Open Access

miR‑374a‑5p alleviates sepsis‑induced acute lung injury by targeting ZEB1 via the p38 MAPK pathway

  • Authors:
    • Jia Shen
    • Xiaojun Ma
  • View Affiliations

  • Published online on: July 12, 2022     https://doi.org/10.3892/etm.2022.11501
  • Article Number: 564
  • Copyright: © Shen et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The aim of the present study was to investigate the effects of microRNA (miR)‑374a‑5p on sepsis‑induced acute lung injury (ALI) and the associated mechanism. Lipopolysaccharide (LPS)‑induced human pulmonary microvascular endothelial cells (HPMVECs) were used to construct the cellular model of sepsis. A luciferase reporter assay was performed to confirm the association between miR‑374a‑5p and zinc finger E‑box binding homeobox 1 (ZEB1). Reverse transcription‑quantitative polymerase chain reaction and western blot analysis were performed to assess the relative expression of miR‑374a‑5p, ZEB1 and apoptosis‑related proteins. Cell viability and apoptosis were determined by Cell Counting Kit‑8 assay and flow cytometry, respectively. Enzyme‑linked immunosorbent assays were used to evaluate inflammatory cytokines. The results revealed that miR‑374a‑5p was downregulated in sepsis patients and LPS‑treated HPMVECs. Upregulation of miR‑374a‑5p alleviated LPS‑triggered cell injury in HPMVECs, as evidenced by restoration of cell viability, and inhibition of apoptosis and the production of proinflammatory cytokines. In addition, ZEB1 was revealed to be a downstream target of miR‑374a‑5p, and overexpression of ZEB1 could reverse the anti‑apoptotic and anti‑inflammatory effects of miR‑374a‑5p on an LPS‑induced sepsis cell model. Moreover, miR‑374a‑5p‑induced protective effects involved the p38 MAPK signaling pathway. Collectively, miR‑374a‑5p exerted a protective role in sepsis‑induced ALI by regulating the ZEB1‑mediated p38 MAPK signaling pathway, providing a potential target for the diagnosis and treatment of sepsis.

Introduction

Sepsis is a systemic inflammatory response syndrome (SIRS) caused by infection, which could develop into septic shock and multiple organ dysfunction syndrome (MODS), and has become one of the leading causes of death in critically ill patients, with a mortality rate of 25 to 40% (1,2). Acute lung injury (ALI)/acute respiratory distress syndrome (ARDS) is one of the most common complications of severe sepsis, involving an inflammatory process (3,4). Therefore, it is of great significance to explore the biomarkers for the early diagnosis, treatment and prognosis evaluation of sepsis-induced ALI. Pulmonary endothelial cell injury plays an important role in the dysfunction of the alveolar-capillary barrier, which is a characteristic feature of ALI (5,6). Lipopolysaccharide (LPS), the bacterial endotoxin, is a primary pathogenic mediator of pulmonary endothelial cell activation, which triggers ALI, involving multiple inflammatory cells, and cytokines (7,8). Alleviating the injury of pulmonary endothelial cells is an important method to prevent sepsis-induced ALI.

MicroRNAs (miRNAs or miRs) are a class of small non-coding RNAs that have been discovered in recent years, which can specifically recognize the 3'-UTR sites of target mRNAs to inhibit protein translation or induce mRNA degradation, and thus regulate gene expression at the post-transcriptional levels (9). MiRNAs play crucial roles in the regulation of multiple physiological and pathological processes such as cell proliferation and apoptosis, differentiation, and inflammatory response (10,11). Previous research has revealed that several miRNAs are implicated in the development of sepsis-induced ALI, such as miR-155 and miR-146a (12). MiR-374a has been demonstrated to inhibit the progression of lung adenocarcinoma and non-small cell lung carcinoma (13-15). MiR-374a was necessary for the inhibition of intestinal inflammation and oxidative injury in rats with colitis (16). MiR-374a-5p was critical for the protective effects on neonatal hypoxic-ischemic encephalopathy (HIE) by inhibiting LPS-induced microglial neuroinflammation (17). A previous study indicated that miR-374a alleviated LPS-induced hyperpermeability of human pulmonary artery endothelial cells (18). However, it remains unclear whether miR-374a-5p is engaged in sepsis-induced ALI.

Zinc finger E-box binding homeobox 1 (ZEB1) is a transcription factor which has critical roles in epithelial-mesenchymal transition (EMT), senescence, and angiogenesis (19-21). It has been reported that ZEB1 induces inflammatory response in periodontal disease and liver fibrosis (22,23). In addition, the p38 MAPK signaling pathway is associated with septic lung injury (24-26). A previous study revealed that the p38 MAPK pathway could be restricted by miR-200s by targeting ZEB1/2 in LPS-induced pulmonary fibrosis (27).

