Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2021 Volume 21 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2021 Volume 21 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia‑reperfusion injuries

  • Authors:
    • Zhi-Xiao Li
    • Yu-Juan Li
    • Qian Wang
    • Zhi-Gang He
    • Mao-Hui Feng
    • Hong-Bing Xiang
  • View Affiliations / Copyright

    Affiliations: Department of Anesthesiology and Pain Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, P.R. China, Department of Emergency Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, P.R. China, Department of Gastrointestinal Surgery, Zhongnan Hospital, Wuhan University, Wuhan, Hubei 430071, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 352
    |
    Published online on: February 11, 2021
       https://doi.org/10.3892/etm.2021.9783
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Myocardial ischemia‑reperfusion injury (MIRI) is a significant problem in clinical cardiology, and refers to a more serious myocardial injury caused by blood recanalization after a period of myocardial ischemia, as compared with injury caused by vascular occlusion. The spinal cord, as the primary afferent and efferent center of cardiac sensory and sympathetic nerve fibres, has received increased attention in recent years with regards to the regulation of MIRIs. Previous studies have revealed that MIRI has a strong correlation with the abnormal expression of long non‑coding (lnc)RNAs in the myocardium; however, there are limited reports on the effects of the altered expression of lncRNAs in the spinal cord following MIRI. To investigate the expression patterns of lncRNAs in the spinal cord after MIRI and their potential role in the early stage of reperfusion, a MIRI model was established in rats. After 30 min of myocardial ischemia and 2 h of reperfusion, the upper thoracic spinal cord tissues were immediately dissected and isolated. lncRNAs and mRNAs in spinal cord tissues were screened using transcriptome sequencing technology, and the expression of several highly deregulated mRNAs, including Frs3, Zfp52, Dnajc6, Nedd4l, Tep1, Myef2, Tgfbr1, Fgf12, Mef2c, Tfdp1 and lncRNA, including ENSRNOT00000080713, ENSRNOT00000090564, ENSRNOT00000082588, ENSRNOT00000091080, ENSRNOT00000091570, ENSRNOT00000087777, ENSRNOT00000082061, ENSRNOT00000091108, ENSRNOT00000087028, ENSRNOT00000086475, were further validated via reverse transcription‑quantitative PCR. The number of altered expressed lncRNAs was 126, among which there were 41 upregulated probe sets and 85 downregulated sets. A total of 470 mRNAs were differentially expressed, in which 231 probe sets were upregulated and 239 were downregulated. Gene Ontology analysis indicated that dysregulated transcripts related to biological processes were mainly associated with ‘cell‑cell signaling’. Moreover, pathway analysis demonstrated significant changes in the ‘PI3K/Akt signaling pathway’ and the ‘p53 signaling pathway’. Thus, the altered expression of lncRNAs in the spinal cord may be of considerable importance in the process of MIRI. The present results could provide an insight into the potential roles and mechanism of lncRNAs during the early stage of reperfusion.

Introduction

Ischemic heart disease (IHD) is a leading cause of premature mortality worldwide (1,2). IHD affects ~126 million individuals globally (1,655 per 100,000), which is estimated to be 1.72% of the world's population (1). Restoration of coronary artery perfusion is currently one of the main treatment options but it can lead to myocardial ischemia-reperfusion injury (MIRI), which refers to a more serious myocardial injury caused by blood recanalization after a period of myocardial ischemia compared with that induced by vascular occlusion (3,4). MIRI is reported to increase the risk of cardiovascular disease, which imposes health, social and human burdens on societies worldwide, and thus is a public health issue (5-8). Therefore, treatment of MIRI is important for the prevention of cardiovascular disease, the end stage of cardiac dysfunction and mortality.

Previous studies have reported that the spinal cord is closely associated with the occurrence and development of MIRI (9-11). Following cardiac ischemia and reperfusion, chemical mediators such as dynorphin and suppresses substance P within the myocardium activate cardiac afferent fibres projecting from the dorsal root ganglion to the upper thoracic dorsal horn of the spinal cord. This results in the release of inflammatory factors and neuropeptides within the spinal cord (12-15), which triggers abnormal changes in gene transcription and translation within the spinal cord (16-18). Despite these recognized spinal responses, the genomic mechanisms that enable differences during these spinal processes of MIRI remain largely elusive.

It has been revealed that long non-coding (lnc)RNAs serve a key role in the processing of gene expression signals via the regulation of cell cycle distribution, stem cell differentiation and transcriptional and post-transcriptional control (19,20). Moreover, there are aberrant expression levels of spinal lncRNAs in peripheral diseases, such as pruritus (21,22), acute kidney injury (23), neuropathic pain and inflammation-related pain (24).

In the present study, the altered expression of mRNAs and lncRNAs in the thoracic (T)1-T4 spinal cord were analyzed using high-throughput RNA-sequencing (RNA-seq) between a group of rats established with MIRI and a sham group. Using microarrays, the current study identified 470 mRNAs and 126 lncRNAs that were significantly differentially expressed in rats with MIRI, and further analyzed the biologic roles of these mRNAs and lncRNAs by performing Gene Ontology (GO) and pathway analyses. Subsequently, the differentially expressed mRNAs and lncRNAs were validated using reverse transcription-quantitative (RT-q) PCR. The present results may facilitate the development of molecular-targeting therapies for MIRI.

Materials and methods

Animals

In total, 26 male Sprague Dawley rats (specific pathogen free grade; weight, 250-300 g; age, 8-10 weeks) from Hunan Slack Jingda Experimental Animal Company were used in the present study. The animals were housed at a controlled room temperature (25±0.5˚C) and relative humidity (40-60%) with a 12-h light/dark cycle and had unlimited access to food and water. The number of animals in each group was three, and each animal was used only once. All experiments were performed with the approval of the Institutional Animal Care and Use Committee of Tongji Hospital, Huazhong University of Science and Technology (IRB ID, TJ-A0804) and the National Institutes of Health Guide for the Care and Use of Laboratory Animals (25).

MIRI

Rats were randomly divided into MIRI (model, n=13) and sham (control, n=13) groups. MIRI experiments were performed according to previously published protocols (18,26-29). The rats were maintained in deep anesthetic state on a heating pad using sodium pentobarbital (50 mg/kg; intraperitoneal), which was indicated by disappearance of the foot withdrawal reflex.

In the model group, the left anterior descending coronary artery (LAD) was ligated 2-mm below the left atrial appendage for 30 min and then reperfused for 2 h, while sutures were placed without LAD ligation in control operations. The reperfused rats were considered as the animal model of MIRI. Sham-operated age-matched rats served as controls. During the experiment, the electrocardiogram (ECG) of animals was monitored using a electrocardiogram machine (model no. ECG-2303B; Guangzhou Sanrui Electronic Technology Co., Ltd.) at the following time points: Before the operation, ischemia for 0, 15 and 30 min, reperfusion for 0 min, 30 min and 2 h. After reperfusion for 2 h, 150 mg/kg sodium pentobarbital via intraperitoneal injection was used for euthanasia and the confirmation of euthanasia was decapitation. Then, the hearts were collected for 2,3,5-triphenyltetrazolium chloride (TTC) staining, hematoxylin and eosin (H&E) staining and Masson staining. At the end of reperfusion, the rats were deeply anesthetized, blood (~1 ml) samples were collected from the aorta for cardiac troponin I (cTnI) detection before euthanasia.

