This article is mentioned in:

Introduction

Salmonella is a gram-negative, facultative, intracellular bacterium that frequently causes human and animal diseases (1). According to the WHO, >90 million people are infected by Salmonella annually, 150,000 of whom will succumb to Salmonella infection. The main clinical symptoms of Salmonella infection, also called salmonellosis, are sepsis and gastroenteritis (2). To date, >2,600 subtypes of Salmonella have been discovered and categorized (3). Salmonella serotypes are typically associated with their host adaptation and virulence capability, rendering serotyping to be a key tool for Salmonella surveillance and outbreak investigations (4). However, treatment of invasive salmonellosis has been compromised due to the emergence of Salmonella strains that are resistant to a variety of first-line drugs such as ampicillin, chloramphenicol and co-trimoxazole (5). Therefore, an appropriate molecular typing method should be used in combination with serotyping to investigate the epidemiology of Salmonella.

Accurate typing and tracing are important for microbial epidemiological investigation, food safety and public health. Bacterial typing methods that are available include phenotyping such as phage-typing, serotyping and ribotyping and genotyping such as plasmid profile, pulsed-field gel electrophoresis and multi-locus sequence typing (6). Among them, serotyping and multi-locus sequence typing (MLST) are the most frequently used (7). Typing methods of Salmonella can be divided into phenotypic typing based on their phenotypic characteristics and molecular typing based on their gene expression patterns (8). Serotyping using standard agglutination methods has been the most common form of typing since 1934(9). By contrast, molecular typing techniques mainly include pulsed field gel electrophoresis (PFGE) (10), MLST and multi-locus variable-number tandem repeat analysis (8). MLST has become a particularly popular molecular typing method due to its advantages: i) High resolution, it is easy to discover differentiation of genetically related bacterial isolates from nonambiguous sequencing data, which is superior to serotyping and/or PFGE typing (11); and ii), reproducibility and universality, MLST can be readily reproduced and does not require access to specialized reagents or training (12). In particular, Salmonella MLST is a molecular typing method that is based on the sequencing of seven housekeeping genes of Salmonella, namely chorismate synthase (aroC), β sliding clamp of DNA polymerase III (dnaN), uroporphyrinogen-III synthase (hemD), histidinol dehydrogenase (hisD), phosphoribosylaminoimidazole carboxylase catalytic subunit (purE), 2-oxoglutarate dehydrogenase E1 component (sucA) and homoserine dehydrogenase (thrA) (13). These genes are highly conserved and only slowly accumulate site changes (14). Salmonella MLST is mainly applied to understand the hereditary backgrounds, origins and diversification of the various Salmonella sub-strains.

In the present study, the serotypes, MLST, drug resistance, integrin class and distribution of 52 clinical isolates of non-duplicated Salmonella which is not genome contamination from children with diarrhea were analyzed. Specifically, the possible correlation among the allelic profiles of the housekeeping genes aroC, dnaN, hemD, hisD, purE, sucA and thrA and the Salmonella eBrust Groups (eBGs) and serotypes for potential Salmonella serovar prediction were focused upon. In addition, the association between drug resistance and integrin distribution of the Salmonella strains was investigated.

In order to aid clinicians in improving the clinical prevention and treatment of Salmonella infection, 1,725 diarrhea samples from children were collected to isolate the Salmonella strain in the present study. The drug sensitivities of those Salmonella strains were detected focusing on 12 different antibiotics. Total Salmonella genome DNA (gDNA) were extracted for MLST analysis of characteristics of Salmonella. After sequence analysis, eBURST analysis was applied for the various Salmonella sequence types (STs). The class I, II, and III integron distribution was also analyzed to map the integrated substructures of the integrons.

Materials and methods

Strain conservation

The present study was approved by the Medical Ethics Committee of Qingyuan People's Hospital, Qingyuan, China (approval no. A0051). Written informed consent was obtained from each participant's legal guardian. In total, 52 ‘non-duplicate’ (confirmed as not a biological contamination) Salmonella strains were harvested from the feces of children (age, 3 months to 14 years) with diarrhea between September 2018 and April 2020 at the Department of Clinical Laboratory, The Sixth Affiliated Hospital of Guangzhou Medical University, Qingyuan People's Hospital, Qingyuan, China. Patients aged ≤14 years who were admitted to the Outpatient Department or hospitalized at Qingyuan People's Hospital due to diarrhea were selected as candidates. A total of 1,725 children (890 male and 835 female children, mean age 5.6±0.41, median age 5.1±0.69) were enrolled in our study, all of whom exhibited one or more of the following clinical manifestations: Diarrhea, fever and/or abdominal pain. The exclusion criteria were: i) Children with diarrhea presenting with watery stools, without red blood cells, white blood cells or pus cells in routine stool test; ii) with low complete blood count; and iii) with mild symptoms. The quality control strains used for antibiotic susceptibility testing were Pseudomonas aeruginosa (ATCC.27853), Staphylococcus aureus (ATCC.25923) and E. coli (ATCC.25922) (all from American Type Culture Collection) (15). The positive integron reference strain was a clinical isolation Klebsiella pneumoniae strain (1162281; GSK plc.) which contained Class I, II, and III integrons (16).

