This article is mentioned in:

Introduction

Dementia, which features memory loss and cognitive decline, severely influences daily life (1). As a most common contributor to dementia, Alzheimer's disease (AD) accounts for 50-75% of dementia cases (2). AD, which is a common progressive neurodegenerative disease, features the formation of extracellular amyloid plaques as well as intracellular neurofibrillary tangles (3). An increasing number of researches have shown that the neuroinflammation of AD has a close association with neurological dysfunction, which is mediated by the progressive activation of glial cells and the consequent overproduction of pro-inflammatory cytokines (4,5). In AD, neuroinflammation acts as a major element in disease advancement, which features the activities of brain resident glial cells, particularly microglia (6). The over-activated microglia can promote the release of inflammatory cytokines, chemokines, and oxygen/nitrogen radicals, thereby exacerbating the neuronal damage (7,8).

The dedicator of cytokinesis (DOCK) proteins, which are the members of the family of atypical guanine exchange factors, can trigger ρGTPases Rac1 and/or Cdc42 and serve as critical players in cellular activities, such as cell migration, neuronal polarization as well as neuroprotection (9). DOCK8, which belongs to DOCK family of proteins, is highly expressed in B cells as well as T cells and has been widely investigated in immune system (9,10). In addition, DOCK8 exists in microglia and can regulate the advancement of neurodegenerative diseases (11). The depletion of DOCK8 imparts alleviative effects on the migration and function of immune cells (12). DOCK2, another member of DOCK family of proteins, is involved with the advancement of AD (13,14). Nevertheless, the role that DOCK8 played in AD remains to be elucidated.

In the present study, Aβ1-42 (Aβ) was used for the stimulation of BV2 cells to induce inflammatory damage. The present study was performed to discuss the role of DOCK8 in Aβ-induced BV2 cells and to elucidate its hidden regulatory mechanism in alleviating hippocampal neuronal damage.

Materials and methods

Cell culture and treatment

BV2 microglia cells and hippocampal HT22 cells provided by Shanghai Hongshun Biotechnology Co., Ltd were cultivated in modified Eagle's medium (MEM; Thermo Fisher Scientific, Inc.) which contained 10% fetal bovine serum (FBS; Guangzhou Perseco Biotechnology Co., Ltd.) and 1% penicillin/streptomycin and were placed in a humid atmosphere at 37˚C in the presence of 5% CO2. To stimulate inflammatory damage, 10 µM Aβ oligomers (GL Biochem) was administered to BV2 cells for 24 h at 37˚C and the culture medium was considered as conditioned medium (CM) (1). With the purpose of further discovering the mechanism of DOCK8 in STAT3 signaling, STAT3 activator Colivelin (0.5 µM) was applied to BV2 cells with Aβ induction (15). To activate HT22 cells, cells were plated in 96-well plates (1.5 x104/well) in serum-free culture medium were treated with BV2 CM for 24 h at 37˚C (16).

Cell transfection

To deplete DOCK8 expression, 100 nM small interfering RNAs (siRNA) specific to DOCK8 (siRNA-DOCK8-1, CGGAAAAACCAAGGAAGTTCAGA; siRNA-DOCK8-2, CTCTGAAGTTTGAGATTGAAATT) as well as its negative control (siRNA-NC, CCCGATTTCCGAGAATTCTCATTCA) provided by Shanghai GeneChem Co., Ltd. were transfected into BV2 cells or HT22 cells seeded into 6-well plates (2x105 cells/well) using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 48 h at 37˚C according to the manufacturer's protocols. At 48 h following transfection, the transfection efficacy was tested with reverse transcription-quantitative polymerase chain reaction (RT-qPCR).

Immunofluorescence (IF) staining

Following Aβ induction, BV2 cells were subjected to 4% paraformaldehyde for 20 min at room temperature and 0.2% Triton X-100 permeation for 20 min at room temperature. Subsequently, the PBS-rinsed cells were blocked with 1% bovine serum albumin at room temperature. The overnight exposure of cells to primary antibodies targeting IBA-1 (ab178846; 1:500; Abcam) and CD11b (ab184308; 1:500; Abcam) was performed at 4˚C, followed by probing with rabbit anti-mouse IgG H&L (ab6728; 1:1,000; Abcam) at 37˚C for 30 min. After nuclear staining with DAPI (Shenzhen Ziker Biotechnology Co., Ltd.) for 10 min at room temperature, a fluorescence microscope (Olympus Corporation) was used to capture images.