In the present experiment, ~20% of the animals died due to hemorrhage and arrhythmia caused by ligation of coronary artery at the early stage of reperfusion. When ventricular fibrillation and bleeding were uncontrollable, euthanasia was performed on animals as humane endpoints. Time points of 30 min for ischemia and 2 h for reperfusion were selected for this animal model is sufficient to result in significant histopathological and functional myocardial injury, which can be confirmed using the results of ECG, cTnI, TTC, H&E and Masson staining (30).

cTnI detection and myocardial tissue staining

cTnI level was determined using an Automated Blood or Urine Chemical Analyzer (Vitro 350; Ortho Clinical Diagnostics). H&E staining and Masson trichrome staining were conducted in the myocardial tissue samples in order to observe the myocardial pathology. Heart tissues were fixed in 10% formaldehyde for 24 h at room temperature and embedded with paraffin, before 4-µm thick sections were cut. After deparaffinization by washing with xylene followed by rehydration in a descending ethanol gradient, sections were immersed in hematoxylin for 5-7 min, differentiated in 1% acid alcohol for 2-5 sec and stained with 0.5% eosin for 2 min. After rinsing with distilled water for 30 sec, sections were dehydrated with an ascending ethanol gradient and were cleared in xylene. All procedures were carried out at room temperature. Using a light microscope (magnification x200; Leica DM 4000B; Leica Microsystems, Inc.), pathological changes of myocardial tissues were observed. The procedure of Masson's trichrome staining was similar to H&E staining, which was described previously (31).

The infarct size was assessed using TTC staining 2 h after reperfusion. After surgery, the hearts were removed and frozen for 20 min at -20˚C, then transversally cut into sections with a thickness of 1-2 mm. Tissue sections were incubated in 2% TTC for 10 min at 37˚C in dark conditions and then fixed in 10% formaldehyde at 4˚C overnight. Under light microscopic observation, the infarct area was a white color, and the healthy tissues had a red color. The degree of myocardial infarction was represented by the percentage of infarcted area accounting for the left ventricle.

Tissue extraction and RNA isolation

In total, three rats in the MIRI group and three from the sham group were anesthetized, and the T1-T4 spinal cord segments were quickly extracted. Total RNAs were collected from the dorsal horn of the spinal cord using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) based on the manufacturer's instructions. The RNA concentration and purity were examined using a spectrophotometer (Invitrogen; Thermo Fisher Scientific, Inc.) (32,33). Equal amounts of mRNA (1 µg) from one rat with the same treatment was mixed as one sample after these tests. A total of six samples were selected for microarray analysis.

Gene expression analysis

High-throughput lncRNA-seq was used to identify novel genes in the spinal cord that regulate cardiac function in the rat MIRI model. Briefly, total RNA was isolated from the T1-T4 of spinal cord tissues from the three MIRI- and sham-group rats, and the concentration, purity and integrity of the RNA were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc.) and checked using RNase-free 1% agarose gel electrophoresis containing GelRed® (cat. no. 41003; Biotium, Inc.). Ribosomal RNA was then removed from the total RNA. The mRNA and ncRNA were mostly retained and the strand-specific library was then constructed using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (cat. no. E7530L; New England BioLabs, Inc.) according to the manufacturer's protocols. Briefly, the mRNA was fragmented and used as a template to synthesize cDNA with random primers. The first strand cDNA was synthesized using the following progress: 25˚C for 10 min, 42˚C for 15 min, 70˚C for 15 min and final holding at 4˚C. A Second Strand Marking Master Mix was used to synthesize second strand cDNA at 16˚C for 60 min. After using a ligate adapter, uracil-N-glycosylase treatment and PCR amplification were used to construct a sequencing library. The loading concentration of DNA was 12.182 nM. The PCR thermocycling parameters were set as follows: Initial denaturation at 98˚C for 30 sec; followed by 15 cycles of 98˚C for 10 sec, 60˚C for 30 sec and 72˚C for 30 sec; 1 cycle at 72˚C for 5 min and final holding at 10˚C. The library was then sequenced by Illumina HiSeqÔ 4000 with pair ends reads of 150 bp. The data were analyzed by Gene Denovo Biotechnology Co. (https://www.genedenovo.com; Guangzhou, China). The differentially expressed mRNAs and lncRNAs were identified with |log2 fold change (FC)| and P-values as calculated with a t-test. |log2FC| >1 and P<0.05 were set as the up- and downregulated gene thresholds. Hierarchical clustering and volcano plots determined the different expression patterns of mRNAs and lncRNAs among the samples.

Bioinformatics analysis

The differentially expressed lncRNAs and mRNAs with statistical significance were identified via volcano plot filtering. The threshold used to screen RNAs with |log2FC| >1 was P<0.05. |log2FC| >1 is to screen genes with multiples of difference >2 times (34,35). Gene Ontology (GO) analysis (http://www.geneontology.org) described the molecular function, cellular component and biological process of differentially expressed transcripts. GO analysis and a Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis were applied to determine the biologic roles of these differentially expressed lncRNAs and mRNAs based on the latest KEGG data (http://www.genome.jp/kegg/).

RT-qPCR analysis for upper thoracic spinal cord

The total RNA, extracted from the upper T1-T4 segments of the spinal cord using the TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions, was used for the generation of cDNA (21,22,36-40). The primers were designed using the Primer Express 3.0 software (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the specific forward and reverse primer sequences are listed in Table I. RNA samples were quantified using a spectrophotometer (BioPhotometer; Eppendorf AG) and then synthesized to cDNA by reverse transcription using the PrimeScript™ RT reagent kit (Takara Bio, Inc.). The temperature protocol was conducted using the following protocol: 15 min at 37˚C, 5 sec at 85˚C and holding at 4˚C cDNA was quantitated via RT-qPCR using a TB green® Premix Ex Taq (cat. no. RR420A; Takara Bio, Inc.). The thermocycling conditions for PCR were as follows: Initial denaturation for 30 sec at 95˚C, followed by 40 cycles of 15 sec at 95˚C, 15 sec at 60˚C and 45 sec at 72˚C. The threshold cycle (Cq) was used to estimate the amount of target mRNA. The comparative Cq method with a formula for relative FC (2-ΔΔCq) was used to quantify the amplified transcripts (32,33,41). The relative gene expression was determined via normalization to GAPDH. Experiments were evaluated in triplicate and repeated ≥3 times.

Table I

Primer sequences for reverse transcription-quantitative PCR.

Table I

Primer sequences for reverse transcription-quantitative PCR.