Instruments and reagents Instruments

BD Phoenix™ M50 automatic detector and bacterial drug sensitivity analysis system (BD Biosciences). NMIC/ID-4 composite board for the drug sensitivity tests (BD Biosciences). Thermal Cycler T100 (Bio-Rad Laboratories, Inc.). Gel Dox™ XR+ gel imaging system (Bio-Rad Laboratories, Inc.).

Reagents. Triple sugar iron (TSI) agar medium (Qingdao Hope Bio-Tcehnology Co.,Ltd). Bacterial group DNA extraction kit (ab288102, Abcam), 2X Taq PCR MasterMix (KT121221, Tiangen Biotech Co., Ltd.), Gel Red nucleic acid dye (SCT123, Sigma-Aldrich; Merck KGaA), and Marker I, II and III DNA ladder (MD101, MD102 and MD103; Tiangen Biotech Co., Ltd.). Primers (Sangon Biotech Co., Ltd.).

Methods Sample collection and bacterial culture

Fecal samples from children with diarrhea were collected for Salmonella isolation and identification. A small amount (10-50 mg) of feces from each child with diarrhea was collected using sterile swabs, which were placed in 9 ml selenite brilliant green sulfa enrichment broth (E-MA73; Eiken Chemical Co., Ltd.) and cultured at 36˚C for 18 h. After enrichment, 10 µl of the samples was streaked onto a Salmonella chromogenic medium agar plate (CM1007B; Thermo Fisher Scientific, Inc.), before further culture at 36˚C for 18 h. Suspected colonies that are purplish red or wine red with a diameter of 2-3 mm were selected from the plate for biochemical identification.

Serotyping by slide agglutination. Salmonella enterica isolates were cultured at 37˚C overnight. A drop of broth was dropped on a glass slides to test somatic O antigen by slide agglutination. Meanwhile, each Salmonella strain was grown on Swarm agar plates at 37˚C overnight, and single colonies were picked to test phases 1 and 2 of H antigens by slide agglutination. Diagnostic sera for Salmonella antigens were purchased from Tianrun Bio-Pharmaceutical Co. Ltd. and S&A Reagents Lab Ltd. Serotyping and biotyping were performed according to the modified Kauffmann-White scheme, which is a modification of the original scheme from the 1930s (7).

Identification of Salmonella and drug sensitivity detection. All Salmonella strains were inoculated onto TSI agar plates and cultured for 12-18 h at 37˚C. Antibiotic susceptibility test (AST) was performing using the BD Phoenix™ M100 Automated Microbiology System (BD Biosciences), a broth-based microdilution method that utilizes a redox indicator (colorimetric-oxidation-reduction) to enhance the detection of bacterial growth. AST was performed on BD Phoenix™ NMIC-502 panels (BD Biosciences). Samples were prepared and experimental conditions were set following the manufacturer's protocols. Phoenix ID broth (4 ml) was first inoculated with bacterial colonies from a pure culture adjusted to a 0.5 McFarland standard using a CrystalSpec nephelometer (BD Biosciences), before the suspension was poured into the ID side of the Phoenix panel. Bacterial growth at 37˚C in the panels was then monitored every 20 min to determine minimal inhibitory concentration (MIC) of antibiotics. The interpretation of MIC results were recorded as either susceptible (S), intermediate (I) and resistant (R) according to the 2016 CLSl M100-S26 susceptibility test guide (17). Drug resistance rate=(susceptible strain number/total Salmonella strain number) x100%.

In total, 12 different antibiotics were used base on the following antibiotic classification: i) Class A, including carbenpenems imipenem and meropenem; ii) class C, such as quinolones moxifloxacin; iii) class D, including cephalosporins cefotaxime and cefepime; iv) class E, such as broad-spectrum penicillins ampicillin, ampicillin/sulbactam, piperacillin and piperacillin/tazobactam; v) class F, including β-lactam/β-lactamase inhibitor combinations, including amoxicillin, amoxicillin/clavulanate and aztreonam; and vi) class G, including phenicols chloramphenicol.

