and 55˚C for 20 sec. At the end of each run, a melting curve analysis was performed at 72˚C to monitor primer dimers and formation of non-specific products. Relative quantification of gene expression in multiple samples was achieved by normalization to the expression of an endogenous control gene, GAPDH. The relative expression levels were calculated by the 2-∆∆Cq method (32). Primer sequences are listed in Table I.

Table I

Reverse transcription-quantitative PCR primers.

Table I

Reverse transcription-quantitative PCR primers.

GenePrimer sequence (5'-3')
n387037Forward TGGAAATTGGAAGAGCACAA
 Reverse TGTATGAGGGTGCATGGAAA
n340848Forward TTACAAGCTCCATCAGCACAG
 Reverse TCCACCTGTTCATTGGTTCA
ENST00000445168Forward GGTGGCAGAGCTAGAACTCG
 Reverse GGGTAAGCCTCGTGTACCAA
n336823Forward TTGTGGGCCTCCTCATATTT
 Reverse GAAGTTTGTCCACCGCAAAG
GAPDHForward AACTTTGGCATTGTGGAAGG
 Reverse GGATGCAGGGATGATGTTCT
Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses

The GO project offers a controlled vocabulary to label gene and gene product attributes in any organism (geneontology.org; date of access, May 2015). Categories covered by GO analysis include biological process, cellular component and molecular function. GO analysis provides an interpretation of the relevance of genes differentially expressed between the groups by suggesting possible functions of the genes and functions associated with the genes. Fisher's exact test and the χ2 test were performed to calculate the P-value and false discovery rate of each GO term function. The input used in the bioinformatics analysis was the crossover genes of differentially expressed lncRNA-associated genes and differential mRNA genes co-expressed with lncRNA that were screened in the lncRNA expression profiling results. The criterion for screening differentially expressed genes for statistical significance was P<0.05, thus screening out the significant functions exerted by the differentially expressed genes.

KEGG (kegg.jp/kegg/pathway.html) pathway analysis is a functional analysis tool, mapping a set of genes that may be associated with a certain lncRNA to potential pathways they are accumulated in. Fisher's exact test and χ2 test were used to identify differentially expressed genes. P<0.05 was used to screen and obtain significantly associated pathways. The probability of enrichment of a differentially expressed gene set in a term entry was represented by an enrichment score (EC), with a higher EC indicating a higher significance of the entry. The EC was calculated as the negative base 10 log of the P-value.

Statistical analysis

All quantitative data are expressed as the mean ± standard error of the mean. All experiments were repeated ≥3 times with similar results. Data were analyzed using a SPSS statistical package (version no. 17.0; SPSS, Inc.) and the results of the RT-qPCR were evaluated by one-way ANOVA with the Student-Newman-Keuls post-hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Histology

In the S1 group, the bronchial tree extended to numerous bronchioles, which were composed of epithelial cells. In a single layer of cubic cells, cells were tall, columnar and arranged in rings. In the S2 group, terminal bronchioles branched out into greater numbers of respiratory bronchioles and cubic epithelial cells appeared short and columnar compared with S1. A dilated alveolar lumen, increased alveolar septa, thinner interstitium and hyperplasia of capillaries were observed in the fetal lungs in the S2 and S3 groups. Alveolar sacs formed in the S3 group and pulmonary alveoli took shape. In S3, a greater number of alveolar septa appeared compared with the S1 and S2 groups, and the interstitium was thinner compared with the S1 and S2 groups. In S3, epithelial cells had a cubic or flat shape (Fig. 1).

lncRNA microarray profiles

Affymetrix Human GeneChip was utilized to determine the expression spectrum of lncRNAs during fetal lung development. As a result, 687 lncRNAs were indicated to be differentially expressed among the three groups (S1, S2 and S3) of fetal lung tissue samples. According to these data, there were 34 upregulated lncRNAs and 12 downregulated lncRNAs that were significantly differentially expressed among all combinations of S1 vs. S2 vs. S3 (fold-change ≥1.5). Among the 687 differentially expressed lncRNAs, 39 downregulated and 202 upregulated lncRNAs were identified in the S2 vs. S1 comparison (fold-change >2). Furthermore, 24 lncRNAs were downregulated and 78 upregulated in the S3 vs. S2 comparison (fold-change >2) and 77 downregulated and 535 upregulated lncRNAs were identified in the S3 vs. S1 comparison (fold-change >2; Tables II and III). Hierarchical clustering was performed in order to display distinguishable lncRNA expression profiles among the groups. Taken together, these data were consistent with the notion that different lncRNAs may be involved in the different phases of lung development (Fig. 2).