Enzyme-linked immunosorbent assay (ELISA)

Using ELISA kits (Shanghai Xitang Biotechnology, China), the levels of inflammatory cytokines TNF-α (cat. no. F11630), IL-1β (cat. no. F10770) and IL-6 (cat. no. F10830) in cell supernatants were detected according to the manufacturer's protocols. Optical density (OD) value was resolved at λ=450 nm using a microplate reader (Molecular Devices, LLC). The results were calculated according to the standard curve.

Wound healing assay

The migrative capability of Aβ-induced BV2 cells was assessed using wound healing assay. Initially, BV2 cells were cultured in 6-well plates using serum-free medium until 95% confluence was achieved. Thereafter, a wound in the cell monolayer was created with a 10-µl pipette tip. The BV2 cells were rinsed with PBS and cultured at 37˚C in the presence of 5% CO2. At 0 and 24 h, images of the wound areas were captured by a light microscope (Olympus Corporation). Image J software (Version 1.52r; National Institutes of Health) was used to visualize the of migrative cells.

Transwell assay

The invasive capability of Aβ-induced BV2 cells was estimated using Transwell assay. The upper compartment of the Transwell was coated with Matrigel (BD Biosciences) at 37˚C for 30 min and used for BV2 cells. Medium, with 10% FBS, was added to the low chamber. Invaded BV2 cells were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for 20 min at room temperature. The area of invaded cells was tracked using a light microscope (Olympus Corporation).

Cell Counting Kit-8 (CCK-8) assay

BV2 cells in 96-well plates were cultured for 24 h at 37˚C. CCK-8 reagent (10 µl; Beyotime Institute of Biotechnology) was added and the cells cultured for another 2 h at 37˚C. A microplate reader (Molecular Devices, LLC) was used to assess absorbance at 450 nm.

Terminal-deoxynucleotidyl transferase mediated nick end labeling (TUNEL)

The apoptosis level of BV2 cells was assessed using TUNEL staining (Beyotime Institute of Biotechnology). Paraformaldehyde (4%) and Triton X-100 (0.5%) was used to treat BV2 cells for 15 and 20 min respectively at room temperature. Subsequently, the cells were labeled with TUNEL for 1 h at 37 ˚C. The counterstaining of cells with 1 µg/ml DAPI was performed at 37˚C for 30 min in the dark. The observation of positive cells in five randomly selected fields was performed under a florescent microscope (Olympus Corporation).

RT-qPCR

Total RNA was isolated from sample cells placed in a 6-well plate (6x104 cells/well) with TRIzol® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols and reverse transcribed into cDNA using the RevertAid cDNA Synthesis kit (Beijing Zhijie Fangyuan Technology Co., Ltd.) according to the manufacturer's protocols. PCR reactions were performed using iTaq Universal SYBR Green kit (Bio-Rad Laboratories, Inc.) on the MX3000p PCR system (Agilent Technologies, Inc.) according to the manufacturer's protocols. RT-qPCR was performed at 50˚C for 2 min and 95˚C for 2 min, followed by 40 cycles at 95˚C for 15 sec and 60˚C for 1 min. The calculation of relative gene expression was operated with the 2-ΔΔCq (17). The primer sequences were: DOCK8 forward primer: 5'-GGCTGACAGATGAGGCTGG-3', reverse primer: 5'-TCAAAGTCCACTGGCTCGAC-3'; inducible nitric oxide synthase (iNOS) forward primer: 5'-AGGGCCACCTCTACATTTGC-3', reverse primer: 5'-CCCAAGCCATCATTGGGAGT-3'; CD86 forward primer: 5'-TCAATGGGACTGCATATCTGCC-3', reverse primer: 5'-GCCAAAATACTACCAGCTCACT-3' or GAPDH forward primer: 5'-GCCTCCTCCAATTCAACCCT-3', reverse primer: 5'-CTCGTGGTTCACACCCATCA-3'. GAPDH was designated as a standard internal control for relative gene expression. This experiment was repeated three times.