In the present study, human pulmonary microvascular endothelial cells (HPMVECs) induced by LPS were used to investigate whether miR-374a-5p exerted a protective role in sepsis-induced ALI through the p38 MAPK signaling pathway by targeting ZEB1.

Materials and methods

Patients and healthy subjects

In total, 25 patients with sepsis (49.5±10.3 years old; 16 males and 9 females) following intensive care unit (ICU) admission at General Hospital of Ningxia Medical University (Yinchuan, China) from May 2017 to August 2018 were recruited in the present study, according to diagnostic criteria proposed by The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3) (28). Exclusion criteria were as follows: i) Patients younger than 18 years old; ii) patients with chronic liver and renal insufficiency; iii) patients with malignant tumors; iv) patients with haematological diseases; v) patients with compromised immune systems; vi) pregnant and lactating patients; and vii) patients with acute cardiovascular and cerebrovascular diseases. In addition, 25 age- and sex-matched healthy individuals (50.6±9.3 years old; 18 males and 7 females) with no history of pulmonary infection or malignancies were enrolled as the controls. Written informed consent was provided from all participants, and the present study was approved by the Ethics Committee of General Hospital of Ningxia Medical University (approval no. IRB2017-GHNMU-38). Clinical characteristics of the study subjects including sex, age, body mass index (BMI), acute physiology and chronic health evaluation (APACHE) II score, sequential organ failure assessment (SOFA) score, C-reactive protein (CRP), procalcitonin (PTC), and blood gas analysis (lactic acid, and PaO2 /FiO2) are presented in Table I.

Table I

Demographic and clinical characteristics of patients with sepsis and healthy controls.

Table I

Demographic and clinical characteristics of patients with sepsis and healthy controls.

CharacteristicSepsis (n=25)Healthy (n=25)P-value
Sex, male/female16/918/70.544
Age, years49.5±10.350.6±9.30.694
BMI, kg/m220.5±1.920.5±1.80.999
APACHE II score15.9±3.2--
SOFA score6.1±1.3--
CRP, mg/l96.7±20.36.3±2.6<0.001
PCT, ng/ml12.2±5.90.7±0.1<0.001
Lactic acid, mmol/l2. 8±1.81.0±0.4<0.001
PaO2 /FiO2, mmHg187.7±38.1378.3±43.6<0.001

[i] Data are presented as n or the mean ± SD. BMI, body mass index; APACHE, acute physiology and chronic health evaluation; SOFA, sequential organ failure assessment; CRP, C-reactive protein; PCT, procalcitonin.

Following admission, blood samples (5 ml) were obtained on an empty stomach, and centrifuged at 3,000 x g for 10 min at 4˚C to completely remove cell debris. The collected serum was transferred to RNase/DNase-free sterile tubes and stored at -80˚C until further processing.

Cell culture and LPS treatment

HPMVECs, purchased from American Type Culture Collection (ATCC no. PCS-100-022) were cultured in Dulbecco's modified Eagle's medium (DMEM; Life Technologies; Thermo Fisher Scientific, Inc.) plus 10% fetal bovine serum (FBS; Invitrogen; Thermo Fisher Scientific, Inc.) and 100 µg/ml penicillin/streptomycin (Life Technologies; Thermo Fisher Scientific, Inc.) at 37˚C with 5% CO2. For the cellular model of sepsis, HPMVECs were incubated with 1 µg/ml LPS (Sigma-Aldrich; Merck KGaA) for 24 h at 37˚C. The ethics approval for the use of primary cell lines was received.

Cell transfection

HPMVECs (1x104 cells/ml) cultured in 96-well plates were transfected with 50 nM miR-374a-5p mimics, miRNA negative control (miR-NC), 4 µg pcDNA3.1 containing the open reading frame of ZEB1 or pcDNA3.1 empty vector (Vector), chemically synthesized by Shanghai GenePharma Co., Ltd. with Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37˚C, according to manufacturer's protocol. At 24 h after transfection, HPMVECs were stimulated with 1 µg/ml LPS for 24 h. Sequences of the oligonucleotides are shown in Table II.

Table II

Sequences of the oligonucleotides.

Table II

Sequences of the oligonucleotides.

OligonucleotidesSequences (5'-3')
miR-374a-5p UUAUAAUACAACCUGAUAAGUG
mimics CUUAUCAGGUUGUAUUAUAAUU
miR-NC UUCUCCGAACGUGUCACGUTT
  ACGUGACACGUUCGGAGAATT

[i] miR-374a-5p, microRNA-374a-5p; miR-NC, miRNA negative control.