Figure 1.

Morphology of lung tissues at different stages of fetal development. (A) Representative images of group S1 (7-16 weeks); the box indicates bronchioles and the arrow points at high columnar epithelial cells, arranged in rings. (B) Representative images of group S2 (E16-E25 weeks); the box indicates respiratory bronchi and the arrow indicates short columnar cells. (C) Representative images of group S3 (25-28 weeks); the box delineates the alveolar sac and the arrow points to squamous epithelial cells. Scale bar, 10 µm (upper panel) or 20 µm (lower panel). Magnification, x200 (upper panel) or x400 (lower panel).

Table II

Downregulated differentially expressed lncRNAs between the three stages of fetal lung development.

Table II

Downregulated differentially expressed lncRNAs between the three stages of fetal lung development.

A, S2 vs. S1 
lncRNAFold-change
n3357740.06935588
n3397450.182483003
n3345910.186404811
ENST000004451680.194416962
n3427400.223988722
n3369280.225022474
n3361020.234549609
n3357850.254695963
n3330310.272814078
n3328150.275703789
OTTHUMT000003123980.30750654
n4097720.320872488
n3385990.34498774
n3340310.346874815
n4069150.347614219
n3453530.365559716
ENST000005595530.370347627
NR_0244080.371285274
n3334380.376855146
TCONS_l2_00020561-XLOC_l2_0107030.381374424
B, S3 vs. S2
lncRNAFold-change
n3376320.186974574
n3369280.221248411
n3340740.231631923
n3355160.250004679
TCONS_l2_00009549-XLOC_l2_0050890.322783111
n3368410.35573011
n4107230.39944174
n3366830.412094182
n3339580.414088201
TCONS_00000280 XLOC_0003570.415518323
n3365850.417651927
n3334320.424395128
n4081210.425823065
ENST000005570670.428630673
ENST000004486800.4427573
n3817890.457561636
n3327920.469538382
n3333800.482586011
n3408540.486920451
n3356200.488461581
C, S3 vs. S1
lncRNAFold-change
n3369280.049785865
ENST000004451680.108667618
n3397450.117414297
n3357740.144621906
n3361020.179262671
n4097720.243588174
n3388170.26669321
n3368230.27863222
n3357850.281131886
TCONS_l2_00020561-XLOC_l2_0107030.283204481
n3427400.288809679
n3453530.295015569
n3345910.295785862
ENST000005570670.303030728
n3368410.322103669
n3334320.322647779
n3418860.322920291
n3365850.333848393
NR_0398900.343190138
ENST000005008430.344062843

[i] Groups: S1, embryonic weeks 7-16; S2, embryonic weeks 16-25; S3, embryonic weeks 25-28. LncRNA, long non-coding RNA.

Table III

Upregulated differentially expressed lncRNAs between the 3 stages of fetal lung development.

Table III

Upregulated differentially expressed lncRNAs between the 3 stages of fetal lung development.