A, mRNA
Primer namePrimer sequences (5'→3')
Frs3F: GAGCCAGTCATCATCACACGGAAC
 R: GAAGCCATTGGAGAAGCTGGAGAC
Zfp523F: CGCTGACTTCCTGTGAGTGTGAC
 R: ACCTTGGCTCTGGCTCTCGTC
Dnajc6F: GACAAGCCTCATGGAGCCAAGAAG
 R: GGAGAAGTTCGTGCTCACATCGG
Nedd4lF: TACGCAGTGGCACCGACCTAG
 R: GTGTGCGGCCTCCTGATTGATC
Tep1F: GGATGGATACGGAGCTGCTGAATG
 R: GGACACTGACGAAGAGGCACTTG
Myef2F: CCAGGTGGACAGCCAATTAGTGC
 R: GCCTGCCATGCTATTCATTGCTTC
Tgfbr1F: CATTGCTGGTCCAGTCTGCTTCG
 R: TGGTGAATGACAGTGCGGTTATGG
Fgf12F: TGCTGTGCGACTGTGAGATTGC
 R: CGTGCGGCTCGTTGTACTCG
Mef2cF: TGCTGTGCGACTGTGAGATTGC
 R: CGTGCGGCTCGTTGTACTCG
Tfdp1F: AAGAAGATGCCGCCGAGTTGTG
 R: CGCTGGCTTCACGACACATCC
GAPDHF: CGCTAACATCAAATGGGGTG
 R: TTGCTGACAATCTTGAGGGAG
B, Long non-coding RNA
Primer namePrimer sequences (5'→3')
ENSRNOT00000080713F: CACTTCCGCCCACATCACA
 R: AAACCCCTCAGTCTCAAAACCT
ENSRNOT00000090564F: GACCACGCATCTACA
 R: GCGAACTGAGGTGAGAAGGGA
ENSRNOT00000082588F: TGCTTCACTTCTCCCACTCTTC
 R: AGGCCTTCCATCAAACAAATC
ENSRNOT00000091080F: GGTGGTGGACAAGGATGAG
 R: TGGACGGAGGTTGGGGAGAT
ENSRNOT00000091570F: CAAGAAATCCAATACGACCC
 R: TCCCCGTGGAAATAGGTGTAA
ENSRNOT00000087777F: GGAAGAGGGACGTTGGGTA
 R: AGCCAGGTCCAAGTCACAGG
ENSRNOT00000082061F: CATTTCTTCCTCCCTTCCCTT
 R: ACGGTTCTCCAATCGCACA
ENSRNOT00000091108F: CCGTGGAATATGGGAAGGAC
 R: CAAGATGGAAAGGCAACGAG
ENSRNOT00000087028F: ACGGGGTGAAAGGGAAGA
 R: TGCTGGTTTGTTAAGGGGATG
ENSRNOT00000086475F: CAGTTTGGTGTCTGTTTCCC
 R: TGCTTCTTCGAGCCGGTATT

[i] F, forward; R, reverse.

Statistical analysis

Data are presented as the mean ± SEM, and were analyzed using GraphPad Prism software v5.0 (GraphPad Software, Inc.). RT-qPCR parameters were analyzed using unpaired t-test for repeated measures. P<0.05 was considered to indicate a statistically significant difference.

Results

Characteristics of ischemic myocardial tissues

Serum cTnI levels in the model group were significantly increased compared with the control group (Fig. 1B). In addition, the results of TTC staining (Fig. 1A), H&E staining and Masson staining (Fig. 1C) all confirmed the successful establishment of the rat MIRI model. In the control group, the myocardium had a physiological myocardial architecture, and the myocardial fibres and myocardial cells were complete and arranged in an orderly manner. In the model group, structural disorder of the cardiac tissue was observed, with different degrees of vacuolar degeneration and necrosis, as well as loose stroma. Moreover, the number of cardiomyocyte fibres were markedly increased after MIRI.

Figure 1

Evaluation of MIRI. (A) Representative images of 2,3,5-triphenyltetrazolium chloride staining (left) and quantitative analysis of infarct size (right) in hearts subjected to Sham and MIRI surgery. Scale bar, 2 mm. (B) Serum cTnI concentrations in rats with Sham or MIRI surgery. Data are presented as the mean ± SEM, n=4 rats per group. (C) Representative images of H&E staining and Masson trichrome staining from rat left ventricles 2 h after MIRI and in sham group. Scale bar, 100 µm. *P<0.05 vs. sham group. H&E, hematoxylin and eosin; MIRI, myocardial ischemia-reperfusion injury.

mRNAs and lncRNAs expression profiles in MIRI

The patterns of the mRNA and lncRNA expressions in the T1-T4 spinal cord at 2 h after MIRI or sham operations were then examined using microarray. From the volcano map and hierarchical clustering analysis results, a landscape of the expression characteristics of the mRNAs and lncRNAs was obtained. The volcano plots demonstrated that large numbers of the mRNAs and lncRNAs were differentially expressed between the two groups (Fig. 2A and C). The hierarchical cluster analysis of the lncRNAs and mRNAs indicated that the samples of two groups were clustered together and the signal intensity was consistent in the two groups (Fig. 2B and D). Furthermore, these differential alterations of the mRNAs and lncRNAs in the T1-T4 spinal cord were associated with MIRI.

Figure 2

MIRI results in expression profile changes of mRNA and lncRNA in the T1-T4 spinal cord. (A) Volcano plot comparing global mRNA gene expression profiles in the spinal cord between the two groups. (B) Hierarchical cluster analysis of the mRNAs. (C) Volcano plot comparing global lncRNA gene expression profiles in the spinal cord between the two groups. (D) Hierarchical cluster analysis of the lncRNAs. The cluster analysis demonstrated that the three MIRI or three sham samples were clustered together. Upregulated, downregulated and not statistically different genes were colored in red, green and black, respectively. MIRI, myocardial ischemia-reperfusion injury; lncRNA, long non-coding RNA.

Differentially expressed mRNAs and lncRNAs

To further analyze the differentially expressed mRNAs and lncRNAs, a significance analysis of the microarrays method with the criteria P<0.05 and FC >1 was performed.

In the differentially expressed mRNAs, there were 470 genes that exhibited an FC that was >1. The number of downregulated mRNAs was 239, whereas the number of upregulated mRNAs was 231. The most upregulated mRNAs were Tfdp1, Map2, Cep19, Aurkaip1, Tpbg, Myef2, Ap2m1, Tgfbr1, Fgf12 and Mef2c. The most downregulated mRNAs were Frs3, Zfp523, Tpm4, Apold1, Ctnnb1, Lss, Psen2, Dnajc6, Nedd4l and Tep1. Detailed information regarding the differentially expressed mRNAs is listed in Table II.

Table II

Details of the top 10 downregulated and upregulated mRNAs in the T1-T4 spinal cord between MIRI and sham groups.

Table II

Details of the top 10 downregulated and upregulated mRNAs in the T1-T4 spinal cord between MIRI and sham groups.

A, Downregulation
IDLog2FC (MIRI/sham)SymbolP-valueDescription
ENSRNOT00000019404-12.0846Frs3 4.50x10-20Fibroblast growth factor receptor substrate 3
ENSRNOT00000000595-11.2761Zfp523 1.51x10-14Zinc finger protein 523
ENSRNOT00000089056-10.8893Tpm40.001717Tropomyosin 4
ENSRNOT00000010289-10.5635Apold1 1.1610-9Apolipoprotein L domain containing 1
ENSRNOT00000079085-10.1716Ctnnb1 8.32x10-5Catenin beta 1
ENSRNOT00000081903-9.81911Lss0.013918Lanosterol synthase (2,3-oxido squalene-lanos terol cyclase)
ENSRNOT00000091715-9.75933Psen20.000372Presenilin 2
ENSRNOT00000086539-9.30682Dnajc6 5.25x10-5DnaJ heat shock protein family (Hsp40) member C6
ENSRNOT00000083363-9.15482Nedd4l0.005334Neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase
ENSRNOT00000088981-8.70275Tep10.001598Telomerase associated protein 1
B, Upregulation
IDLog2FC (MIRI/sham)SymbolP-valueDescription
ENSRNOT0000008719212.22179Tfdp1 6.42x10-8Transcription factor Dp-1
ENSRNOT0000004576611.86754Map2 5.07x10-5 Microtubule-associated protein 2
ENSRNOT0000003779511.22882Cep19 2.22x10-5Centrosomal protein 19
ENSRNOT0000002553111.16113Aurkaip10.000724Aurora kinase A interacting protein 1
ENSRNOT0000001432610.76763Tpbg0.000962Trophoblast glycoprotein
ENSRNOT0000008153310.69407Myef2 7.98x10-9Myelin expression factor 2
ENSRNOT0000008882110.64386Ap2m10.004070Adaptor-related protein complex 2, mu 1 subunit
ENSRNOT000000810909.813781Tgfbr10.005577Transforming growth factor, beta receptor 1
ENSRNOT000000715869.781360Fgf120.004286Fibroblast growth factor 12
ENSRNOT000000762308.748193Mef2c 1.98x10-5Myocyte enhancer factor 2C

[i] FC, fold change; T, thoracic; MIRI, Myocardial ischemia-reperfusion injury.