Luciferase reporter assay

The binding site between ZEB1 and miR-374a-5p was predicted using StarBase v2.0 (https://starbase.sysu.edu.cn/). The 3'-UTR fragments of ZEB1 containing the predicted wild-type (ZEB1-wt) or corresponding mutated (ZEB1-mut) miR-374a-5p binding sites were amplified by PCR and sub-cloned into a pmirGLO Dual-luciferase miRNA Target Expression Vector (Promega Corporation). When cells reached ~80% confluence, these luciferase reporter plasmids were co-transfected with either miR-374a-5p mimic or miR-NC into HPMVECs using Lipofectamine 2000. After 48 h of transfection, the cells were subjected to further luciferase assays using a Bright-Glo™ LuciferaseAssay System (Promega Corporation). The luciferase activity was normalized to Renilla luciferase activity values.

Reverse transfection-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA was extracted from serum and cultured cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. RT was conducted using a Taqman MicroRNA Reverse Transcription Kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) for miRNA or a Prime-Script™ One Step RT-qPCR kit (Takara Bio, Inc.) for mRNA strictly according to the manufacturers' instructions. Real-time PCR was conducted using SYBR Premix ExTagTM (Takara Bio, Inc.) on a 7500 Fast Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following thermocycling conditions: 95˚C for 10 min, followed by 40 cycles at 94˚C for 45 sec, 55˚C for 30 sec and 72˚C for 1 min. Relative expression levels of miR-374a-5p and ZEB1 were calculated using the 2-ΔΔCq method using U6 snRNA or GAPDH as internal controls (29). The primers used were as follows: miR-374a-5p forward, 5'-GCGCGCTTATAATACAACCTGA-3' and reverse, 5'-AGAGCAGGGTCCGAGGT-3' (universal); ZEB1 forward, 5'-GATGATGAATGCGAGTCAGATGC-3' and reverse, 5'-ACAGCAGTGTCTTGTTGTTGT-3'; U6 forward, 5'-CAGCACATATACTAAAATTGGAACG-3' and reverse, 5'-ACGAATTTGCGTGTCATCC-3'; GAPDH forward, 5'-TGTGGGCATCAATGGATTTGG-3' and reverse, 5'-ACACCATGTATTCCGGGTCAAT-3'.

Cell Counting Kit-8 (CCK-8) assay

A CCK-8 Kit was purchased from Dojindo Laboratories, Inc. to detect the cell viability according to the manufacturer's instructions. In detail, LPS-treated or transfected HPMVECs were seeded in a 96-well plate containing 5x103 cells/well and cultured for 24 h at 37˚C. CCK-8 reagent was added to each well and cells were further incubated at 37˚C for 4 h. The absorbance at 450 nm using a microplate reader (Bio-Rad Laboratories, Inc.) was measured to assess the viability of cells. Each experiment was repeated in triplicate.

Apoptosis detection using flow cytometry

The apoptosis of HPMVECs were determined by flow cytometry using an Annexin V-FITC/PI detection kit (Sigma-Aldrich; Merck KGaA) in accordance with a previous study (30). Briefly, cells were washed with PBS, re-suspended in binding buffer and stained with Annexin V/FITC and PI solution for 30 min. The apoptotic cells were detected with a flow cytometer (Beckman Coulter, Inc.) and Expo32 v1.2 software (Beckman Coulter, Inc.).

Western blot analysis

Following lysis in RIPA buffer (Santa Cruz Biotechnology, Inc.) and centrifugation at 12,000 x g for 20 min at 4˚C, proteins were extracted from serum or cells. Bradford method was used to detect the concentration of the proteins using a Bradford assay kit (Thermo Fisher Scientific, Inc.). Sodium dodecyl sulfate polyacrylamide gel electrophoresis on 7.5-10% gels was used to separate the proteins with equal amounts. The proteins (30 µg) were then transferred onto PVDF membranes (MilliporeSigma). Samples were blocked with 5% non-fat milk at room temperature for 1 h, and incubated with the primary antibodies against Bax (product no. 5023), Bcl-2 (product no. 3498), ZEB1 (product no. 3396), phosphorylated (p)-p38 (product no. 4511), p38 (product no. 8690), p-JNK (product no. 4668), JNK (product no. 9252), p-ERK (product no. 4370), ERK (product no. 4695) and GAPDH (product no. 5174) (all 1:1,000 dilution; Cell Signaling Technology, Inc.) overnight at 4˚C, and then the membrane was incubated with the secondary antibodies (anti-rabbit IgG, HRP-conjugated; product no. 7074; 1:2,000 dilution; Cell Signaling Technology, Inc.) at room temperature for 2 h. GAPDH was used as the internal control. A Super Signal West Pico Chemiluminescent Substrate kit (Pierce; Thermo Fisher Scientific, Inc.) was then used to scan the films according to the manufacturer's protocol. Image-Pro Plus software version 6.0 (Media Cybernetics, Inc.) was used to analyze the relative protein expression.