A, S2 vs. S1
lncRNAFold-change
NR_00156447.08876564
n33775632.68860714
n33763210.19552386
n3391639.001615862
NR_0033498.523677449
n3348298.462693991
NR_0033478.142292223
NR_0032987.369409383
NR_0033147.246287266
NR_0033036.652354265
NR_0033556.62124723
NR_0033596.399445927
n3428006.291303669
NR_0032976.236367731
n3339555.766172512
NR_0012915.567478185
NR_0033085.567478185
NR_0033485.40086692
NR_0029745.268747348
NR_0025815.046048245
B, S3 vs. S2
lncRNAFold-change
n3863264.555394507
NR_0294934.4777873
NR_0240654.340466177
n3829964.289896973
NR_0366774.269902123
NR_0267033.970979739
n4082933.920158536
n3872003.917295604
ENST000005353633.798942827
TCONS_l2_00002153-XLOC_l2_0003933.759703782
n3342893.748358652
ENST000004590593.538294177
n3401463.474537616
TCONS_00023442-XLOC_0112873.453784337
ENST000003798163.283596831
TCONS_l2_00017125-XLOC_l2_0091293.263300854
NR_0044073.159558548
NR_0285023.103420093
NR_0025813.063370788
n3379983.052347039
C, S3 vs. S1
lncRNAFold-change
NR_00156435.47473495
n33775623.19649621
NR_00258115.45791679
n33395514.17277149
n33482913.39219004
NR_02670310.89074695
n33916310.31981355
n3428009.393546857
NR_0044078.566180043
n3328808.210340188
TCONS_00023442-XLOC_0112877.217168811
TCONS_l2_00012221-XLOC_l2_0065487.062979945
NR_0029746.958339161
NR_0033496.388459125
n3408486.261155795
n3379986.218717152
n3330336.04561874
NR_0033475.995399957
NR_0029775.681622584
NR_0033145.591673021

[i] Groups: S1, embryonic weeks 7-16; S2, embryonic weeks 16-25; S3, embryonic weeks 25-28. lncRNA, long non-coding RNA.

As certain lncRNAs exhibited more significant fold-changes among the three groups, 4 lncRNAs were selected based on these data, including two downregulated lncRNAs (n336823 and ENST00000445168; Table IV) and two upregulated lncRNAs (n3408848 and n387037; Table V).

Table IV

Specific fold-changes of ≥1.5 consistently upregulated lncRNAs identified following screening.

Table IV

Specific fold-changes of ≥1.5 consistently upregulated lncRNAs identified following screening.

Comparisonn34048n387037
S2 vs. S12.9059181.571261
S3 vs. S22.1546221.509102
S3 vs. S16.2611562.371193

[i] Groups: S1, embryonic weeks 7-16; S2, embryonic weeks 16-25; S3, embryonic weeks 25-28. Fold-change, the ratio of the geometric mean of the same probe signal value between groups.

Table V

Specific fold-changes of ≥1.5 consistently downregulated lncRNAs identified following screening.

Table V

Specific fold-changes of ≥1.5 consistently downregulated lncRNAs identified following screening.

Fold-changen336823 ENST00000445168
S2 vs. S10.4147610.194416
S3 vs. S20.4717890.458941
S3 vs. S10.2786320.108668

[i] Groups: S1, embryonic weeks 7-16; S2, embryonic weeks 16-25; S3, embryonic weeks 25-28. Fold-change, the ratio of the geometric mean of the same probe signal value between groups.

RT-qPCR

The expression levels of the selected lncRNAs were confirmed by RT-qPCR. Among these differentially expressed lncRNAs, n340848 and n387037 were indicated to be continuously increased in expression with progression through the three phases of lung development, while the expression levels of ENST00000445168 and n336823 were reduced with progression. These results were consistent with the GeneChip data obtained. The relative trends in expression of these lncRNAs are presented in Fig. 3.

Figure 2.

Hierarchical clustering of lncRNA expression in the 3 stages of embryonic development. Distinguishable lncRNA expression profiles were observed. Red indicates significantly increased expression. Green denotes significantly reduced expression and black indicates no difference in expression levels. Groups: S1, embryonic weeks 7-16; S2, embryonic weeks 16-25; S3, embryonic weeks 25-28. lncRNA, long non-coding RNA.

GO analysis and KEGG pathway analysis

Upregulated transcripts were indicated to be associated with the GO terms cell adhesion, hydrogen peroxide decomposition and protein kinase C of a G protein-coupled receptor signaling pathway (Fig. 4A). The top three biological process terms associated with the downregulated transcripts were G protein-coupled receptor signaling pathway coupled to the cyclic guanosine monophosphate nucleotide second messenger, brain development and cerebral cortex development (Fig. 4A).

Figure 4.