Western blotting

Total proteins were isolated from samples with RIPA lysis buffer (Beyotime Institute of Biotechnology), after which was the concentration quantification applying a bicinchoninic acid (protein assay kit (Shanghai Yisheng Biotechnology Co., Ltd.). The proteins (30 µg) were separated by 8% SDS-PAGE, transferred to PVDF membranes and blocked by 5% non-fat milk at room temperature for 1 h. Subsequently, the overnight cultivation of membranes with primary antibodies was performed at 4˚C, after which was the probe with HRP-labeled rabbit anti-mouse secondary antibody (cat. no. 7074P2; 1:5,000; Cell Signaling Technology, Inc.) at room temperature for 2 h. Finally, the visualization and analysis of protein blots were performed with ECL (Yeasen Biotech) and ImageJ (Version 1.52r; National Institutes of Health). GAPDH was used as the loading control. The following primary antibodies were used: anti-DOCK8 (cat. no. 39263S; 1:1,000), anti-CD86 (cat. no. 19589S; 1:1,000), anti-iNOS (cat. no. 13120S; 1:1,000), anti-NOD-like receptor family pyrin domain containing 3 (NLRP3; cat. no. 15101S; 1:1,000), anti-apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC; cat. no. 67824T; 1:1,000), anti-caspase1 (cat. no. 24232S; 1:1,000), anti-p-p65 (cat. no. 3033T; 1:1,000), anti-p65 (cat. no. 8242T; 1:1,000), anti-Bcl2 (cat. no. 3498T; 1:1,000), anti-Bax (cat. no. 14796S; 1:1,000), anti-cleaved caspase3 (cat. no. 9664T; 1:1,000), anti-caspase3 (cat. no. 9662S; 1:1,000) and anti-GAPDH (cat. no. 5174T; 1:1,000) antibodies were from by Cell Signaling Technology, Inc. Anti-p-STAT3 (cat. no. ab76315; 1:2,000) and anti-STAT3 (cat. no. ab68153; 1:2,000) antibodies were purchased from Abcam.

Statistical analysis

Data were given as mean ± standard deviation (SD) and were analyzed using GraphPad Prism 8.0 software (Dotmatics). One-way ANOVA and Tukey's post-hoc test was used for comparisons between multiple groups. P<0.05 was considered to indicate a statistically significant difference.

Results

DOCK8 expression increases in Aβ-induced BV2 cells

Initially, Aβ was used for the induction of BV2 cells and IF adopted to analyze IBA-1 expression. Compared with the Control group, Aβ induction elevated IBA-1 expression in BV2 cells in a time-dependent manner (Fig. 1A). Results obtained from RT-qPCR and western blotting demonstrated that the mRNA and protein expression levels of DOCK8 in BV2 cells were enhanced by Aβ stimulation compared with the Control group (Fig. 1B and C). It was evident that DOCK8 was increased in Aβ-induced BV2 cells.

Figure 1 DOCK8 expression is increased in Aβ-induced BV2 cells. (A) The expression of IBA-1 was detected using IF staining. Magnification, x200. The mRNA and protein expression levels of DOCK8 were detected using (B) Reverse transcription-quantitative PCR and (C) western blotting. **P<0.01 and ***P<0.001 vs. control. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β.

DOCK8 interference inhibits the activation and inflammatory factors release of Aβ-induced BV2 cells

To decrease DOCK8 expression, siRNAs specific to DOCK8 were transfected into BV2 cells and then RT-qPCR was used to the test transfection efficacy. As shown in Fig. 2A, the expression of DOCK8 in BV2 cells declined after transfection with siRNA targeting DOCK8 when compared to the Control group. Notably, DOCK8 had lower expression in siRNA-DOCK8-2 group than that in siRNA-DOCK8-1 group, thus siRNA-DOCK8-2 was adopted the following experiments. Compared with the Control group, Aβ stimulation markedly increased IBA-1 expression, which was then decreased by DOCK8 interference (Fig. 2B). In addition, the increased levels of TNF-α, IL-6 and IL-1β in BV2 cells caused by Aβ induction were decreased after decreasing DOCK8 expression (Fig. 2C), suggesting that DOCK8 silence imparted a suppressive effect on the inflammatory response of Aβ-induced BV2 cells.