Cytokine assessment

Enzyme-linked immunosorbent assay (ELISA) method was performed to determine the concentration of interleukin (IL)-6 (cat. no. RAB0313), IL-1β (cat. no. RAB0273), and tumor necrosis factor-α (TNF-α) (cat. no. RAB1089) in cell culture supernatant using commercial ELISA kits (Sigma-Aldrich; Merck KGaA) according to the manufacturer's instructions.

Statistical analysis

All analyses were performed using SPSS version 22.0 (IBM Corp.). Two-sided unpaired Student's t-test or analysis of variance (ANOVA) with Tukey's post hoc test was used to compare differences between groups. All results were presented as the mean ± standard deviation (SD) and a P-value <0.05 was considered to indicate a statistically significant difference. Pearson's correlation analysis was employed to analyze the association between serum miR-374a-5p and ZEB1 mRNA levels.

Results

MiR-374a-5p is downregulated in patients with sepsis and LPS-treated HPMVECs

The serum expression levels of miR-374a-5p in patients with sepsis and healthy controls were analyzed by RT-qPCR. A low expression of serum miR-374a-5p was revealed in septic patients compared with healthy controls (Fig. 1A). The expression level of miR-374a-5p was further detected in sepsis-induced ALI in vitro using LPS-treated HPMVECs. As revealed in Fig. 1B, miR-374a-5p was significantly downregulated after LPS treatment in comparison with the untreated cells.

Overexpression of miR-374a-5p alleviates LPS-induced apoptosis and inflammation in HPMVECs

To further explore the effects of miR-374a-5p in LPS-induced HPMVECs, the expression of miR-374a-5p was upregulated in LPS-treated HPMVECs by transfection with miR-374a-5p mimic (Fig. 2A). In addition, upregulation of miR-374a-5p restored cell viability (Fig. 2B) which was decreased by LPS treatment and attenuated the apoptotic rate which was induced by LPS in HPMVECs (Fig. 2C and D). Furthermore, LPS treatment resulted in increased expression of Bax and a significant reduction of Bcl-2 expression, while miR-374a-5p overexpression reversed these effects of apoptosis-related proteins in LPS-treated HPMVECs (Fig. 2E). In addition, LPS-induced secretion of IL-6, IL-1β, and TNF-α in HPMVECs was significantly impeded by miR-374a-5p overexpression (Fig. 2F).

ZEB1 is directly targeted by miR-374a-5p in HPMVECs

Subsequently, the downstream target of miR-374a-5p was searched for using bioinformatics analysis. ZEB1 was predicted as a direct target gene of miR-374a-5p with several putative binding sites using StarBase v2.0 (https://starbase.sysu.edu.cn/) (Fig. 3A). Dual-luciferase reporter assay demonstrated that the luciferase activity of ZEB1-wt was significantly decreased in cells transfected with miR-374a-5p mimic compared with miR-NC transfection (Fig. 3B). The mRNA and protein levels of ZEB1 in miR-374a-5p-overexpressing HPMVECs were then assessed and it was determined that the expression of ZEB1 at the mRNA and protein levels was significantly downregulated by the miR-374a-5p mimic (Fig. 3C and D). There was a higher expression of ZEB1 mRNA in the serum of patients with sepsis than that in healthy controls (Fig. 3E). A negative correlation between miR-374a-5p and ZEB1 mRNA expression was revealed in patients with sepsis (Fig. 3F). As anticipated, LPS stimulation induced the upregulation of ZEB1 mRNA and protein levels in HPMVECs (Fig. 3G and H).

MiR-374a-5p reduces LPS-induced HPMVEC injury by targeting ZEB1

To verify whether miR-374a-5p was involved in sepsis-induced ALI by targeting ZEB1, miR-374a-5p mimic was co-transfected with ZEB1 into HPMVECs, and then the cells were treated with LPS. The expression of ZEB1 in LPS-treated HPMVECs was efficiently increased by transfection of ZEB1 overexpression vector (Fig. 4A). Further results revealed that upregulation of ZEB1 weakened the viability induced by enforced expression of miR-374a-5p in LPS-treated cells (Fig. 4B). As depicted in Fig. 4C-E, ZEB1 overexpression abolished the inhibitory effects of miR-374a-5p on cell apoptosis, as determined by the enhanced apoptotic ratio, the increased Bax level and decreased Bcl-2 level. Introduction of ZEB1 counteracted the suppressive effect of miR-374a-5p on IL-6, IL-1β, and TNF-α production triggered by LPS in HPMVECs (Fig. 4F).