Total bacterial DNA extraction. Salmonella genomic DNA was extracted in accordance with the protocol of the Bacterial group DNA extraction kit (ab288102; Abcam), transferred to an aseptic 1.5 ml tube and stored at -80˚C.

Primer design. In total, seven housekeeping genes of Salmonella, aroC, dnaN, hemD, hisD, purE, sucA and thrA, were chosen for MLST analysis (18). The primer sequences were designed according to the Salmonella MLST database (https://enterobase.readthedocs.io/en/latest/mlst/mlst-legacy-info-senterica.html) and are listed in Table I. Primers for the intI1, intI2, intI3 gene and variable region were designed using primer3Web (version 4.1.0; http://primer3.ut.ee/) as described previously (19) and are listed in Table II.

Table I Primer sequences used for multi-locus sequence typing.

Table I

Primer sequences used for multi-locus sequence typing.

Gene	Oligonucleotide and sequence (5'-3')	Length/bp
Chorismate synthase	F: CCTGGCACCTCGCGCTATAC	826
	R: CCACACACGGATCGTGGCG
β sliding clamp of DNA polymerase III	F: ATGAAATTTACCGTTGAACGTGA	833
	R: AATTTCTCATTCGAGAGGATTGC
Uroporphyrinogen-III synthase	F: GAAGCGTTAGTGAGCCGTCTGCG	666
	R: ATCAGCGACCTTAATATCTTGCCA
Histidinol dehydrogenase	F: GAAACGTTCCATTCCGCGCAGAC	894
	R: CTGAACGGTCATCCGTTTCTG
Phosphoribosylaminoimidazole carboxylase catalytic subunit	F: ATGTCTTCCCGCAATAATCC	510
	R: TCATAGCGTCCCCCGCGGATC
2-oxoglutarate dehydrogenase E1 component	F: AGCACCGAAGAGAAACGCTG	643
	R: GGTTGTTGATAACGATACGTAC
Homoserine dehydrogenase	F: GTCACGGTGATCGATCCGGT	852
	R: CACGATATTGATATTAGCCCG

[i] F, forward; R, reverse.

Table II Primer sequences of the three integrase genes and variable areas.

Table II

Primer sequences of the three integrase genes and variable areas.

Target gene	Oligonucleotide (5'-3')	Length/bp
Int 1	F: GGTCAAGGATCTGGATTTCG	493 bp
	R: ACATGCGTGTAAATCATCGTC
Int 2	F: CACGGATATGCGACAAAAAGGT	789 bp
	R: GTAGCAAACGAGTGACGAAATG
Int 3	F: AGTGGGTGGCGAATGAGTG	922 bp
	R: TGTTCTTGTATCGGCAGGTG
Int-variable area	5'-CS: GGCATCCAAGCAGCAAG	variable
	3'-CS: AAGCAGACTTGACCTGA

[i] F, forward; R, reverse; CS, conserved segment; int, integrase gene.

PCR for Salmonella MLST, integrase genes and variable regions. The PCR mix for the seven housekeeping genes was constructed as follows: 25 µl 2X Taq PCR MasterMix, 1 µl each of the forward and reverse primers, 2 µl Salmonella gDNA template and 22 µl ddH2O. The reaction conditions were as follows: Initial denaturation at 94˚C for 5 min; followed by 32 cycles of denaturation at 95˚C for 30 secs, annealing at 60˚C for 1 min and extension at 72˚C for 1 min; and a final extension at 72˚C for 10 min. The PCR products were visualized electrophoretically on an agarose gel using Gel Red nucleic acid dye (Sigma-Aldrich; Merck KGaA) and sent to Sangon Biotech Co., Ltd. for bidirectional Sanger sequencing.

The PCR mix for the class I, II, and III integrons comprised the following: 12.5 µl 2X Taq PCR MasterMix, 0.5 µl each of the forward and reverse primer, 0.5 µl Salmonella gDNA template and 11.5 µl ddH2O. The reaction conditions were as follows: Initial denaturation at 95˚C for 5 min; followed by 26 cycles of denaturation at 94˚C for 30 sec, annealing at 62˚C for 30 sec and extension at 72˚C for 1 min; and a final extension at 72˚C for 5 min. In total, 5 µl PCR products were loaded onto a 2% agarose gel (60 min, 80 V) and visualized using Gel Red nucleic acid dye and a gel imaging system (Bio-Rad Laboratories, Inc.).