Figure 2 DOCK8 interference inhibits the activation and inflammatory factors release of Aβ-induced BV2 cells. (A) The transfection efficacy was detected using reverse transcription-quantitative PCR. ***P<0.001 vs. siRNA-NC. (B) The expression of IBA-1 in transfected cells was detected using immunofluorescence staining. Magnification, x200. (C) The levels of inflammatory cytokines were detected using ELISA. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-NC. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; siRNA, short interfering RNA; NC, negative control; IBA-1, ionized calcium binding adapter molecule-1.

DOCK8 interference inhibits the migration and invasion of Aβ-induced BV2 cells

In contrast to the Control group, the migrative ability of BV2 cells was markedly increased by Aβ stimulation. Nevertheless, DOCK8 silencing imparted suppressive effects on the migration of Aβ-induced BV2 cells, as evidenced by reduced migrative ability in the Aβ + siRNA-DOCK8 group compared with the Aβ + siRNA-NC group (Fig. 3A). Additionally, the enhanced invasion of Aβ-induced BV2 cells subsequently declined following siRNA DOCK8 expression (Fig. 3B). The above results demonstrated that DOCK8 interference inhibited the migration and invasion of Aβ-induced BV2 cells.

Figure 3 DOCK8 interference inhibits the migration and invasion of Aβ-induced BV2 cells. (A) The migration was detected using wound healing assay. Magnification, x100. (B) The invasion was detected using Transwell assay. Magnification, x100. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-NC. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; siRNA, short interfering RNA; NC, negative control.

DOCK8 interference inhibits the polarization of Aβ-induced BV2 cells to M1 cells

Results from IF staining showed that Aβ stimulation conspicuously increased the level of CD11b compared with that in the Control group while DOCK8 deficiency showed opposite effects on this protein, evidenced by reduced CD11b content in Aβ + siRNA-DOCK8 in comparison with that in Aβ + siRNA-NC group (Fig. 4A). Elsewhere, the expression levels of iNOS and CD86 in BV2 cells assessed with RT-qPCR and western blotting were notably elevated by Aβ induction and then reduced following interfering DOCK8 expression (Fig. 4B and C). Collectively, DOCK8 interference inhibited the polarization of Aβ-induced BV2 cells to M1 cells.

Figure 4 DOCK8 interference inhibits the polarization of Aβ-induced BV2 cells to M1 cells. (A) The expression of CD11b was detected using immunofluorescence staining. Magnification, x200. The expression levels of iNOS and CD86 using (B) reverse transcription-quantitative PCR and (C) western blotting. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-NC. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; CD, cluster of differentiation; iNOS, inducible nitric oxide synthase; siRNA, short interfering RNA; NC, negative control.

DOCK8 interference inhibits STAT3/NLRP3/NF-κB signal in Aβ-induced BV2 cells

Compared with the Control group, Aβ induction remarkably increased the expression of p-STAT3, NLRP3, ASC, caspase1 and p-p65. Nonetheless, DOCK8 depletion decreased the contents of the above proteins in Aβ-induced BV2 cells when compared to the Aβ + siRNA-NC group (Fig. 5). Notably, both Aβ induction and DOCK8 silencing had no significant effects on the contents of STAT3 and p65. The above results suggested that DOCK8 interference inhibited the STAT3/NLRP3/NF-κB signaling pathway in Aβ-stimulated BV2 cells.

Figure 5 DOCK8 interference inhibits STAT3/NLRP3/NF-κB signaling in Aβ-induced BV2 cells. The expression levels of STAT3, p-STAT3, NLRP3, ASC, caspase1, p-p65 and p65 were detected using western blotting. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-NC. DOCK8, dedicator of cytokinesis 8; NLRP3, NLR family pyrin domain containing 3; Aβ, amyloid β; p-, phosphorylated; siRNA, short interfering RNA; NC, negative control.