MiR-374a-5p exerts its function in LPS-treated HPMVECs by regulating the ZEB1-mediated p38 MAPK signaling pathway

To investigate the underlying mechanism of miR-374a-5p in sepsis-induced ALI, the expression of the p38 MAPK pathway was determined following overexpression of miR-374a-5p and ZEB1. Western blotting confirmed that the phosphorylation levels of p38, JNK, and ERK were significantly increased in LPS-treated HPMVECs. When miR-374a-5p was overexpressed, the protein expression of p38, JNK, and ERK phosphorylation levels was reduced, whereas ectopic expression of ZEB1 antagonized the downregulation (Fig. 5).

Discussion

Reportedly, the pathogenesis of sepsis-induced ALI is associated with pulmonary endothelial dysfunction, leading to abnormal apoptosis and inflammatory response (31,32). In the present study, for the first time to the best of our knowledge, it is reported that miR-374a-5p ameliorated the progression of sepsis-induced ALI in vitro by targeting ZEB1 and thus inactivating the p38 MAPK signaling pathway. This conclusion was supported by the following evidence. First, miR-374a-5p expression was decreased in the serum of patients with sepsis and in HPMVECs treated with LPS. Second, miR-374a-5p overexpression alleviated LPS-induced apoptosis and inflammatory response in HPMVECs. Third, ZEB1 was confirmed as a direct target of miR-374a-5p, and ZEB1 upregulation could attenuate the inhibition of miR-374a-5p on LPS-induced cell injury. Finally, the p38 MAPK signaling axis was essential for LPS-induced injury, and was also involved in the miR-374a-5p/ZEB1 network.

Increasing studies have shown that miR-374a-5p plays its protective roles in the development of neurological dysfunction (17,33) and myocardial injury (34,35). In a study of metabolically healthy obese (MHO), serum miR-374a-5p was highly expressed in MHO, and there was a positive association between miR-374a-5p expression with the downregulation of pro-inflammatory cytokines (36). In the present study, serum miR-374a-5p expression was decreased in septic patients when compared with healthy controls. Similarly, in an in vitro cell model of LPS-induced ALI in HPMVECs, miR-374a-5p expression was also downregulated when compared with the untreated cells. MiR-374a-5p mimic was further used to upregulate miR-374a-5p expression in HPMVECs, and it was demonstrated that miR-374a-5p overexpression attenuated the LPS-induced inhibition of cell viability. Bax and Bcl-2, significant members of the Bcl-2 family, are vital regulators of apoptotic cell death (37); and the present research revealed that miR-374a-5p overexpression decreased the proportion of apoptotic cells in LPS-treated HPMVECs, as demonstrated by inhibition of Bax expression and upregulation of Bcl-2. Pro-inflammatory cytokines such as IL-6, IL-1β and TNF-α and inflammatory chemokines appear to trigger the inflammatory cascade, leading to pathological changes (38). In the present study, stimulation of LPS caused increased levels of IL-6, IL-1β and TNF-α in cell supernatants. The gain-of-function assay revealed that miR-374a-5p overexpression mitigated LPS-induced inflammatory response. These results indicated the apoptosis and inflammatory inhibitory effects of miR-374a-5p in HPMVECs.

ZEB1 may serve as a novel therapeutic target for pulmonary inflammation (27), neuroinflammation (39), and inflammatory cancer (40). ZEB1 was confirmed as a direct downstream target of miR-374a-5p and their expression was negatively correlated in the present study. Moreover, ZEB1 overexpression was capable of reversing the protective roles of miR-374a-5p in LPS-induced cell injury of HPMVECs. Extensive evidence indicates that aberrant activation of the p38 MAPK signaling pathway contributes to the pathogenesis of sepsis-induced ALI (24-26). In addition, ZEB1 is increased in LPS-induced pulmonary fibrosis, which is associated with the p38 MAPK signaling pathway (27). JNK and ERK pathways, the other MAPK pathways, also play vital roles in triggering the production of pro-inflammatory cytokines in response to LPS stimulation (41). In the present study, it was determined that p38, JNK, and ERK phosphorylation levels were downregulated when miR-374a-5p was overexpressed in LPS-treated HPMVECs, while ZEB1 overexpression led to the activation of p38 MAPK, JNK and ERK signaling pathways. Collectively, these findings indicated that miR-374a-5p ameliorated sepsis-induced ALI through the ZEB1-mediated p38 MAPK, JNK, and ERK pathways. However, there were some limitations in the present study. First, further validating investigations may have to be performed using a larger cohort to compare cases of sepsis with healthy controls to provide a greater statistical significance. Second, further investigation is required to verify the in vivo role of miR-374a-5p in sepsis-induced ALI using animal models. Third, the other signaling pathways involved in the regulatory effect of miR-374a-5p on HPMVEC cell behaviors were not further investigated.