Gene Ontology terms associated with the crossover genes of differentially expressed lncRNA-associated genes and differential mRNA genes co-expressed with lncRNA. (A) Terms associated with upregulated genes. (B) Terms associated with downregulated genes. ER, estrogen receptor; cGMP, cyclic guanosine monophosphate.

Figure 3.

Validation of GeneChip results by RT-qPCR. n340848 and n387037 progressively increased in expression as the gestational age increased. ENST00000445168 and n336823 expression was reduced with the gestational age. Groups: S1, embryonic weeks 7-16; S2, embryonic weeks 16-25; S3, embryonic weeks 25-28. Statistical analysis was performed on RT-qPCR data. ***P<0.001, **P<0.01 and *P<0.05 vs. indicated groups. RT-qPCR, reverse transcription-quantitative PCR.

Additionally, KEGG enrichment analysis was performed to investigate the possible roles of the lncRNA-associated protein-coding genes. The most significant pathways enriched in the set of upregulated protein-coding genes included cell adhesion molecules, as well as adherens junction and glyceride metabolism (Fig. 5A). Biosynthesis of an amino acid, basal cell carcinoma and glycolysis/gluconeogenesis were the most important pathways enriched in the set of down-regulated genes (Fig. 5B).

Figure 5.

Kyoto Encyclopedia of Genes and Genomes pathways associated with the crossover genes of differentially expressed lncRNA-associated genes and differential mRNA genes co-expressed with lncRNA. (A) Terms associated with upregulated genes. (B) Terms associated with downregulated genes.

Discussion

In the present study, 687 lncRNAs were identified to be differentially expressed among three groups (embryonic periods S1, S2 and S3) of human fetal lung tissue samples. The results revealed 34 upregulated lncRNAs and 12 downregulated lncRNAs, which were significantly differentially expressed among all combinations of S1 vs. S2 vs. S3 (fold-change ≥1.5; P<0.05). Among these differentially expressed lncRNAs, n340848, n387037, n336823 and ENST00000445168 were then validated by RT-qPCR. These results were consistent with the GeneChip results. GO enrichment analysis revealed that the majority of the GO terms associated with these genes belonged to the biological process category. The fact that one lncRNA is able to target numerous genes suggests that lncRNAs may be involved in a series of biological processes.

Among the four lncRNAs selected, lncRNA n340848 is located on chromosome 6, overlapping with a gene called neural precursor cell expressed developmentally down-regulated 9 (NEDD9). The highest levels of NEDD9 mRNA and protein have been detected in lungs and kidneys (33). NEDD9 has been reported to act as a scaffold protein and is part of the Crk-associated substrate family, which regulates protein complex control of cell invasion and differentiation (34). n387037 is a 1,342-bp lncRNA with a genomic overlap with the platelet and endothelial cell adhesion molecule 1 (PECAM1) gene (5). PECAM1 expression has been reported in almost all tissues and is expressed at the highest levels in the placenta, lungs and fat tissues (35). It has been indicated as a novel therapeutic target in neonatal respiratory distress syndrome and ventilator-induced lung injury (36). LncRNA n336823 is 26,063 bp long and overlaps with patched 1, which encodes a member of the patched family of proteins and a component of the hedgehog (HH) signaling pathway (37). HH signaling is crucial for embryonic development and tumorigenesis (38). Numerous studies have indicated that activation of the HH signaling pathway is associated with the progression of multiple solid tumors, including lung cancer (1,39).

lncRNA ENST0000445168 (also known as 02038-202), encoded on chromosome 3, is an intergenic lncRNA, whose transcription occurs entirely within the genomic interval between two adjacent protein-coding genes (40,41). These results indicated that the four lncRNAs mentioned above may take part in the etiology and pathogenesis of disorders of neonatal lung development; however, further research is required for confirmation.

Numerous studies have indicated that various lncRNAs are involved in different biological events (38,42,43). lncRNA NR_033925, also known as forkhead box (FOX)F1-AS1 or FOXF1-adjacent non-coding developmental regulatory RNA, is encoded upstream of FOXF1(44). It is highly expressed in human lungs and has an important effect on the development of the heart and gastrointestinal tract (45). lncRNA n409380, associated with the FOXP2 gene, promotes embryonic development and the proliferation of lung epithelial cells (46). lncRNA n335087 and lncRNA n339275 overlap with gene TGF-β receptor 2 and are involved in lung development-associated tracheal morphogenesis and leukocytic protein phosphorylation (17).