The results identified that 126 lncRNAs, which included 41 upregulated and 85 downregulated lncRNAs, were significantly altered in the MIRI group compared with the sham group. The most upregulated lncRNAs were ENSRNOT00000086475, ENSRNOT00000087028, ENSRNOT00000091108, ENSRNOT00000031815, ENSRNOT00000082061 and ENSRNOT00000087777. The most downregulated lncRNAs were ENSRNOT00000080713, ENSRNOT00000090564, ENSRNOT00000082588, ENSRNOT00000091080, ENSRNOT00000091570, ENSRNOT00000077319, ENSRNOT00000077509, ENSRNOT00000089288, ENSRNOT00000083187 and ENSRNOT00000091435. Additional information regarding the differentially expressed lncRNAs is presented in Table III.

Table III

Details of the downregulated and upregulated long non-coding RNAs in the T1-T4 spinal cord between MIRI and sham group.

Table III

Details of the downregulated and upregulated long non-coding RNAs in the T1-T4 spinal cord between MIRI and sham group.

A, Downregulation
IDLog2FC (MIRI/sham)P-valueSymbol
ENSRNOT00000080713-9.987260.000442LOC102550026
ENSRNOT00000090564-8.103290.040576AABR07050135.1
ENSRNOT00000082588-7.49185 4.01x10-5AABR07000385.2
ENSRNOT00000091080-6.9542 1.14x10-6AABR07044980.1
ENSRNOT00000091570-6.714250.025341AABR07071198.1
ENSRNOT00000077319-6.228820.005841AABR07071383.1
ENSRNOT00000077509-5.321930.048185AABR07027371.1
ENSRNOT00000089288-4.169930.01174AABR07044001.4
ENSRNOT00000083187-3.523560.024012AABR07060560.4
ENSRNOT00000091435-3.380820.016282AABR07042668.1
B, Upregulation
IDLog2FC (MIRI/sham)P-valueSymbol
ENSRNOT000000864758.7976620.013366AABR07070801.2
ENSRNOT000000870286.1292830.027308LOC103692514
ENSRNOT000000911084.0588940.020796AABR07006724.1
ENSRNOT000000318153.2976810.041965Rn50_X_0744.6
ENSRNOT000000820612.9668330.034871AABR07071395.1
ENSRNOT000000877772.9175380.024331AABR07016845.1

[i] FC, fold change; T, thoracic; MIRI, Myocardial ischemia-reperfusion injury.

Functional prediction of differentially expressed mRNAs in MIRI

To investigate the spinal molecular mechanisms in MIRI, GO and KEGG pathway analyses of the differentially expressed mRNAs in MIRI vs. sham were performed.

To identify major biochemical metabolic pathways and signal transduction pathways for differential gene enrichment, KEGG pathway analysis (Fig. 3) was conducted. Using the KEGG pathway analysis, it was found that differential genes were mainly enriched in the ‘PI3K/Akt signaling pathway’, ‘protein digestion and uptake’, ‘p53 signaling pathway’ and ‘neuroactive ligand-dependent body interaction’ (Fig. 3; Table IV).

Figure 3

Heatmap of Kyoto Encyclopedia of Genes and Genomes pathway analysis. Size of the bubble represents the number of enriched genes, and the color of the bubble from red to green indicates a gradual increase in the P-value. ECM, extracellular matrix; TRP, transient receptor potential.

Table IV

Differential gene enriched in Kyoto Encyclopedia of Genes and Genomes pathway.

Table IV

Differential gene enriched in Kyoto Encyclopedia of Genes and Genomes pathway.

Pathway IDPathwayGene numberP-value
ko04151PI3K/Akt signaling pathway200.00039
ko04974Protein digestion and absorption80.001448
ko04115p53 signaling pathway70.001795
ko04510Focal adhesion130.005058
ko04080Neuroactive ligand-receptor interaction160.005635
ko04512ECM-receptor interaction70.008425
ko00534Glycosaminoglycan biosynthesis-heparan sulfate/heparin30.019966
ko04960 Aldosterone-regulated sodium reabsorption40.023467
ko04015Rap1 signaling pathway120.027612
ko04721Synaptic vesicle cycle50.030579
ko00600Sphingolipid metabolism40.036733
ko04020Calcium signaling pathway110.03857

[i] ECM, extracellular matrix.

The differential genes associated with cellular components were mainly enriched in the ‘extracellular fraction’, ‘cytoplasm’, ‘microtubule cytoskeleton’, ‘cytoskeleton’ and ‘intracellular’, whereas the genes participating in biological processes were mainly enriched in ‘cell signal transduction’ (Fig. 4; Table V).

Figure 4

Functional analysis of differential lncRNAs. (A) Gene Ontology analysis heat map of co-expressed genes of differential lncRNAs. (B) Kyoto Encyclopedia of Genes and Genomes pathway analysis heat map of co-expressed genes of differential lncRNAs. lncRNA, long non-coding RNA; PPAR, peroxisome proliferator activated receptor; NOD, nucleotide-binding oligomerization domain-containing protein.

Table V

Functional classification of differential genes via GO analysis.

Table V

Functional classification of differential genes via GO analysis.

A, Cellular component
GO IDDescriptionGene numberP-value
GO:0044424Intracellular part480.013126
GO:0005737Cytoplasm300.025862
GO:0015630Microtubule cytoskeleton30.026874
GO:0005856Cytoskeleton70.041896
GO:0005622Intracellular630.044992
B, Biological process
GO IDDescriptionGene numberP-value
GO:0030198Extracellular matrix organization30.010728
GO:0043062Extracellular structure organization30.010729
GO:0007267Cell-cell signaling40.028507
GO:0032196Transposition10.035381

[i] GO, Gene Ontology.

Gene co-expression networks were presented to identify interactions between lncRNAs and their co-expression genes (Fig. 5). The co-expressed network showed that 10 highly-dysregulated lncRNAs were highly co-expressed with 277 target genes, of which 10 were positively correlated (colored with yellow) and 267 were negatively correlated (colored with blue). ENSRNOT00000080713 was at the core of the lncRNA-mRNA co-expression network and had a co-expression relationship with many mRNAs.

Figure 5

Sub-network of 10 highly dysregulated lncRNAs co-expressed with mRNAs. Genes colored in red are upregulated lncRNAs and those in green are downregulated lncRNAs. Upregulated mRNAs are colored with yellow and downregulated mRNAs are colored with blue. lncRNA, long non-coding RNA.

RT-qPCR confirmation of mRNA and lncRNA expression from microarray

To confirm the reliability of the microarray data and analyze the temporal alterations in mRNA and lncRNA expression after MIRI, the lncRNAs, ENSRNOT00000080713, ENSRNOT00000090564, ENSRNOT00000082588, ENSRNOT00000091080, ENSRNOT00000091570, ENSRNOT00000087777, ENSRNOT00000082061, ENSRNOT00000091108, ENSRNOT00000087028 and ENSRNOT00000086475, and the mRNAs, fibroblast growth factor receptor substrate 3 (Frs3), zinc finger protein 76 (Zfp523), DnaJ heat shock protein family (Hsp40) member C6 (Dnajc6), NEDD4 like E3 ubiquitin protein ligase (Nedd4l), telomerase associated protein 1 (Tep1), myelin expression factor 2 (Myef2), transforming growth factor β receptor 1 (Tgfbr1), fibroblast growth factor 12 (Fgf12), myocyte enhancer factor 2C (Mef2c) and transcription factor Dp-1 (Tfdp1), were randomly selected and detected via RT-qPCR.