Overall, the present study highlighted miR-374a-5p as a novel target for sepsis therapy and demonstrated that miR-374a-5p attenuated LPS-induced cell injury in HPMVECs, possibly via the ZEB1-mediated p38 MAPK signaling pathway.

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JS conducted most of the experiments and wrote the manuscript. XM conducted the experiments and analyzed the data. JS designed the study and revised the manuscript. All authors have read and approved the final manuscript. JS and XM confirm the authenticity of all the raw data.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of General Hospital of Ningxia Medical University of Science and Technology (Yinchuan, China; approval no. IRB2017-GHNMU-38).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Liu KD and Matthay MA: Advances in critical care for the nephrologist: Acute lung injury/ARDS. Clin J Am Soc Nephrol. 3:578–586. 2008.PubMed/NCBI View Article : Google Scholar

2 

Gotts JE and Matthay MA: Sepsis: Pathophysiology and clinical management. BMJ. 353(i1585)2016.PubMed/NCBI View Article : Google Scholar

3 

Yang L, Zhang Z, Zhuo Y, Cui L, Li C, Li D, Zhang S, Cui N, Wang X and Gao H: Resveratrol alleviates sepsis-induced acute lung injury by suppressing inflammation and apoptosis of alveolar macrophage cells. Am J Transl Res. 10:1961–1975. 2018.PubMed/NCBI

4 

Wang RH, Xie YX, Qiu JW and Chen JY: Influence of LincRNA-p21 on acute lung injury in sepsis. Eur Rev Med Pharmacol Sci. 24:5618–5626. 2020.PubMed/NCBI View Article : Google Scholar

5 

Huang LS, Hong Z, Wu W, Xiong S, Zhong M, Gao X, Rehman J and Malik AB: mtDNA activates cGAS signaling and suppresses the YAP-mediated endothelial cell proliferation program to promote inflammatory injury. Immunity. 52:475–486.e5. 2020.PubMed/NCBI View Article : Google Scholar

6 

Cen M, Ouyang W, Zhang W, Yang L, Lin X, Dai M, Hu H, Tang H, Liu H, Xia J and Xu F: MitoQ protects against hyperpermeability of endothelium barrier in acute lung injury via a Nrf2-dependent mechanism. Redox Biol. 41(101936)2021.PubMed/NCBI View Article : Google Scholar

7 

Nova Z, Skovierova H and Calkovska A: Alveolar-capillary membrane-related pulmonary cells as a target in endotoxin-induced acute lung injury. Int J Mol Sci. 20(831)2019.PubMed/NCBI View Article : Google Scholar

8 

Lu Q, Zhang D, Liu H and Xu H: miR-942-5p prevents sepsis-induced acute lung injury via targeting TRIM37. Int J Exp Pathol. 102:192–199. 2021.PubMed/NCBI View Article : Google Scholar

9 

Vishnoi A and Rani S: MiRNA biogenesis and regulation of diseases: An overview. Methods Mol Biol. 1509:1–10. 2017.PubMed/NCBI View Article : Google Scholar

10 

Chunlei H, Chang Z, Sheng L, Yanchun Z, Lulin L and Daozhang C: Down-regulation of MiR-138-5p Protects Chondrocytes ATDC5 and CHON-001 from IL-1 β-induced inflammation via up-regulating SOX9. Curr Pharm Des. 25:4613–4621. 2020.PubMed/NCBI View Article : Google Scholar

11 

Qu SP, Li GW, Ma H and Xing Q: MicroRNA-193a-3p participates in the progression of rheumatoid arthritis by regulating proliferation and apoptosis of MH7A cells through targeting IGFBP5. Eur Rev Med Pharmacol Sci. 23:4850–4857. 2019.PubMed/NCBI View Article : Google Scholar

12 

Han Y, Li Y and Jiang Y: The prognostic value of plasma microRNA-155 and microRNA-146a level in severe sepsis and sepsis-induced acute lung injury patients. Clin Lab. 62:2355–2360. 2016.PubMed/NCBI View Article : Google Scholar

13 

Wu H, Liu Y, Shu XO and Cai Q: MiR-374a suppresses lung adenocarcinoma cell proliferation and invasion by targeting TGFA gene expression. Carcinogenesis. 37:567–575. 2016.PubMed/NCBI View Article : Google Scholar

14 

Xu Z, Xu J, Lu H, Lin B, Cai S, Guo J, Zang F and Chen R: LARP1 is regulated by the XIST/miR-374a axis and functions as an oncogene in non-small cell lung carcinoma. Oncol Rep. 38:3659–3667. 2017.PubMed/NCBI View Article : Google Scholar