The PCR mix for the variable regions of class I, II, and III integrons comprised the following: 25 µl 2X Taq PCR MasterMix, 0.5 µl each of the forward and reverse primer, 1 µl DNA template and ddH2O to 50 µl. The reaction conditions were as follows: Initial denaturation at 94˚C for 5 min; followed by 35 cycles of denaturation at 94˚C for 30 sec, annealing at 58˚C for 30 sec and extension at 72˚C for 2 min; and a final extension at 72˚C for 7 min. PCR products (5 µl) were visualized electrophoretically on a 1.2% agarose gel (60 min, 80 V) using Gel Red nucleic acid dye and a gel imaging system (Bio-Rad Laboratories, Inc.).

Sequence analysis of the variable regions

The PCR products (displaying bright bands) were sent to Sangon Biotech Co., Ltd. for sequencing. Corrected sequencing data were obtained by removing failed signals with Chromas software (version 2.6.6; http://technelysium.com.au/wp/chromas/). Subsequently, sequencing data were compared and analyzed using BLAST (BLAST+ version 2.10.0; https://blast.ncbi.nlm.nih.gov/Blast.cgi). Results with 100% coincidence were selected.

Genotyping analysis of Salmonella MLST

The sequencing reads were subjected to the Salmonella MLST database v1.1.3 (http://mlst.warwick.ac.uk/mlst/dbs/Senterica), before the different allele values were obtained by allele/ST query to identify the corresponding ST, yielding an allelic spectrum. The ST classification data were then uploaded onto the Pub MLST Data Analysis (http://pubmlst.org/salmonella/) tool to conduct eBURST analysis to obtain the BURST group diagram (group definition: Profiles match at n-2 loci to any other member, ‘n’ is the number of loci in the scheme). The standard of clustering used is that if four subunits in seven ST-labeled genes are the same, then they would be considered to be in the same composite clone group (20,21).

Statistical analysis

All statistical analyses were performed using SPSS software version 16.0 (SPSS, Inc.). Drug resistance was analyzed using the χ2 test. P<0.05 was considered to indicate a statistically significant difference.

Results

Serotyping

A total of 11 serotypes were obtained from the 52 Salmonella strains, including 33 strains of S. Typhimurium, five strains of S. Enteritidis, four strains of S. Stanley, three strains of S. Rigel and one strain each of S. Paratyphi A, S. Derby, S. Dublin, S. San Juan, S. Togo, S. Bisra and S. Havana (Fig. 1A and B).

Figure 1 Serotype and ST distribution of Salmonella strains in the present study. (A) Serotype distribution of the 52 Salmonella strains in the present study. (B) Pareto chart of the serotypes of 52 Salmonella strains in the present study. (C) Seven pairs of housekeeping genes as determined using PCR-based multi-locus sequence typing. (D) ST distribution of 52 Salmonella strains in the present study. (E) Pareto chart of ST of 52 Salmonella strains in the present study. ST, sequence type; M, marker; aroC, chorismate synthase; dnaN, β sliding clamp of DNA polymerase III (dnaN); hemD, uroporphyrinogen-III synthase; hisD, histidinol dehydrogenase; purE, phosphoribosylaminoimidazole carboxylase catalytic subunit; sucA, 2-oxoglutarate dehydrogenase E1 component; thrA, homoserine dehydrogenase.

MLST results

To estimate the genetic correlations, MLST was performed. In total, seven housekeeping gene loci, namely aroC, dnaN, hemD, hisD, purE, sucA and thrA, were chosen for MLST analysis of Salmonella (Fig. 1C). A total of 52 Salmonella strains were divided into 11 STs base on MLST result (Table III), including 22 strains with ST34 (42.31%), nine strains with ST19 (17.31%), five strains with ST11 (9.62%), four strains with ST29 (7.69%), three strains with ST40 (5.77%) and ST469 (5.77%), two strains with ST27 (3.85%) and one strain with ST365 (1.92%), ST413 (1.92%), ST1499 (1.92%) and ST588 (1.92%) (Fig. 1D and E).

Table III Salmonella multi-locus sequence typing and distribution rate in 52 samples.

Table III

Salmonella multi-locus sequence typing and distribution rate in 52 samples.