The results demonstrated that expression of lncRNAs ENSRNOT00000080713, ENSRNOT00000090564, ENSRNOT00000082588, ENSRNOT00000091080 and ENSRNOT00000091570 were markedly decreased in MIRI group compared with those in the control group, whilst ENSRNOT00000087777, ENSRNOT00000082061, ENSRNOT00000091108, ENSRNOT00000087028 and ENSRNOT00000086475 were markedly increased. In addition, the mRNAs Frs3, Zfp523, Dnajc6, Nedd4l and Tep1 were markedly decreased in the MIRI group compared with those in the control group, but Myef2, Tgfbr1, Fgf12, Mef2c and Tfdp1 were markedly increased. These RT-qPCR results were consistent with the results from the transcriptome sequencing (Fig. 6), which further supported the reliability of the microarray data.

Figure 6

RT-qPCR confirmation of mRNA and lncRNA expression from the microarray. (A) mRNA expression levels in spinal cord tissue of MIRI rats. (B) lncRNA expression levels in spinal cord tissue of MIRI rats. The expression of mRNAs and lncRNAs in the spinal cord of rats with MIRI was consistent with the results of transcriptome sequencing, indicating the reliability of the microarray data. lncRNA, long non-coding RNA; Frs3, fibroblast growth factor receptor substrate 3; Zfp523, zinc finger protein 76; Dnajc6, DnaJ heat shock protein family (Hsp40) member C6; Nedd4l, NEDD4 like E3 ubiquitin protein ligase; Tep1, telomerase associated protein 1; Myef2, myelin expression factor 2; Tgfbr1, transforming growth factor β receptor 1; Fgf12, fibroblast growth factor 12; Mef2c, myocyte enhancer factor 2C; Tfdp1, transcription factor Dp-1; RT-qPCR, reverse transcription-quantitative PCR; seq, sequencing; MIRI, myocardial ischemia-reperfusion injury.

RT-qPCR validation of mRNAs and lncRNAs in T1-T4 spinal cord

The results of RT-qPCR demonstrated that the mRNA expression levels of Frs3, Nedd4l and Tep1 were significantly downregulated in the model group, while the expression of mRNA Myef2 was significantly upregulated in the model group. The expression levels of mRNA Zfp523, Dnajc6 and Myef2 were not significantly different between the two groups (Fig. 7). The expression levels of lncRNA ENSRNOT00000080713, ENSRNOT00000090564, ENSRNOT00000082588 and ENSRNOT00000091570 were significantly downregulated in the model group, but the expression levels of lncRNA ENSRNOT00000087777, ENSRNOT00000082061, ENSRNOT00000087028 and ENSRNOT00000086475 were significantly upregulated in the model group. However, the expression levels of lncRNA ENSRNOT00000091080 and ENSRNOT00000091108 were not significantly different between the two groups (Fig. 8).

Figure 7

Reverse transcription-quantitative PCR validation of the mRNAs in the T1-T4 spinal cord. The expression levels of mRNA Frs3, Nedd4l and Tep1 were significantly downregulated in model group, whereas the expression of mRNA Myef2 was significantly upregulated. The expression levels of mRNA Zfp523, Dnajc6 and Myef2 were not statistically different between the two groups. Data are presented as the mean ± SEM (n=6). *P<0.05 vs. control. Frs3, fibroblast growth factor receptor substrate 3; Zfp523, zinc finger protein 76; Dnajc6, DnaJ heat shock protein family (Hsp40) member C6; Nedd4l, NEDD4 like E3 ubiquitin protein ligase; Tep1, telomerase associated protein 1; Myef2, myelin expression factor 2; Tgfbr1, transforming growth factor β receptor 1; Fgf12, fibroblast growth factor 12; Mef2c, myocyte enhancer factor 2C; Tfdp1, transcription factor Dp-1; MIRI, myocardial ischemia-reperfusion injury.

Figure 8

Reverse transcription-quantitative PCR validation of 10 lncRNAs in the T1-T4 spinal cord. The expression levels of lncRNA ENSRNOT00000080713, ENSRNOT00000090564, ENSRNOT00000082588 and ENSRNOT00000091570 were significantly downregulated in model group, whereas the expression levels of lncRNA ENSRNOT00000087777, ENSRNOT00000082061, ENSRNOT00000087028 and ENSRNOT00000086475 were significantly upregulated. The expression levels of lncRNA ENSRNOT00000091080 and ENSRNOT00000091108 were not statistically different between the two groups. Data are presented as the mean ± SEM (n=6). *P<0.05, **P<0.01,***P<0.001 vs. control. MIRI, myocardial ischemia-reperfusion injury; lncRNA, long non-coding RNA.

Discussion

MIRI causes nociceptive chemical and electrical signals that affect dorsal root ganglia and the upper thoracic spinal cord (42). Previous studies have reported that spinal gene expression is associated with in the development of MIRI (9,27) and have identified the molecular mechanisms during MIRI (26,27,42); however, the impact of the spinal process during MIRI requires further investigation.

Emerging evidence indicates that the inflammatory and immune responses that occur in the spinal cord are vital contributors to the progression of MIRI (9,13,14,16). Moreover, autonomic dysregulation following MIRI is an important pathogenic event (43-47). Interactions between the heart and spinal autonomic nervous system serve a role in both the development and maintenance of MIRI, and are also crucial in myocardial ischemia-induced angina pectoris (48-52). Based on the importance of the spinal autonomic nervous system in the pathophysiology of MIRI, there has been a notable effort in this field to study changes in the genomics, transcriptomics, proteomics and metabolomics in the spinal cord after MIRI, which could facilitate both existing interventions and novel therapies directed at cardiac-autonomic targets (53).

In the present study, the differentially expressed lncRNAs in the T1-T4 spinal cord during MIRI, along with their characteristics and possible relationships with mRNAs, were identified. A total of 126 lncRNAs were observed in the T1-T4 spinal cord of the MIRI model rats. Among these lncRNAs, 41 lncRNAs were upregulated, and 85 lncRNAs were downregulated at 2 h after MIRI. Moreover, RT-qPCR was used to validate the microarray analysis results, for which the conclusion was consistent. Based on these findings, it was suggested that the aforementioned lncRNAs may serve a role in MIRI pathology. Furthermore, the present research contributes to understanding the molecular mechanism of MIRI.

To further investigate the roles of these differentially expressed lncRNAs in the development of MIRI, GO and KEGG pathway analyses were performed. Based on the GO and KEGG enrichment analyses of these lncRNAs, the results suggested that the significantly enriched biologic processes and molecular functions of the upregulated genes after MIRI were associated with gene sets termed as follows: ‘PI3K/Akt signaling pathway’, ‘protein digestion and absorption’, ‘p53 signaling pathway’ and ‘neuroactive ligand-dependent body interaction’.

The PI3K/Akt signaling pathway is associated with MIRI (54). p53 is a tumor suppressor, which exerts an important role in the process of apoptosis and is associated with the occurrence and development of cardiovascular disease (55-57). Previous studies have shown that apoptosis is a typical manifestation and primary pathological mechanism of MIRI (58). The loss of cardiomyocytes caused by apoptosis is an important reason for the development of various heart diseases (59). Preventing the process of apoptosis can prevent myocardial damage caused by reperfusion, thus slowing or preventing the occurrence of heart failure and even mortality (60).