Certain studies have addressed the specific expression patterns or function of lncRNAs in lung development. Herriges et al (47) screened 363 lncRNAs in the lung and foregut endoderm and indicated that they were spatially associated with transcription factors across the genome. It has been reported that lncRNAs in the lungs are located near genes of transcription factors, including NK2 homeobox 1 (NKX2.1), GATA binding protein 6, FOXA2 and FOXF1, which are essential in foregut and lung development (48,49). One of these lncRNAs, NKX2.1-associated non-coding intergenic RNA (NANCI), performs an important function in lung development by acting upstream of the critical transcription factor NKX2.1 and downstream of Wnt/β-catenin signaling to regulate lung endoderm gene expression and morphogenesis (16). Furthermore, a previous study identified a feedback loop within the NANCI-NKX2.1 gene duplex to explain how this subset acts as a rheostat to buffer the expression of neighboring transcription factor genes, to maintain tissue-specific cellular identity during development and postnatal homeostasis (47).

In conclusion, the results of the present study indicated that the lncRNA expression profile varies among different phases of fetal lung development. These results provided certain indications of the roles of lncRNAs in human fetal lung development. In the future, functional verification, target gene prediction and validation of the identified lncRNAs will be performed in vitro and in vivo to provide novel insight into the pathogenesis of neonatal pulmonary diseases.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (grant no. 781270725).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JS, ZB, YY, XGZ and XYZ designed the experiments. JS, ZB, WZ, CM, YS and QK performed the experiments, collected data, generated the figures and interpreted the results. JS, ZB, XGZ and XYZ wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All procedures were approved by the Ethics Committee of Nanjing Maternal and Child Health Hospital, Nanjing, China [approval no. (2014) 74] and all patients provided written informed consent.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Schmitz SU, Grote P and Herrmann BG: Mechanisms of long noncoding RNA function in development and disease. Cell Mol Life Sci. 73:2491–2509. 2016.PubMed/NCBI View Article : Google Scholar

2 

Ulitsky I and Bartel DP: lincRNAs: Genomics, evolution, and mechanisms. Cell. 154:26–46. 2013.PubMed/NCBI View Article : Google Scholar

3 

Rinn JL and Chang HY: Genome regulation by long noncoding RNAs. Annu Rev Biochem. 81:145–166. 2012.PubMed/NCBI View Article : Google Scholar

4 

Wang KC and Chang HY: Molecular mechanisms of long noncoding RNAs. Mol Cell. 43:904–914. 2011.PubMed/NCBI View Article : Google Scholar

5 

Mercer TR, Dinger ME and Mattick JS: Long non-coding RNAs: Insights into functions. Nat Rev Genet. 10:155–159. 2009.PubMed/NCBI View Article : Google Scholar

6 

Wang C, Wang L, Ding Y, Lu X, Zhang G, Yang J, Zheng H, Wang H, Jiang Y and Xu L: LncRNA structural characteristics in epigenetic regulation. Int J Mol Sci. 18(2659)2017.PubMed/NCBI View Article : Google Scholar

7 

Wangyang Z, Daolin J, Yi X, Zhenglong L, Lining H, Yunfu C and Xingming J: NcRNAs and Cholangiocarcinoma. J Cancer. 9:100–107. 2018.PubMed/NCBI View Article : Google Scholar

8 

Jiang W, Liu Y, Liu R, Zhang K and Zhang Y: The lncRNA DEANR1 facilitates human endoderm differentiation by activating FOXA2 expression. Cell Rep. 11:137–148. 2015.PubMed/NCBI View Article : Google Scholar

9 

Wang P, Lu S and Mao H, Bai Y, Ma T, Cheng Z, Zhang H, Jin Q, Zhao J and Mao H: Identification of biomarkers for the detection of early stage lung adenocarcinoma by microarray profiling of long noncoding RNAs. Lung Cancer. 88:147–153. 2015.PubMed/NCBI View Article : Google Scholar