Chorismate synthase	β sliding clamp of DNA polymerase III	Uroporphyrinogen-III synthase	Histidinol dehydrogenase	Phosphoribosylaminoimidazole carboxylase catalytic subunit	2-oxoglutarate dehydrogenase E1 component	Homoserine dehydrogenase	Sequence types	Distribution rate %
5	2	3	7	6	6	11	11	9.61
2	59	23	64	38	19	12	1499	1.92
10	7	12	9	5	9	2	19	17.31
5	14	79	9	6	12	17	27	3.85
186	35	78	75	39	182	97	588	1.92
16	16	20	18	5	12	18	29	7.69
10	19	12	9	5	9	2	34	42.31
130	97	25	125	84	9	101	365	1.92
19	20	3	20	5	22	22	40	5.77
15	70	93	78	113	6	68	413	1.92
92	107	79	156	64	151	87	469	5.77

Association between MLST and serotyping

Among the 52 Salmonella samples, each Salmonella serotype corresponded to ≥ one MLST type. The most common serotype and ST type were S. Typhimurium (33/52) and ST34 (22/52), respectively. These two types are the most prevalent in the South of China. The three other predominant types were S. Enteritideis, S. Stanley and S. Rigel, accounting for ~80.77% in total. In the aforementioned serotypes, four strains of ST11, nine strains of ST19, two strains of ST27, four strains of ST29, 21 strains of ST34 and two strains of ST40 were identified, where ST34 was the most abundant ST within the S. Typhimurium subtype (63.63%), whereas ST11 was the most abundant ST of S. Enteritidis (80%; Table IV).

Table IV Salmonella ST type corresponding to each serotype in 52 samples.

Table IV

Salmonella ST type corresponding to each serotype in 52 samples.

Serotypes	ST types (number of strains)
Salmonella	ST19(9), ST29(2), ST34(21), ST40(1)
Typhimurium
Salmonella	ST11(4), ST40(1)
Enteritis
Salmonella	ST29(2), ST27(2)
Stanley
Salmonella	ST469(3)
Rigel
Salmonella	ST365(1)
Paratyphi A
Salmonella	ST34(1)
Togo
Salmonella	ST1499(1)
Bisra
Salmonella	ST413(1)
San Juan
Salmonella	ST40(1)
Derby
Salmonella	ST11(1)
Dublin
Salmonella	ST588(1)
Havana

[i] ST, sequence type.

Analysis of the similarity, variability and evolutionary relationships among different ST types of Salmonella

eBURST is an algorithm that can identifies groups of closely associated sequence types from MLST data (20). It was used to analyze the possible similarity, variability and evolutionary relationships among different ST types of Salmonella in the present study. The genetic backgrounds were found to be diverse among the STs identified in the present study. In total, 11 STs belonged to 10 different eBURST groups (eBGs). Further analysis also indicated that ST19 and ST34 are part of the same composite group (eBG1) sharing a high genetic relationship (Fig. 2).

Figure 2 eBURST diagram for the STs. eBURST was used to analyze the similarity, variability and evolutionary relationships among the different ST types of Salmonella. The eBURST diagram was generated using the STs of 52 Salmonella samples in the present study. ST19 and ST34 formed a composite group (eBG1) with a high genetic relationship. ST, Sequence type; eBG, eBURST group.

Association between class I integrons and anti-bacterial resistance and anti-microbial resistance profile

Among the 52 Salmonella strains, 20 harbored class I integrase, where the detection rate was 38.46% (20/52). However, none of the 52 strains harbored class II or III integrons (Fig. 3A and B). The resistance rates of strains harboring class I integrons toward ampicillin, ampicillin/sulbactam, chloramphenicol and moxifloxacin were found to be significantly higher compared with those of class I intergroup-negative strains (P<0.05). Neither class I integron-positive nor class I integron-negative strains were resistant to amoxicillin/clavulanate, meropenem, piperacillin/tazobactam or imipenem. The resistance rates of class I integron-positive strains to aztreonam, piperacillin, cefepime and cefotaxime were increased compared with those of class I integron-negative strains, but no significance were found (Table V).

Figure 3 PCR for integrin and multi-locus sequence typing. (A and B) In total, 20 strains harboring the class I integrase gene following PCR. (A) Lane 2-15 and (B) lane 3-8 represent class I integron-positive samples. Lane 1 in (A) and lanes 1 and 2 in (B) represent positive controls (Klebsiella pneumonia gDNA as template). Lane 16 in (A) and lane 9 in (B) are negative controls (E. coli ATCC 25922 gDNA as template). Lane 10 in (B) is a blank control. (C) Variable regions in nine strains revealed through PCR analysis. Lanes 1 and 2 represent positive controls (Klebsiella pneumonia gDNA as template), Lanes 4-7 represent variable region-positive samples. Lane 3 represent negative control (E. coli ATCC 25922 gDNA as template). Lane 8 represents blank control.

Table V Drug resistance phenotypes between 52 Salmonella profile I integron-positive and -negative strains.