The present study has several limitations. For example, the reperfusion time for tissue collection lasted only 2 h. Therefore, it remains unknown if the expression of lncRNA has the same regulation for a longer period after ischemia. Moreover, a functional analysis of differentially expressed genes was performed without further verification. LncRNAs are poorly conserved and only part of the sequence is conserved by multiple species (61,62). Previous studies have reported that there are 481 segments longer >200 bp (range, 200-779 bp) that are conserved between orthologous regions of the mouse, rat and human genomes (63), and these conserved lncRNAs can provide an insight into their key functional roles (64,65). As a result, further research is required to examine the functions of lncRNAs and the conservation of differentially expressed lncRNAs in rats and humans, which will identify their predicted targets and provide a detailed expression profile of lncRNA.

In conclusion, the present study demonstrated that lncRNA transcripts of the upper thoracic spinal cord were differentially expressed after MIRI. These spinal lncRNAs may regulate the expression of MIRI-related proteins and genes, and contribute to the pathogenesis of MIRI. Future investigations of these spinal lncRNAs found in the present study will mainly focus on their functions and their relationship with MIRI. Nonetheless, the present study may provide important evidence for further basic research and clinical investigations on improved therapeutic interventions of MIRI.

Acknowledgements

Not applicable.

Funding

Funding: This work was supported by grants from National Natural Science Foundation of P.R. China (grant nos. 82070302, 81873467 and 81770283), the Clinical Medical Research Center of Peritoneal Cancer of Wuhan (grant no. 2015060911020462), Research Foundation of Health and Family Planning Commission of Hubei Province (grant nos. WJ2015MA010 and WJ2017M249), Natural Science Foundation of Hubei Province (grant no. 2015CFA027) and the National Natural Science Foundation of Hubei Province (grant no. 2016CFB625).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

ZXL and YJL performed the surgical procedures and PCR experiments. QW and ZGH participated in the experimental design. MHF and ZGH analyzed the data. HBX and MHF contributed to the study concept and design and supervised the whole project. All authors contributed to the final manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Institutional Ethical Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology (approval no. TJ-A20150804).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Khan MA, Hashim MJ, Mustafa H, Baniyas MY, Al Suwaidi SK, AlKatheeri R, Alblooshi FM, Almatrooshi ME, Alzaabi ME, Al Darmaki RS and Lootah SN: Global epidemiology of ischemic heart disease: Results from the global burden of disease study. Cureus. 12(e9349)2020.PubMed/NCBI View Article : Google Scholar

2 

Roth GA, Johnson C, Abajobir A, Abd-Allah F, Abera SF, Abyu G, Ahmed M, Aksut B, Alam T, Alam K, et al: Global, regional, and national burden of cardiovascular diseases for 10 causes, 1990 to 2015. J Am Coll Cardiol. 70:1–25. 2017.PubMed/NCBI View Article : Google Scholar

3 

Yellon DM and Hausenloy DJ: Myocardial reperfusion injury. N Engl J Med. 357:1121–1135. 2007.PubMed/NCBI View Article : Google Scholar

4 

Grace PA: Ischemia-reperfusion injury. Br J Surg. 81:637–647. 1994.PubMed/NCBI View Article : Google Scholar

5 

Cheng YF, Chang YT, Chen WH, Shih HC, Chen YH, Shyu BC and Chen CC: Cardioprotection induced in a mouse model of neuropathic pain via anterior nucleus of paraventricular thalamus. Nat Commun. 8(826)2017.PubMed/NCBI View Article : Google Scholar

6 

Xu A, Song Z, Peng Y and Xiang H: Change of mitochondrial function in the early stage after cardiac ischemia-reperfusion injury in mice. Int J Clin Exp Med. 9:2549–2554. 2016.

7 

De Hert S and Moerman A: Myocardial injury and protection related to cardiopulmonary bypass. Best Pract Res Clin Anaesthesiol. 29:137–149. 2015.PubMed/NCBI View Article : Google Scholar

8 

Murphy E and Steenbergen C: Mechanisms underlying acute protection from cardiac ischemia-reperfusion injury. Physiol Rev. 88:581–609. 2008.PubMed/NCBI View Article : Google Scholar

9 

Saddic LA, Howard-Quijano K, Kipke J, Kubo Y, Dale EA, Hoover D, Shivkumar K, Eghbali M and Mahajan A: Progression of myocardial ischemia leads to unique changes in immediate-early gene expression in the spinal cord dorsal horn. Am J Physiol Heart Circ Physiol. 315:H1592–H1601. 2018.PubMed/NCBI View Article : Google Scholar

10 

Waldron NH, Fudim M, Mathew JP and Piccini JP: Neuromodulation for the treatment of heart rhythm disorders. JACC Basic Transl Sci. 4:546–562. 2019.PubMed/NCBI View Article : Google Scholar

11 

Shen MJ and Zipes DP: Role of the autonomic nervous system in modulating cardiac arrhythmias. Circ Res. 114:1004–1021. 2014.PubMed/NCBI View Article : Google Scholar

12 

Hua F, Ardell JL and Williams CA: Left vagal stimulation induces dynorphin release and suppresses substance P release from the rat thoracic spinal cord during cardiac ischemia. Am J Physiol Regul Integr Comp Physiol. 287:R1468–R1477. 2004.PubMed/NCBI View Article : Google Scholar

13 

Steagall RJ, Sipe AL, Williams CA, Joyner WL and Singh K: Substance p release in response to cardiac ischemia from rat thoracic spinal dorsal horn is mediated by trpv1. Neuroscience. 214:106–119. 2012.PubMed/NCBI View Article : Google Scholar

14 

Ding X, Ardell JL, Hua F, McAuley RJ, Sutherly K, Daniel JJ and Williams CA: Modulation of cardiac ischemia-sensitive afferent neuron signaling by preemptive C2 spinal cord stimulation: Effect on substance P release from rat spinal cord. Am J Physiol Regul Integr Comp Physiol. 294:R93–R101. 2008.PubMed/NCBI View Article : Google Scholar

15 

Gao C, Howard-Quijano K, Rau C, Takamiya T, Song Y, Shivkumar K, Wang Y and Mahajan A: Inflammatory and apoptotic remodeling in autonomic nervous system following myocardial infarction. PLoS One. 12(e0177750)2017.PubMed/NCBI View Article : Google Scholar

16 

Niu YL, Guo Z and Zhou RH: Up-Regulation of TNF-alpha in neurons of dorsal root ganglia and spinal cord during coronary artery occlusion in rats. Cytokine. 47:23–29. 2009.PubMed/NCBI View Article : Google Scholar

17 

Guo Z, Niu YL, Zhang JW and Yao TP: Coronary artery occlusion alters expression of substance P and its mRNA in spinal dorsal horn in rats. Neuroscience. 145:669–675. 2007.PubMed/NCBI View Article : Google Scholar

18 

Wang Q, He ZG, Li ZX, Li SY, Chen YL, Feng MH, Hong QX and Xiang HB: Bioinformatics analysis of gene expression profile data to screen key genes involved in cardiac ischemia-reperfusion injury. Int J Clin Exp Med. 11:4955–4966. 2018.