DOCK8 interference inhibits the activation and release of inflammatory factors in Aβ-induced BV2 cells via inactivation of STAT3/NLRP3/NF-κB pathway

To further investigate the mechanism of DOCK8 in STAT3 signal, Colivelin, which is an activator of STAT3, was administered to BV2 cells. Results obtained from western blotting showed that the decreased contents of p-STAT3, NLRP3, ASC, caspase1 and p-p65 in Aβ-induced BV2 cells caused by DOCK8 interference were partially elevated after administration with Colivelin (Fig. 6A). Compared with the Aβ group, the expression of IBA-1 was decreased after depleting DOCK8 expression and was subsequently rescued by Colivelin administration (Fig. 6B). Furthermore, DOCK8 interference decreased the levels of TNF-α, IL-1β and IL-6 in Aβ-induced BV2 cells compared with the Aβ group while Colivelin exhibited opposite effects on these inflammatory cytokines, as testified by increased levels of TNF-α, IL-1β and IL-6 in Aβ + siRNA-DOCK8+STAT3 activator group (Fig. 6C). To conclude, DOCK8 interference suppressed the activation and inflammation of Aβ-induced BV2 cells by blocking STAT3/NLRP3/NF-κB pathway.

Figure 6 DOCK8 interference inhibits the activation and inflammatory factors release of Aβ-induced BV2 cells by suppressing STAT3/NLRP3/NF-κB signaling. (A) The expression levels of STAT3, p-STAT3, NLRP3, ASC, caspase1, p-p65 and p65 were detected using western blotting. (B) The expression of IBA-1 was detected using immunofluorescence staining. Magnification, x200. (C) The levels of inflammatory cytokines were detected using ELISA. ***P<0.001 vs. control; #P<0.05, ##P<0.01, ###P<0.001 vs. Aβ + siRNA-DOCK8. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; NLRP3, NLR family pyrin domain containing 3; p-, phosphorylated; siRNA, short interfering RNA; NC, negative control; IBA-1, ionized calcium binding adapter molecule-1.

DOCK8 interference inhibits the migration and invasion of Aβ-induced BV2 cells by suppressing STAT3/NLRP3/NF-κB pathway

In comparison with the Control group, Aβ induction markedly increased the migrative ability of BV2 cells, which then declined following transfection of cells with siRNA targeting DOCK8 (Fig. 7A). Nevertheless, the decreased migration in Aβ-induced BV2 cells was quickly enhanced by Colivelin administration, revealing that DOCK8 depletion suppressed the migrative capability of Aβ-induced BV2 cells via inhibiting STAT3 signal. Similarly, the reduced invasive ability of Aβ-induced BV2 cells was also increased after treating cells with Colivelin (Fig. 7B).

Figure 7 DOCK8 interference inhibits the migration and invasion of Aβ-induced BV2 cells by suppressing STAT3/NLRP3/NF-κB signaling. (A) The cell migration was detected using wound healing assay. Magnification, x100. (B) The cell invasion was detected using Transwell assay. Magnification, x100. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-DOCK8. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; NLRP3, NLR family pyrin domain containing 3; siRNA, short interfering RNA; NC, negative control.

DOCK8 interference inhibits the polarization of Aβ-induced BV2 cells to M1 cells by restraining STAT3/NLRP3/NF-κB pathway

Evidently, the reduced CD11b level in Aβ-induced BV2 cells that resulted from DOCK8 interference was elevated by Colivelin compared with that in Aβ + siRNA-DOCK8 group (Fig. 8A). Similarly, DOCK8 deficiency decreased the contents of CD86 and iNOS in Aβ-induced BV2 cells compared with the Aβ group and these were subsequently increased by Colivelin treatment (Fig. 8B and C). In summary, DOCK8 silencing repressed the polarization of Aβ-induced BV2 cells to M1 cells via blocking the STAT3/NLRP3/NF-κB pathway.