Table V

Drug resistance phenotypes between 52 Salmonella profile I integron-positive and -negative strains.

		Profile Ⅰ integron positive strains (n=20)			Profile Ⅰ integron negative strains (n=32)
Antibiotic	DRR (%)	DRR (%)	IR (%)	SR (%)	DRR (%)	IR (%)	SR (%)	P-valuea
Amoxicillin/Clavulanate	0.0	0.0	13.3	86.7	0.0	0.0	100.0	-
Ampicillin	51.9	75.0	0.0	25.0	37.5	0.0	62.5	<0.05
Ampicillin/Sulbactam	19.2	40.0	35.0	25.0	6.25	28.1	65.6	<0.05
Aztreonam	13.5	15.0	0.0	85.0	12.5	0.0	88.5	>0.05
Chloramphenicol	34.6	70.0	0.0	30.0	12.5	3.1	84.4	<0.05
Meropenem	0.0	0.0	0.0	100.0	0.0	0.0	100.0	-
Moxifloxacin	3.8	10.0	30.0	60.0	0.0	9.4	90.6	<0.05
Piperacillin	48.1	65.0	10.0	25.0	37.5	3.1	59.4	<0.05
Piperacillin/Tazobactam	0.0	0.0	0.0	100.0	0.0	0.0	100.0	-
Cefepime	14.0	20.0	0.0	80.0	10.7	0.0	89.3	<0.05
Cefotaxime	17.3	25.0	0.0	75.0	12.5	0.0	87.5	<0.05
Imipenem	0.0	0.0	5.0	95.0	0.0	12.5	87.5	-

[i] ^aχ2 test. DRR, Drug resistance rate; IR, Intermediary rate; SR, sensitivity rate.

Drug resistance gene cassette distribution of class I integron-positive strains

A total of three class I integrin-positive strains and one class I integron-negative strain (four strains in total) were sent for genome sequencing (Fig. 3C), where 12 drug resistance gene cassettes were detected (Table VI; Fig. 4). The actual drug resistance genes of the successfully sequenced strains and the variable regions in the gene cassette are summarized in Fig. 4. The integrated substructure is presented in Fig. 4. The drug resistance rates of Salmonella class I integrin-positive strains against ampicillin, ampicillin/sulbactam, chloramphenicol, moxifloxacin, piperacillin, cefepime and cefotaxime were significantly higher than those of the negative strains (P<0.05), indicating that the mechanism underlying the acquisition of drug resistance in Salmonella was closely related with the presence of class I integrons (Table V). However, the resistance rates of class I integron-negative Salmonella strains to aztreonam, moxifloxacin were similar to class I integrin-positive strains (Table V), indicating that multidrug resistance among Salmonella strains is not only associated with class I integrons but also with other drug resistance mechanisms which needs further investigation.

Figure 4 Integrated substructures of the integrons in the present study. Among the 52 Salmonella strains, 20 harbored class I integrases, where the detection rate was 38.46% (20/52), but none of the 52 strains harbored class II or class III integrons. White circle, integration site attI; black circle, integration site attC. CS, conserved sequences; Dfr, dihydrofolate reductase; Orf, open reading frame; aad, aminoglycoside-adenylyltransferase; int, integrase; cadA2, cadmium-translocating P-type ATPase 2; InuF, lincosamide.

Table VI Comparison between drug resistance phenotypes and variable region gene boxes.

Table VI

Comparison between drug resistance phenotypes and variable region gene boxes.

Sample number	Resistance phenotypea	Size of the variable area (bp)	Combination of the variable region gene box
19	b, d, e, f	2800	dfrA12, orfF and aadA2
35	b, d, e, h	2600	dfrA17 and aadA5
41	b, d, e, g, h	3000	aadA2, aadA22, aadA23 aadA1, cadA2 and lnuF, linF

[i] ^aDivided into nine categories: Class a is carbocylase dilutes, including imipenem and meropenem (MEM); class b is aminoglycosides, such as gentamicin and amikacin; class c is quinolones, such as ciprofloxacin, levofloxacin and ciprofloxacin; class d is cephalosporins, including cefazoxime, ceftazidime, cefotaxime and cefepime; class e is a broad-spectrum penicillin, such as ampicillin/sulbactam, piperacillin/tazobactam, ampicillin and piperacillin; class f is β-lactam, including aztreonam and amoxicillin/clavicularulanic acid; class g is sulfonamides, such as compound neomin (SXT); class h represents tetracyclines; and class i represents amides and alcohols, including chloramphenicol. Dfr, dihydrofolate reductase; Orf, open reading frame; aad, aminoglycoside-adenylyltransferase; cadA2, cadmium-translocating P-type ATPase 2; InuF, lincosamide.