10 

Cheng HR, He SR, Wu BQ, Li DC, Hu TY, Chen L and Deng ZH: Deep Illumina sequencing reveals differential expression of long non-coding RNAs in hyperoxia induced bronchopulmonary dysplasia in a rat model. Am J Transl Res. 9:5696–5707. 2017.PubMed/NCBI

11 

Schmidt LH, Spieker T, Koschmieder S, Schäffers S, Humberg J, Jungen D, Bulk E, Hascher A, Wittmer D, Marra A, et al: The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. J Thorac Oncol. 6:1984–1992. 2011.PubMed/NCBI View Article : Google Scholar

12 

Xu C, Yang M, Tian J, Wang X and Li Z: MALAT-1: A long non-coding RNA and its important 3' end functional motif in colorectal cancer metastasis. Int J Oncol. 39:169–175. 2011.PubMed/NCBI View Article : Google Scholar

13 

Lai MC, Yang Z, Zhou L, Zhu QQ, Xie HY, Zhang F, Wu LM, Chen LM and Zheng SS: Long non-coding RNA MALAT-1 overexpression predicts tumor recurrence of hepatocellular carcinoma after liver transplantation. Med Oncol. 29:1810–1816. 2012.PubMed/NCBI View Article : Google Scholar

14 

Zhang B, Arun G, Mao YS, Lazar Z, Hung G, Bhattacharjee G, Xiao X, Booth CJ, Wu J, Zhang C and Spector DL: The lncRNA Malat1 is dispensable for mouse development but its transcription plays a cis-regulatory role in the adult. Cell Rep. 2:111–123. 2012.PubMed/NCBI View Article : Google Scholar

15 

Cai C, Qiu J, Qiu G, Chen Y, Song Z, Li J and Gong X: Long non-coding RNA MALAT1 protects preterm infants with bronchopulmonary dysplasia by inhibiting cell apoptosis. BMC Pulm Med. 17(199)2017.PubMed/NCBI View Article : Google Scholar

16 

Herriges MJ, Swarr DT, Morley MP, Rathi KS, Peng T, Stewart KM and Morrisey EE: Long noncoding RNAs are spatially correlated with transcription factors and regulate lung development. Genes Dev. 28:1363–1379. 2014.PubMed/NCBI View Article : Google Scholar

17 

Szafranski P, Dharmadhikari AV, Brosens E, Gurha P, Kolodziejska KE, Zhishuo O, Dittwald P, Majewski T, Mohan KN, Chen B, et al: Small noncoding differentially methylated copy-number variants, including lncRNA genes, cause a lethal lung developmental disorder. Genome Res. 23:23–33. 2013.PubMed/NCBI View Article : Google Scholar

18 

Moss TJ: Respiratory consequences of preterm birth. Clin Exp Pharmacol Physiol. 33:280–284. 2006.PubMed/NCBI View Article : Google Scholar

19 

Pierro M, Ciarmoli E and Thébaud B: Bronchopulmonary dysplasia and chronic lung disease: Stem cell therapy. Clin Perinatol. 42:889–910. 2015.PubMed/NCBI View Article : Google Scholar

20 

Kumar A and Bhatnagar V: Respiratory distress in neonates. Indian J Pediatr. 72:425–428. 2005.PubMed/NCBI View Article : Google Scholar

21 

Schittny JC: Development of the lung. Cell Tissue Res. 367:427–444. 2017.PubMed/NCBI View Article : Google Scholar

22 

Burri PH: Fetal and postnatal development of the lung. Annu Rev Physiol. 46:617–628. 1984.PubMed/NCBI View Article : Google Scholar

23 

Copland I and Post M: Lung development and fetal lung growth. Paediatr Respir Rev. 5 (Suppl A):S259–S264. 2004.PubMed/NCBI View Article : Google Scholar

24 

Roth-Kleiner M and Post M: Similarities and dissimilarities of branching and septation during lung development. Pediatr Pulmonol. 40:113–134. 2005.PubMed/NCBI View Article : Google Scholar