19 

Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL and Pachter L: Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 7:562–578. 2012.PubMed/NCBI View Article : Google Scholar

20 

Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ and Pachter L: Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 28:U511–U174. 2010.PubMed/NCBI View Article : Google Scholar

21 

Chen M, Li ZX, Wang Q and Xiang HB: Altered expression of differential genes in thoracic spinal cord involved in experimental cholestatic itch mouse model. Curr Med Sci. 38:679–683. 2018.PubMed/NCBI View Article : Google Scholar

22 

Wang Q, Li ZX, Liu BW, He ZG, Liu C, Chen M, Liu SG, Wu WZ and Xiang HB: Altered expression of differential gene and lncRNA in the lower thoracic spinal cord on different time courses of experimental obstructive jaundice model accompanied with altered peripheral nociception in rats. Oncotarget. 8:106098–106112. 2017.PubMed/NCBI View Article : Google Scholar

23 

Liu QQ, Liu H, He ZG, Zhang SJ, Liu BW, Wang L, Qiu WH, Xu Q, Xiang HB and Lv YM: Differential gene and lncRNA expression in the lower thoracic spinal cord following ischemia/reperfusion-induced acute kidney injury in rats. Oncotarget. 8:53465–53481. 2017.PubMed/NCBI View Article : Google Scholar

24 

Wang QL, Ai HZ, Liu JL, Xu M, Zhou Z, Qian C, Xie Y and Yan J: Characterization of novel lnc RNAs in the spinal cord of rats with lumbar disc herniation. J Pain Res. 12:501–512. 2019.PubMed/NCBI View Article : Google Scholar

25 

National Research Council (US) Institute for Laboratory Animal Research. In: Guide for the Care and Use of Laboratory Animals. National Academies Press (US), Washington, DC, 1996.

26 

Wang Q, Li ZX, Li YJ, Manyande A, Li SY, Feng MH, Wu DZ and Xiang HB: Alterations in amino acid levels and metabolite ratio of spinal cord in rat with myocardial ischemia-reperfusion injury by proton magnetic resonance spectroscopy. Am J Transl Res. 11:3101–3108. 2019.PubMed/NCBI

27 

Wang Q, Li ZX, Li YJ, He ZG, Chen YL, Feng MH, Li SY, Wu DZ and Xiang HB: Identification of lncRNA and mRNA expression profiles in rat spinal cords at various timepoints following cardiac ischemia/reperfusion. Int J Mol Med. 43:2361–2375. 2019.PubMed/NCBI View Article : Google Scholar

28 

Pan XC, Li ZX, Wu DZ, Li SY, Xiang HB and Song YT: Mapping changes of whole brain blood flow in rats with myocardial ischemia/reperfusion injury assessed by positron emission tomography. Curr Med Sci. 39:653–657. 2019.PubMed/NCBI View Article : Google Scholar

29 

Li SY, Li ZX, He ZG, Wang Q, Li YJ, Yang Q, Wu DZ, Zeng HL and Xiang HB: Quantitative proteomics reveal the alterations in the spinal cord after myocardial ischemia-reperfusion injury in rats. Int J Mol Med. 43:1877–1887. 2019.PubMed/NCBI View Article : Google Scholar

30 

Xu Z, Alloush J, Beck E and Weisleder N: A murine model of myocardial ischemia-reperfusion injury through ligation of the left anterior descending artery. J Vis Exp. 10(51329)2014.PubMed/NCBI View Article : Google Scholar

31 

Liu S, Yang Y, Song YQ, Geng J and Chen QL: Protective effects of N(2)LalanylLglutamine mediated by the JAK2/STAT3 signaling pathway on myocardial ischemia reperfusion. Mol Med Rep. 17:5102–5108. 2018.PubMed/NCBI View Article : Google Scholar

32 

Liu BW, Li ZX, He ZG, Wang Q, Liu C, Zhang XW, Yang H and Xiang HB: Altered expression of itch-related mediators in the lower cervical spinal cord in mouse models of two types of chronic itch. Int J Mol Med. 44:835–846. 2019.PubMed/NCBI View Article : Google Scholar

33 

Liu QQ, Liu H, He ZG, Zhang SJ, Liu BW, Wang L, Qiu WH, Xu Q, Xiang HB and Lv YM: Differential gene and lncRNA expression in the lower thoracic spinal cord following ischemia/reperfusion-induced acute kidney injury in rats. Oncotarget. 8:53465–53481. 2017.PubMed/NCBI View Article : Google Scholar

34 

Pan N, Bhatti MZ, Zhang H, Ni B, Fan X and Chen J: The encystment-related micrornas and its regulation molecular mechanism in pseudourostyla cristata revealed by high throughput small RNA sequencing. Int J Mol Sci. 21(2309)2020.PubMed/NCBI View Article : Google Scholar

35 

Sun H, Wang J, Que J, Peng Y, Yu Y, Wang L, Ye H, Huang K, Xue Y, Zhou Y and Ji K: RNA sequencing revealing the role of AMP-activated protein kinase signaling in mice myocardial ischemia reperfusion injury. Gene. 703:91–101. 2019.PubMed/NCBI View Article : Google Scholar

36 

Ke C, Gao F, Tian X, Li C, Shi D, He W and Tian Y: Slit2/Robo1 mediation of synaptic plasticity contributes to bone cancer pain. Mol Neurobiol. 54:295–307. 2017.PubMed/NCBI View Article : Google Scholar

37 

Liu BW, Li ZX, He ZG, Liu C, Xiong J and Xiang HB: Altered expression of target genes of spinal cord in different itch models compared with capsaicin assessed by RT-qPCR validation. Oncotarget. 8:74423–74433. 2017.PubMed/NCBI View Article : Google Scholar

38 

Fu Q, Shi D, Zhou Y, Zheng H, Xiang H, Tian X, Gao F, Manyande A, Cao F, Tian Y and Ye D: MHC-I promotes apoptosis of GABAergic interneurons in the spinal dorsal horn and contributes to cancer induced bone pain. Exp Neurol. 286:12–20. 2016.PubMed/NCBI View Article : Google Scholar

39 

Guan XH, Fu QC, Shi D, Bu HL, Song ZP, Xiong BR, Shu B, Xiang HB, Xu B, Manyande A, et al: Activation of spinal chemokine receptor CXCR3 mediates bone cancer pain through an Akt-ERK crosstalk pathway in rats. Exp Neurol. 263:39–49. 2015.PubMed/NCBI View Article : Google Scholar

40 

Xu B, Guan XH, Yu JX, Lv J, Zhang HX, Fu QC, Xiang HB, Bu HL, Shi D, Shu B, et al: Activation of spinal phosphatidylinositol 3-kinase/protein kinase B mediates pain behavior induced by plantar incision in mice. Exp Neurol. 255:71–82. 2014.PubMed/NCBI View Article : Google Scholar

41 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

42 

Huang C, Wang J, Wang N, Du F, Xiong W, Qian J, Zhong K, Cai A, Xu S, Huang J, et al: Effect of myocardial ischemic preconditioning on ischemia-reperfusion stimulation-induced activation in rat thoracic spinal cord with functional MRI. Int J Cardiol. 285:59–64. 2019.PubMed/NCBI View Article : Google Scholar

43 

Rajendran PS, Nakamura K, Ajijola OA, Vaseghi M, Armour JA, Ardell JL and Shivkumar K: Myocardial infarction induces structural and functional remodelling of the intrinsic cardiac nervous system. J Physiol. 594:321–341. 2016.PubMed/NCBI View Article : Google Scholar

44 

Huang WA, Boyle NG and Vaseghi M: Cardiac innervation and the autonomic nervous system in sudden cardiac death. Card Electrophysiol Clin. 9:665–679. 2017.PubMed/NCBI View Article : Google Scholar

45 

Dae MW, Lee RJ, Ursell PC, Chin MC, Stillson CA and Moise NS: Heterogeneous sympathetic innervation in German shepherd dogs with inherited ventricular arrhythmia and sudden cardiac death. Circulation. 96:1337–1342. 1997.PubMed/NCBI View Article : Google Scholar

46 

Stramba-Badiale M, Lazzarotti M and Schwartz PJ: Development of cardiac innervation, ventricular fibrillation, and sudden infant death syndrome. Am J Physiol. 263:H1514–H1522. 1992.PubMed/NCBI View Article : Google Scholar