Discussion

Salmonella is a highly versatile pathogen that can infect a wide range of hosts and cause different clinical manifestations (22). To date, >2,600 Salmonella serotypes have been reported worldwide, of which 292 different serotypes belonging to 35 different somatic (O) groups have been reported in China (23). Salmonella infections in children with diarrhea in Guangdong have been reported to be mainly caused by S. Typhimurium, S. Enteritis and S. Stanley, which belong to five separate O groups (24). However, human infections caused by non-typhoid Salmonella are becoming a global public sanitation problem, leading to ~93.8 million cases of gastroenteritis and 155,000 deaths every year (25).

In recent years, non-typhoid Salmonella is emerging as one of the main pathogens in infants in China, causing diarrhea, fever and abdominal pain (26-29). Children have immature immune systems and weak gastrointestinal systems that are particularly susceptible to Salmonella (30). In the present study, all Salmonella strains were collected from the fecal specimens of children with diarrhea. S. Typhimurium was found to be the most common serotype in the present study, with a detection rate of 63.46% (33/52), followed by S. Enteritis and S. Stanley, with detection rates of 9.62 and 7.69%, respectively.

Quinolones and third-generation cephalosporins are currently the first-line therapeutic options for the treatment of non-typhoid Salmonella infections (31). Due to the limitations of drug administration to children, quinolones and aminoglycosides are restricted in use (32). Therefore, third-generation cephalosporin is the priority method for the treatment of children with Salmonella infections (33). In the present study, drug sensitivity results showed that the resistance rate of non-typhoid Salmonella strains was as high as 51.9% to ampicillin, >48.1% to piperacillin and certainly >17.3% to cefotaxime. These resistance rates are similar to those reported by a previous study (34). The isolated Salmonella strains had drug resistance to 3rd- or 4th-generation cephalosporins. However, amoxicillin/clavulanic acid-, piperacillin/tazobactam-, imipenem- and meropenem-resistant strains could not be detected in the present study. The treatment of infectious diarrhea should be combined with drug sensitivity testing to avoid the risk of multiple drug resistance strains arising due to the overuse of clinical antibiotics.

Integrons are important genetic factors in the capture, integration and expression of drug resistance genes and are particularly abundant in Gram-negative bacteria (35,36). Integrons can carry ≥ one drug resistance gene cassettes, which is an important mechanism of the horizontal transmission of drug resistance genes (37-39). In the present study, class I, II and III integrons and variable regions were sequenced and analyzed in the 52 non-typhoid Salmonella strains. In total, 20 strains harbored class I integrons with a positive rate of 38.46%, compared with the 57.0% reported by a previous study (40). The prevalence of integrons found in Salmonella varies from country to country and depends on the origin of the isolates (41). There have been several reports associating the prevalence of Class I integrons in Salmonella isolates from different places in China. Lu et al (42) reported that 66.5% class I integrons in Salmonella enterica serovar Indiana (87.2%) and Enteritidis (50.8%) were isolated from chicken samples in Eastern China. In addition, class I integrons were detected in 26.9% of the broiler chicken in Shandong, China (43), whilst 34.7% class I integron-positive Salmonella were isolated in duck farms and in a slaughterhouse in Shandong province, China (44). However, another previous study reported only 16.9% positivity in terms of class I integrons in Salmonella isolated from farm animals in Shandong province, China (45). Zhang et al (46) also reported that 17.4% Salmonella isolated from healthy humans were positive for class I integrons in Guangdong in China.

In the present study, 12 types of drug resistance gene cassettes were detected, namely dfrA12, orfF, aadA2, drfA17, aadA5, aadA2, aadA22, aadA23, aadA1, cadA2, InuF and linF. However, Class II and III integrons could not be detected in the present study. The class I integron-positive strain antibiotic resistance rate was found to be significantly higher compared with that of the integron-negative strains, except for sensitivity to amoxicillin/clavulanic acid, piperacillin/tazobactam and imipenem, according to the drug susceptibility analysis. These results suggest that integron gene-positive strains are associated with significant multidrug resistance, consistent with previous reports (47,48). Class I integrons greatly increase the risk of horizontal drug resistance gene transmission due to their mobile and integration features (49). The cautious use of antimicrobial agents is essential for preventing the emergence and spread of drug-resistant strains of bacteria (50). The integron-positive and antibiotic-resistant genes found in the Salmonella isolates in the present study may contribute to the control and therapy of Salmonella infection. However, further studies are necessary to determine the significance of class I integron in the distribution of antibiotic resistance.