25 

Burri PH: Structural aspects of postnatal lung development-alveolar formation and growth. Biol Neonate. 89:313–322. 2006.PubMed/NCBI View Article : Google Scholar

26 

Zoetis T and Hurtt ME: Species comparison of lung development. Birth Defects Res B Dev Reprod Toxicol. 68:121–124. 2003.PubMed/NCBI View Article : Google Scholar

27 

Hislop AA: Airway and blood vessel interaction during lung development. J Anat. 201:325–334. 2002.PubMed/NCBI View Article : Google Scholar

28 

WHO 2018: Medical management of abortion: Available online: https://www.who.int/reproductivehealth/publications/medicalmanagement-abortion/en/.

29 

Chen QJ, Hou SP, Meads C, Huang YM, Hong QQ, Zhu HP and Cheng LN: EBM-CONNECT Collaboration: Mifepristone in combination with prostaglandins for termination of 10-16 weeks' gestation: A systematic review. Eur J Obstet Gynecol Reprod Biol. 159:247–254. 2011.PubMed/NCBI View Article : Google Scholar

30 

ACOG Practice Bulletin No. 135: Second-trimester abortion. Obstet Gynecol 121: 1394-1406, 2013.

31 

Young RA: Biomedical discovery with DNA arrays. Cell. 102:9–15. 2000.PubMed/NCBI View Article : Google Scholar

32 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

33 

Duff MO, Olson S, Wei X, Garrett SC, Osman A, Bolisetty M, Plocik A, Celniker SE and Graveley BR: Genome-wide identification of zero nucleotide recursive splicing in Drosophila. Nature. 521:376–379. 2015.PubMed/NCBI View Article : Google Scholar

34 

Chang JX, Gao F, Zhao GQ and Zhang GJ: Expression and clinical significance of NEDD9 in lung tissues. Med Oncol. 29:2654–2660. 2012.PubMed/NCBI View Article : Google Scholar

35 

Gumina RJ, Kirschbaum NE, Rao PN, van Tuinen P and Newman PJ: The human PECAM1 gene maps to 17q23. Genomics. 34:229–232. 1996.PubMed/NCBI View Article : Google Scholar

36 

Villar J, Zhang H and Slutsky AS: Lung repair and regeneration in ARDS: Role of PECAM1 and Wnt Signaling. Chest. 155:587–594. 2019.PubMed/NCBI View Article : Google Scholar

37 

Jia Y, Wang Y and Xie J: The Hedgehog pathway: Role in cell differentiation, polarity and proliferation. Arch Toxicol. 89:179–191. 2015.PubMed/NCBI View Article : Google Scholar

38 

Kopp F and Mendell JT: Functional classification and experimental dissection of long noncoding RNAs. Cell. 172:393–407. 2018.PubMed/NCBI View Article : Google Scholar

39 

McMillan R and Matsui W: Molecular pathways: The hedgehog signaling pathway in cancer. Clin Cancer Res. 18:4883–4888. 2012.PubMed/NCBI View Article : Google Scholar

40 

Bu D, Yu K, Sun S, Xie C, Skogerbø G, Miao R, Xiao H, Liao Q, Luo H, Zhao G, et al: NONCODE v3.0: Integrative annotation of long noncoding RNAs. Nucleic Acids Res. 40 (Database Issue):D210–D215. 2012.PubMed/NCBI View Article : Google Scholar

41 

Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, Thomas K, Presser A, Bernstein BE, van Oudenaarden A, et al: Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci USA. 106:11667–11672. 2009.PubMed/NCBI View Article : Google Scholar

42 

McDonel P and Guttman M: Approaches for understanding the mechanisms of long noncoding RNA regulation of gene expression. Cold Spring Harb Perspect Biol. 11(a032151)2019.PubMed/NCBI View Article : Google Scholar

43 

Wu H, Yang L and Chen LL: The diversity of long noncoding RNAs and their generation. Trends Genet. 33:540–552. 2017.PubMed/NCBI View Article : Google Scholar

44 

Schnatwinkel C and Niswander L: Nubp1 is required for lung branching morphogenesis and distal progenitor cell survival in mice. PLoS One. 7(e44871)2012.PubMed/NCBI View Article : Google Scholar