47 

Schwartz PJ: Cardiac sympathetic innervation and the prevention of sudden death. Cardiologia. 35:51–54. 1990.PubMed/NCBI

48 

Scalercio L, Vitter J and Elliott CE: Placement of a continuous stellate ganglion block for treatment of refractory ventricular fibrillation in the setting of known prinzmetal angina during pregnancy: A case report. A A Pract. 12:106–108. 2019.PubMed/NCBI View Article : Google Scholar

49 

Imran TF, Malapero R, Qavi AH, Hasan Z, de la Torre B, Patel YR, Yong RJ, Djousse L, Gaziano JM and Gerhard-Herman MD: Efficacy of spinal cord stimulation as an adjunct therapy for chronic refractory angina pectoris. Int J Cardiol. 227:535–542. 2017.PubMed/NCBI View Article : Google Scholar

50 

Dobias M, Michalek P, Neuzil P, Stritesky M and Johnston P: Interventional treatment of pain in refractory angina. A review. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 158:518–527. 2014.PubMed/NCBI View Article : Google Scholar

51 

Deer TR, Mekhail N, Provenzano D, Pope J, Krames E, Thomson S, Raso L, Burton A, DeAndres J, Buchser E, et al: The appropriate use of neurostimulation of the spinal cord and peripheral nervous system for the treatment of chronic pain and ischemic diseases: The neuromodulation appropriateness consensus committee. Neuromodulation. 17:515–550. 2014.PubMed/NCBI View Article : Google Scholar

52 

Sylvén C: Neurophysiological aspects of angina pectoris. Z Kardiol. 86:95–105. 1997.PubMed/NCBI

53 

Pan X, Bao H, Si Y, Xu C, Chen H, Gao X, Xie X, Xu Y, Sun F and Zeng L: Spinal cord stimulation for refractory angina pectoris: A systematic review and meta-analysis. Clin J Pain. 33:543–551. 2017.PubMed/NCBI View Article : Google Scholar

54 

Hombach V, Grebe O, Merkle N, Waldenmaier S, Höher M, Kochs M, Wöhrle J and Kestler HA: Sequelae of acute myocardial infarction regarding cardiac structure and function and their prognostic significance as assessed by magnetic resonance imaging. Eur Heart J. 26:549–557. 2005.PubMed/NCBI View Article : Google Scholar

55 

Bär FW, Tzivoni D, Dirksen MT, Fernández-Ortiz A, Heyndrickx GR, Brachmann J, Reiber JH, Avasthy N, Tatsuno J, Davies M, et al: Results of the first clinical study of adjunctive CAldaret (MCC-135) in patients undergoing primary percutaneous coronary intervention for ST-elevation myocardial infarction: The randomized multicentre CASTEMI study. Eur Heart J. 27:2516–2523. 2006.PubMed/NCBI View Article : Google Scholar

56 

Hearse DJ, Humphrey SM and Chain EB: Abrupt reoxygenation of the anoxic potassium-arrested perfused rat heart: A study of myocardial enzyme release. J Mol Cell Cardiol. 5:395–407. 1973.PubMed/NCBI View Article : Google Scholar

57 

Herzog WR, Vogel RA, Schlossberg ML, Edenbaum LR, Scott HJ and Serebruany VL: Short-Term low dose intracoronary diltiazem administered at the onset of reperfusion reduces myocardial infarct size. Int J Cardiol. 59:21–27. 1997.PubMed/NCBI View Article : Google Scholar

58 

De Stefani D, Raffaello A, Teardo E, Szabò I and Rizzuto R: A forty-kilodalton protein of the inner membrane is the mitochondrial calcium uniporter. Nature. 476:336–340. 2011.PubMed/NCBI View Article : Google Scholar

59 

Hausenloy DJ and Yellon DM: The mitochondrial permeability transition pore: Its fundamental role in mediating cell death during ischaemia and reperfusion. J Mol Cell Cardiol. 35:339–341. 2003.PubMed/NCBI View Article : Google Scholar

60 

Argaud L, Gateau-Roesch O, Muntean D, Chalabreysse L, Loufouat J, Robert D and Ovize M: Specific inhibition of the mitochondrial permeability transition prevents lethal reperfusion injury. J Mol Cell Cardiol. 38:367–374. 2005.PubMed/NCBI View Article : Google Scholar

61 

Pang KC, Frith MC and Mattick JS: Rapid evolution of noncoding RNAs: Lack of conservation does not mean lack of function. Trends Genet. 22:1–5. 2006.PubMed/NCBI View Article : Google Scholar

62 

Wang P, Luo ML, Song E, Zhou Z, Ma T, Wang J, Jia N, Wang G, Nie S, Liu Y and Hou F: Long noncoding RNA lnc-TSI inhibits renal fibrogenesis by negatively regulating the TGF-beta/smad3 pathway. Sci Transl Med. 10:2018.PubMed/NCBI View Article : Google Scholar

63 

Bejerano G, Pheasant M, Makunin I, Stephen S, Kent WJ, Mattick JS and Haussler D: Ultraconserved elements in the human genome. Science. 304:1321–1325. 2004.PubMed/NCBI View Article : Google Scholar

64 

Li D and Yang MQ: Identification and characterization of conserved lncRNAs in human and rat brain. BMC Bioinformatics. 18(489)2017.PubMed/NCBI View Article : Google Scholar

65 

Sun Y, Fan W, Xue R, Dong B, Liang Z, Chen C, Li J, Wang Y, Zhao J, Huang H, et al: Transcribed ultraconserved regions, Uc.323, ameliorates cardiac hypertrophy by regulating the transcription of CPT1b (Carnitine Palmitoyl transferase 1b). Hypertension. 75:79–90. 2020.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li Z, Li Y, Wang Q, He Z, Feng M and Xiang H: Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia‑reperfusion injuries. Exp Ther Med 21: 352, 2021.
APA
Li, Z., Li, Y., Wang, Q., He, Z., Feng, M., & Xiang, H. (2021). Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia‑reperfusion injuries. Experimental and Therapeutic Medicine, 21, 352. https://doi.org/10.3892/etm.2021.9783
MLA
Li, Z., Li, Y., Wang, Q., He, Z., Feng, M., Xiang, H."Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia‑reperfusion injuries". Experimental and Therapeutic Medicine 21.4 (2021): 352.
Chicago
Li, Z., Li, Y., Wang, Q., He, Z., Feng, M., Xiang, H."Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia‑reperfusion injuries". Experimental and Therapeutic Medicine 21, no. 4 (2021): 352. https://doi.org/10.3892/etm.2021.9783
Copy and paste a formatted citation
x
Spandidos Publications style
Li Z, Li Y, Wang Q, He Z, Feng M and Xiang H: Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia‑reperfusion injuries. Exp Ther Med 21: 352, 2021.
APA
Li, Z., Li, Y., Wang, Q., He, Z., Feng, M., & Xiang, H. (2021). Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia‑reperfusion injuries. Experimental and Therapeutic Medicine, 21, 352. https://doi.org/10.3892/etm.2021.9783
MLA
Li, Z., Li, Y., Wang, Q., He, Z., Feng, M., Xiang, H."Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia‑reperfusion injuries". Experimental and Therapeutic Medicine 21.4 (2021): 352.
Chicago
Li, Z., Li, Y., Wang, Q., He, Z., Feng, M., Xiang, H."Characterization of novel lncRNAs in upper thoracic spinal cords of rats with myocardial ischemia‑reperfusion injuries". Experimental and Therapeutic Medicine 21, no. 4 (2021): 352. https://doi.org/10.3892/etm.2021.9783
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team