Figure 8 DOCK8 interference inhibits the polarization of Aβ-induced BV2 cells to M1 cells by suppressing STAT3/NLRP3/NF-κB signaling. (A) The expression of CD11b was detected using immunofluorescence staining. Magnification, x200. The expression levels of iNOS and CD86 using (B) reverse transcription-quantitative PCR and (C) western blotting. ***P<0.001 vs. control; ##P<0.01, ###P<0.001 vs. Aβ + siRNA-DOCK8. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; NLRP3, NLR family pyrin domain containing 3; CD, cluster of differentiation; iNOS, inducible nitric oxide synthase; siRNA, short interfering RNA; NC, negative control.

DOCK8 interference inhibits the neuronal activity damage and apoptosis of hippocampal HT22 cells induced by neuroinflammatory release in BV2 cells

As observed from Fig. 9A, hippocampal HT22 cells transfected with siRNA-DOCK8-1/2 presented significantly downregulated DOCK8 expression compared with the siRNA-NC group. SiRNA-DOCK8-2 was selected to perform the subsequent experiments due to the lower DOCK8 expression in HT22 cells. As Fig. 9B showed, Aβ stimulation reduced the viability of HT22 cells compared with the Control group. Nonetheless, the declined viability of Aβ-induced HT22 cells was rapidly revived after the cells were transfection with siRNA-DOCK8. Apoptosis was appraised by TUNEL and the results demonstrated that Aβ stimulation conspicuously enhanced the apoptosis level of HT22 cells compared with the Control group, which was subsequently notably diminished by DOCK8 interference (Fig. 9C and D). Moreover, Aβ stimulation decreased Bcl2 content but markedly increased the contents of Bax and cleaved caspase3 compared with the Control group, while DOCK8 depletion exhibited opposite effects on these proteins, evidenced by elevated Bcl2 content as well as diminished contents of Bax and cleaved caspase3 in Aβ + siRNA-DOCK8 group (Fig. 9E).

Figure 9 DOCK8 interference inhibits the neuronal activity damage and apoptosis of hippocampal HT22 cells induced by neuroinflammatory release in BV2 cells. (A) The transfection efficacy was detected using reverse transcription-quantitative PCR. ***P<0.001 vs. siRNA-NC. (B) The viability was detected using CCK-8. (C-D) The apoptosis was detected using terminal-deoxynucleotidyl transferase mediated nick end labeling. Magnification, x200. (E) The expression levels of apoptosis-related proteins were detected using western blotting. ***P<0.001 vs. control (CM); ##P<0.01, ###P<0.001 vs. Aβ + siRNA-NC (CM). DOCK8, dedicator of cytokinesis 8; siRNA, short interfering RNA; NC, negative control; CM, conditioned medium.

Discussion

Extensive studies evidence that neuroinflammation acts as a predominant player in the pathogenesis of AD as well as other neurodegenerative disorders (4,18,19). Accumulated Aβ deposition can be a marker of AD and the aggregation of Aβ peptide can trigger microglia (19). In addition, the triggered microglia can stimulate inflammatory response including the secretion of inflammatory factors, thereby contributing to brain damage (20). IBA-1, which is a microglia/macrophage-specific marker, has been broadly used for microglial assessment (21-23). IBA-1 is increased in activated microglia (24,25), which indicates that the upregulation of IBA-1 could serve as a hallmark for microglial activation (26,27). Therefore, the present study used Aβ to stimulate BV2 microglia cells to induce inflammatory damage in vitro and then used IF staining to resolve the expression of IBA-1. It was discovered that Aβ induction elevated the level of IBA-1, suggesting the activation of BV2 cells, which was consistent with the findings in aforementioned studies.