45 

Sauvageau M, Goff LA, Lodato S, Bonev B, Groff AF, Gerhardinger C, Sanchez-Gomez DB, Hacisuleyman E, Li E, Spence M, et al: Multiple knockout mouse models reveal lincRNAs are required for life and brain development. Elife. 2(e01749)2013.PubMed/NCBI View Article : Google Scholar

46 

Mahlapuu M, Enerbäck S and Carlsson P: Haploinsufficiency of the forkhead gene Foxf1, a target for sonic hedgehog signaling, causes lung and foregut malformations. Development. 128:2397–2406. 2001.PubMed/NCBI

47 

Herriges MJ, Tischfield DJ, Cui Z, Morley MP, Han Y, Babu A, Li S, Lu M, Cendan I, Garcia BA, et al: The NANCI-Nkx2.1 gene duplex buffers Nkx2.1 expression to maintain lung development and homeostasis. Genes Dev. 31:889–903. 2017.PubMed/NCBI View Article : Google Scholar

48 

Goss AM, Tian Y, Tsukiyama T, Cohen ED, Zhou D, Lu MM, Yamaguchi TP and Morrisey EE: Wnt2/2b and beta-catenin signaling are necessary and sufficient to specify lung progenitors in the foregut. Dev Cell. 17:290–298. 2009.PubMed/NCBI View Article : Google Scholar

49 

Yang H, Lu MM, Zhang L, Whitsett JA and Morrisey EE: GATA6 regulates differentiation of distal lung epithelium. Development. 129:2233–2246. 2002.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Shen J, Bao Z, Zhu W, Ma C, Shen Y, Kan Q, Zhou X, Yang Y and Zhou X: Expression profiles of long non‑coding RNAs during fetal lung development. Exp Ther Med 20: 144, 2020.
APA
Shen, J., Bao, Z., Zhu, W., Ma, C., Shen, Y., Kan, Q. ... Zhou, X. (2020). Expression profiles of long non‑coding RNAs during fetal lung development. Experimental and Therapeutic Medicine, 20, 144. https://doi.org/10.3892/etm.2020.9273
MLA
Shen, J., Bao, Z., Zhu, W., Ma, C., Shen, Y., Kan, Q., Zhou, X., Yang, Y., Zhou, X."Expression profiles of long non‑coding RNAs during fetal lung development". Experimental and Therapeutic Medicine 20.6 (2020): 144.
Chicago
Shen, J., Bao, Z., Zhu, W., Ma, C., Shen, Y., Kan, Q., Zhou, X., Yang, Y., Zhou, X."Expression profiles of long non‑coding RNAs during fetal lung development". Experimental and Therapeutic Medicine 20, no. 6 (2020): 144. https://doi.org/10.3892/etm.2020.9273
Copy and paste a formatted citation
x
Spandidos Publications style
Shen J, Bao Z, Zhu W, Ma C, Shen Y, Kan Q, Zhou X, Yang Y and Zhou X: Expression profiles of long non‑coding RNAs during fetal lung development. Exp Ther Med 20: 144, 2020.
APA
Shen, J., Bao, Z., Zhu, W., Ma, C., Shen, Y., Kan, Q. ... Zhou, X. (2020). Expression profiles of long non‑coding RNAs during fetal lung development. Experimental and Therapeutic Medicine, 20, 144. https://doi.org/10.3892/etm.2020.9273
MLA
Shen, J., Bao, Z., Zhu, W., Ma, C., Shen, Y., Kan, Q., Zhou, X., Yang, Y., Zhou, X."Expression profiles of long non‑coding RNAs during fetal lung development". Experimental and Therapeutic Medicine 20.6 (2020): 144.
Chicago
Shen, J., Bao, Z., Zhu, W., Ma, C., Shen, Y., Kan, Q., Zhou, X., Yang, Y., Zhou, X."Expression profiles of long non‑coding RNAs during fetal lung development". Experimental and Therapeutic Medicine 20, no. 6 (2020): 144. https://doi.org/10.3892/etm.2020.9273
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team