15 

Zhao M, Xu P, Liu Z, Zhen Y, Chen Y, Liu Y, Fu Q, Deng X, Liang Z, Li Y, et al: Dual roles of miR-374a by modulated c-Jun respectively targets CCND1-inducing PI3K/AKT signal and PTEN-suppressing Wnt/β-catenin signaling in non-small-cell lung cancer. Cell Death Dis. 9(78)2018.PubMed/NCBI View Article : Google Scholar

16 

Xiong Y, Qiu J, Li C, Qiu Y, Guo L, Liu Y, Wan J, Li Y, Wu G, Wang L, et al: Fortunellin-induced modulation of phosphatase and tensin homolog by microRNA-374a decreases inflammation and maintains intestinal barrier function in colitis. Front Immunol. 9(83)2018.PubMed/NCBI View Article : Google Scholar

17 

Chen Z, Hu Y, Lu R, Ge M and Zhang L: MicroRNA-374a-5p inhibits neuroinflammation in neonatal hypoxic-ischemic encephalopathy via regulating NLRP3 inflammasome targeted Smad6. Life Sci. 252(117664)2020.PubMed/NCBI View Article : Google Scholar

18 

Adyshev DM, Moldobaeva N, Mapes B, Elangovan V and Garcia JG: MicroRNA regulation of nonmuscle myosin light chain kinase expression in human lung endothelium. Am J Respir Cell Mol Biol. 49:58–66. 2013.PubMed/NCBI View Article : Google Scholar

19 

Gao Y, Zhao Y, Zhang J, Lu Y, Liu X, Geng P, Huang B, Zhang Y and Lu J: The dual function of PRMT1 in modulating epithelial-mesenchymal transition and cellular senescence in breast cancer cells through regulation of ZEB1. Sci Rep. 6(19874)2016.PubMed/NCBI View Article : Google Scholar

20 

Liu Y, El-Naggar S, Darling DS, Higashi Y and Dean DC: Zeb1 links epithelial-mesenchymal transition and cellular senescence. Development. 135:579–588. 2008.PubMed/NCBI View Article : Google Scholar

21 

Fu R, Lv WC, Xu Y, Gong MY, Chen XJ, Jiang N, Xu Y, Yao QQ, Di L, Lu T, et al: Endothelial ZEB1 promotes angiogenesis-dependent bone formation and reverses osteoporosis. Nat Commun. 11(460)2020.PubMed/NCBI View Article : Google Scholar

22 

Matsui S, Zhou L, Nakayama Y, Mezawa M, Kato A, Suzuki N, Tanabe N, Nakayama T, Suzuki Y, Kamio N, et al: MiR-200b attenuates IL-6 production through IKKβ and ZEB1 in human gingival fibroblasts. Inflamm Res. 67:965–973. 2018.PubMed/NCBI View Article : Google Scholar

23 

Yang J, Tao Q, Zhou Y, Chen Q, Li L, Hu S, Liu Y, Zhang Y, Shu J, Zhang X, et al: MicroRNA-708 represses hepatic stellate cells activation and proliferation by targeting ZEB1 through Wnt/β-catenin pathway. Eur J Pharmacol. 871(172927)2020.PubMed/NCBI View Article : Google Scholar

24 

Lin LP, Niu GH and Zhang XQ: Influence of lncRNA MALAT1 on septic lung injury in mice through p38 MAPK/p65 NF-κB pathway. Eur Rev Med Pharmacol Sci. 23:1296–1304. 2019.PubMed/NCBI View Article : Google Scholar

25 

Hu XH, Situ HL, Chen JP and Yu RH: Lipoxin A4 alleviates lung injury in sepsis rats through p38/MAPK signaling pathway. J Biol Regul Homeost Agents. 34:807–814. 2020.PubMed/NCBI View Article : Google Scholar

26 

Shao Y, Chen X, Liu Y, Chen X, Li C, Wang L and Zhao W: Dexmedetomidine alleviates lung injury in sepsis mice through regulating P38 MAPK signaling pathway. Panminerva Med. 63:563–564. 2021.PubMed/NCBI View Article : Google Scholar

27 

Cao Y, Liu Y, Ping F, Yi L, Zeng Z and Li Y: miR-200b/c attenuates lipopolysaccharide-induced early pulmonary fibrosis by targeting ZEB1/2 via p38 MAPK and TGF-β/smad3 signaling pathways. Lab Invest. 98:339–359. 2018.PubMed/NCBI View Article : Google Scholar

28 

Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, et al: The third international consensus definitions for sepsis and septic shock (sepsis-3). JAMA. 315:801–810. 2016.PubMed/NCBI View Article : Google Scholar

29 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

30 

Crowley LC, Marfell BJ, Scott AP and Waterhouse NJ: Quantitation of apoptosis and necrosis by annexin V binding, propidium iodide uptake, and flow cytometry. Cold Spring Harb Protoc. 2016:953–957. 2016.PubMed/NCBI View Article : Google Scholar