DOCK8, which is located on chromosome 9p24.3, is reported to be expressed in microglia (28). Previous researches have verified that DOCK8 exhibits the feature of autoimmunity and serves as an indispensable role in immune surveillance (29,30). In addition, DOCK8 has been widely considered in neurodegenerative diseases. Taking glaucoma as an instance, DOCK8 exhibits existence in microglia and mediates microglial activity in the process of neurodegeneration (11). Additionally, Xu et al (31) suggest that DOCK8 is conspicuously increased in patients suffering from multiple sclerosis. DOCK8 is acknowledged to be a critical regulator in cell migration, invasion, survival, inflammation as well as polarization. For example, the interference of DOCK8 can suppress the migrative ability of PDGF-induced Schwann cell precursor (32). A previous study demonstrated that depleted DOCK8 contributed to decreased polarization (33). Although numerous researches have been performed (11,31-33), the role that DOCK8 played in AD has not yet been elucidated. In the present study, the mRNA and protein expression levels of DOCK8 in BV2 cells were notably increased following Aβ stimulation, revealing the upregulation of DOCK8 in AD. After silencing DOCK8, a series of functional experiments were performed. The increased expression of IBA-1 in Aβ-induced BV2 cells was downregulated following silencing DOCK8, revealing that DOCK8 deficiency suppressed the activation of BV2 cells with Aβ stimulation. In addition, DOCK8 silencing also imparted suppressive effects on the inflammation, migration and invasion of Aβ-stimulated BV2 cells. Elsewhere, the decreased contents of CD11b, CD86 and iNOS in DOCK8-silenced BV2 cells with Aβ stimulation implied that DOCK8 interference repressed the polarization of Aβ-induced BV2 cells to M1 cells.

On the basis of size similarity, antigenic as well as structural relatedness, STAT3 is identified as belonging to the STAT family (34). It is reported that STAT3 possesses an anti-inflammatory property and can mediate crucial cellular activities, such as cell growth, apoptosis and transcription of inflammatory genes (35,36). Additionally, the dysregulation of STAT3 is involved with the advance of numerous malignancies and neurodegenerative diseases (37). STAT3 signaling can be activated in Aβ-induced microglia (38), which can further activate the expression of NLRP3 and NF-κB signaling, ultimately promoting the release of inflammation (39,40). Evidence indicates that DOCK8 can activate STAT3 signaling in B cells (41). The same finding has been reported by Keles et al (38); that DOCK8 can interact with STAT3 and regulates its activation in T cells. The results of the present study showed that the enhanced contents of p-STAT3, NLRP3, ASC, caspase1 and p-p65 in Aβ-induced BV2 cells were decreased following interfering DOCK8 expression, implying that DOCK8 knockdown could inhibit the STAT3/NLRP3/NF-κB signaling pathway in Aβ-induced BV2 cells. The suppressive effects of DOCK8 silencing on the activation, inflammation, migration, invasion and polarization of Aβ-induced BV2 cells were reversed by Colivelin, indicating that DOCK8 interference repressed the malignant behaviors of Aβ-induced BV2 cells by blocking STAT3/NLRP3/NF-κB signaling. Furthermore, it was found that DOCK8 deficiency promoted the viability but repressed the apoptosis of Aβ-induced HT22 cells, implying that DOCK8 silencing helped to protect against hippocampal neuronal damage. Further mechanistic studies are needed to elucidate the interaction between Aß stimulation, DOCK8 and any subsequent pathway in the future experiments, which is a limitation of the present study.

In conclusion, the present study was the first, to the best of the authors' knowledge, to discuss the regulatory role DOCK8 in AD and uncover its detailed mechanism, which lays the foundation for the study of DOCK8 in neurodegenerative diseases. However, there were also some limitations. For example, the role of DOCK8 in animal model and in clinic was not addressed in the present study; more studies need to be performed in the future.

Acknowledgements

Not applicable.

Funding

Funding: This work was supported by Special Funds for Fundamental Research Expenses of Central Universities (grant nos. 2017KFYXJJ084 and 2018KFYYXJJ113).

Availability of data and material

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Authors' contributions

XZ and QW designed the study and performed the experiments. JH and DX performed the experiments and analyzed the data. XZ and SZ interpreted the data and drafted the manuscript. QW revised the manuscript for important intellectual content. All authors have read and approved the final manuscript. XZ and QW confirm the authenticity of all the raw data.

Competing interests

The authors declare that they have no competing interests.

References