MLST is a high-resolution typing technique first proposed by Maiden et al (12) in 1998, which was developed based on the technique of multi-site enzyme electrophoresis. Harbottle et al (51) then used PFGE and MLST to type 81 strains of Salmonella enteritis, indicating that MLST was a suitable technique for the typing of the different Salmonella serotypes. Although MLST has advantages that can potentially replace and supplement serotyping, the principle of MLST is different from that of serotype detection. The combination of MLST and serotype detection can facilitate research on the hereditary and evolutionary relationships of Salmonella. The most common Salmonella sequence types were found to be ST19 and ST34 in the present study, where the corresponding serotype was S. Typhimurium. This is consistent with findings from a previous report, where the most prevalent Salmonella subtypes found were ST34 and ST19 in the Guangdong province in 2007-2011(52). Observations from the present study therefore provided important evidence and confirmed further that these two types of Salmonella can serve an important role in pediatric diarrhea in Guangdong, China. Since the drug resistance characteristics of predominant Salmonella ST and genetic drift between various Salmonella ST could guide the clinical antibiotic treatment of Salmonella infection and epidemics, the present study may lay a foundation for a therapeutic strategy for pediatric diarrhea caused by Salmonella infection in the future.

The characteristics of Salmonella infection differ depending on the region. S. paratyphoid A tended to dominate in Yunnan from 1995 to 2013, where the dominant sequence types were ST85 and ST129(53). By contrast, the prevalent sequence types were found to be ST11 and ST34 in Nanjing in 2014-2015(54). In the present study, ST34 corresponded to S. Typhimurium and S. Togo, while ST29 corresponded to S. Stanley and S. Typhimurium. In addition, although ST34 and ST29 were two different sequence types, they both belong to the serotype group B (13), suggesting that these strains may have been subjected to convergent evolution and are variations of the same strain. According to eBURST cluster analysis, ST19 and ST34 were highly associated, with only one pair of housekeeping genes that were different. Among the housekeeping genes, thrA comprised the largest number of alleles in the seven groups of the ST types of 52 Salmonella strains. By contrast, the least common was sucA, suggesting that sucA was the most stable.

The present study suggests that multi-drug resistance is closely associated with the presence of class I integrons in isolated Salmonella strain. the isolated Salmonella strains are particular resistant to ampicillin (51.9%), chloramphenicol (34.6%) and piperacillin (48.1%). This is consistent with results from a previous study conducted in Guangdong, China (52). This finding may facilitate the design of Salmonella antibiotics for clinical practice. In particular, since class I integrons appear to serve an important role in the acquisition of drug resistance, they warrant immediate attention. Furthermore, the present data show that MLST can be used for clinical Salmonella genotyping. Due to the rapid emergence of multi-drug resistance in Salmonella, further studies are required to investigate the mechanism underlying bacterial drug resistance, strictly monitor susceptible factors, control bacterial drug resistance, strengthen disinfection and isolation methods in clinical practice.

However, the present study remains associated with a number of limitations. The number of cases examined in the present study is small. In addition, the characterization of multi-drug resistance was not performed, where the mechanism of antibiotic resistance, virulence and transfer of resistance genes were evaluated in the present study. The sensitivity and specificity of the results of genotyping analysis of Salmonella MLST were also not considered.

To conclude, Salmonella infection in children with diarrhea was mainly caused by S. Typhimurium, where the most prominent sequence types were ST34 and ST19. The class I integrons found were closely associated with Salmonella drug resistance. Deepening the research into integrons is expected to serve an important role in understanding the occurrence and transmission mechanism of Salmonella drug resistance. Particular attention should be given to the 3rd- and 4th-generation cephalosporin resistance of Salmonella.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by grants from the Natural Science Foundation of China (grant no. 31770183) and the Medical Science Technology Research Foundation of Guangdong (grant no. A2015226), Guangdong Provincial Bureau of Traditional Chinese Medicine (grant no. 20201407) and Qingyuan People's Hospital Medical Scientific Research Fund Project (grant no. 20190209).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

LX and QH performed the molecular genetic studies and participated in the sequence alignment. YT and WW performed species identification. LC and YL performed the antibiotics susceptibility tests. YT and WW performed the PCR. CY and BF conceived the study and participated in its design and coordination. LX and BF confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Medical Ethics Committee of Qingyuan People's Hospital (Qingyuan, China). Written informed consent was obtained from each participant's legal guardian.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References