31 

Mu S, Liu Y, Jiang J, Ding R, Li X, Li X and Ma X: Unfractionated heparin ameliorates pulmonary microvascular endothelial barrier dysfunction via microtubule stabilization in acute lung injury. Respir Res. 19(220)2018.PubMed/NCBI View Article : Google Scholar

32 

Li X, Jamal M, Guo P, Jin Z, Zheng F, Song X, Zhan J and Wu H: Irisin alleviates pulmonary epithelial barrier dysfunction in sepsis-induced acute lung injury via activation of AMPK/SIRT1 pathways. Biomed Pharmacother. 118(109363)2019.PubMed/NCBI View Article : Google Scholar

33 

Jiang F, Yang M, Wu C and Wang J: Potential roles of miR-374a-5p in mediating neuroprotective effects and related molecular mechanism. J Mol Neurosci. 69:123–132. 2019.PubMed/NCBI View Article : Google Scholar

34 

Chen YQ, Yang X, Xu W, Yan Y, Chen XM and Huang ZQ: Knockdown of lncRNA TTTY15 alleviates myocardial ischemia-reperfusion injury through the miR-374a-5p/FOXO1 axis. IUBMB Life. 73:273–285. 2021.PubMed/NCBI View Article : Google Scholar

35 

Huang ZQ, Xu W, Wu JL, Lu X and Chen XM: MicroRNA-374a protects against myocardial ischemia-reperfusion injury in mice by targeting the MAPK6 pathway. Life Sci. 232(116619)2019.PubMed/NCBI View Article : Google Scholar

36 

Doumatey AP, He WJ, Gaye A, Lei L, Zhou J, Gibbons GH, Adeyemo A and Rotimi CN: Circulating MiR-374a-5p is a potential modulator of the inflammatory process in obesity. Sci Rep. 8(7680)2018.PubMed/NCBI View Article : Google Scholar

37 

Voss AK and Strasser A: The essentials of developmental apoptosis. F1000Res. 9(F1000)2020.PubMed/NCBI View Article : Google Scholar

38 

Wu X, Kong Q, Zhan L, Qiu Z, Huang Q and Song X: TIPE2 ameliorates lipopolysaccharide-induced apoptosis and inflammation in acute lung injury. Inflamm Res. 68:981–992. 2019.PubMed/NCBI View Article : Google Scholar

39 

Li D, Lang W, Zhou C, Wu C, Zhang F, Liu Q, Yang S and Hao J: Upregulation of microglial ZEB1 ameliorates brain damage after acute ischemic stroke. Cell Rep. 22:3574–3586. 2018.PubMed/NCBI View Article : Google Scholar

40 

de Barrios O, Sanchez-Moral L, Cortés M, Ninfali C, Profitós-Pelejà N, Martínez-Campanario MC, Siles L, Del Campo R, Fernández-Aceñero MJ, Darling DS, et al: ZEB1 promotes inflammation and progression towards inflammation-driven carcinoma through repression of the DNA repair glycosylase MPG in epithelial cells. Gut. 68:2129–2141. 2019.PubMed/NCBI View Article : Google Scholar

41 

Chen IC, Wang SC, Chen YT, Tseng HH, Liu PL, Lin TC, Wu HE, Chen YR, Tseng YH, Hsu JH, et al: Corylin ameliorates LPS-induced acute lung injury via suppressing the MAPKs and IL-6/STAT3 signaling pathways. Pharmaceuticals (Basel). 14(1046)2021.PubMed/NCBI View Article : Google Scholar

Related Articles

Journal Cover

September-2022
Volume 24 Issue 3

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Shen J and Ma X: miR‑374a‑5p alleviates sepsis‑induced acute lung injury by targeting ZEB1 via the p38 MAPK pathway. Exp Ther Med 24: 564, 2022.
APA
Shen, J., & Ma, X. (2022). miR‑374a‑5p alleviates sepsis‑induced acute lung injury by targeting ZEB1 via the p38 MAPK pathway. Experimental and Therapeutic Medicine, 24, 564. https://doi.org/10.3892/etm.2022.11501
MLA
Shen, J., Ma, X."miR‑374a‑5p alleviates sepsis‑induced acute lung injury by targeting ZEB1 via the p38 MAPK pathway". Experimental and Therapeutic Medicine 24.3 (2022): 564.
Chicago
Shen, J., Ma, X."miR‑374a‑5p alleviates sepsis‑induced acute lung injury by targeting ZEB1 via the p38 MAPK pathway". Experimental and Therapeutic Medicine 24, no. 3 (2022): 564. https://doi.org/10.3892/etm.2022.11501