Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
August 2012 Volume 30 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August 2012 Volume 30 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Protective effects of atorvastatin against oxidized LDL-induced downregulation of KLF expression in EA.hy926 cells

  • Authors:
    • Yan Gao
    • Xian-Feng Liu
    • Xue-Chun Lu
    • Cong Ma
    • Jian Cao
    • Li Fan
  • View Affiliations / Copyright

    Affiliations: First Geriatric Cardiology Division, Chinese PLA General Hospital, Beijing 100853, P.R. China, Department of Geriatric Hematology, Chinese PLA General Hospital, Beijing 100853, P.R. China
  • Pages: 330-336
    |
    Published online on: May 14, 2012
       https://doi.org/10.3892/ijmm.2012.999
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Krüppel-like transcription factors (KLFs) play a key role in both vascular development and pathophysiological processes, but little is known about the relationship between KLFs and oxidized low-density lipoprotein (ox-LDL). We investigated the effects of ox-LDL on KLF expression. Furthermore, since atorvastatin is commonly used to treat high cholesterol, we also examined the role of this drug in the regulation of KLF expression. The human umbilical vein endothelial cell line EA.hy926 was treated with atorvastatin and ox-LDL alone or in combination, and KLF expression was examined by DNA microarray, semi-quantitative real-time PCR, western blot and immunofluorescence analyses. Atorvastatin upregulated KLF expression in EA.hy926 cells in both the quiescent and ox-LDL-induced inflammatory states, suggesting that KLFs were novel participants in the vascular endothelial dysfunction response to ox-LDL. Our study demonstrated that atorvastatin increased both the mRNA and protein levels of KLF in quiescent EA.hy926 cells. Moreover, atorvastatin counteracted the ox-LDL-induced downregulation of KLF expression.

Introduction

Oxidized low-density lipoprotein (ox-LDL) has been demonstrated to be a key molecule in the initiation and development of atherosclerotic plaque (1), which is abundant in atherosclerotic arterial walls and has numerous detrimental effects on endothelial cell function (2). Recent clinical research has shown the association between circulating ox-LDL and preclinical atherosclerosis, coronary and peripheral artery atherosclerosis, and acute coronary syndromes (ACS) (3). The level of ox-LDL in circulation is a marker of the severity and course of ACS (4). Moreover, ox-LDL levels are independently associated with higher risk of progression in lacunar strokes (5). Recent studies have identified several mechanisms by which ox-LDL exerts its atherogenic effects, including activation of endothelial cell arginase II, which decreases endothelial nitric oxide (NO) production (6) and upregulation of inflammatory genes such as tumor necrosis factor (TNF)-α (7), adhesive factors, monocyte chemotactic agents (8) and metalloproteinases (9,10). Through these mechanisms, ox-LDL facilitates endothelial dysfunction, platelet aggregation and thrombus formation, leading to augmentation of the inflammatory reaction and destabilization of the atherosclerotic plaques (11). Interestingly, low concentrations of ox-LDL appear to have an opposite effect, as in vitro studies have shown that ox-LDL at low concentration can promote angiogenesis and activate nitric oxide synthesis in human coronary artery endothelial cells (12). These contradictory data show us that the mechanism of ox-LDL activity on endothelial cells is far beyond our current understanding.

Krüppel-like factors (KLF) are a subclass of evolutionarily conserved zinc finger-containing transcription factors. The expression of KLF2 and KLF4 has been documented in endothelial cells and the overexpression of these factors induces expression of multiple anti-inflammatory and anti-thrombotic factors, including endothelial nitric oxide synthase (NOS) and thrombomodulin. KLF2 and KLF4 are also novel regulators of endothelial activation in response to pro-inflammatory stimuli (13–15); however, no studies have been performed on the role of other KLF family members in endothelial function. Because ox-LDL is one of the initial triggers of atherosclerosis, these studies led us to the question whether ox-LDL exerts its atherogenic effects by signaling through the KLF family members. KLF2 and KLF4 showed opposing effects on some factors compared with ox-LDL, including eNOS and thrombomodulin, so we hypothesized that ox-LDL might reduce KLF production in endothelial cells.

Atorvastatin is a synthetic 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor and is used to treat patients with high cholesterol. In general, statins regulate endothelial function, inhibit macrophage activities, modulate several inflammatory mechanisms involved in the atherosclerotic process and inhibit migration and proliferation of endothelial smooth muscle cells. Studies have shown that atorvastatin decreases the amount of circulating ox-LDL (16) and increases the expression of atheroprotective genes such as KLF2 (17) and its downstream targets, namely, endothelial nitric oxide synthase (eNOS) and thrombomodulin (15), so we hypothesized that atorvastatin may also modulate other KLF family members.

This study aims to investigate the effect of ox-LDL on KLF expression and the role of atorvastatin in the regulation of KLF expression with or without ox-LDL induction. To conduct our experiments, we selected EA.hy926 cells as our model of macrovascular endothelial cells.

Materials and methods

Materials

The human umbilical vein endothelial cell line EA.hy926 was purchased from the cell bank of Institute of Cellular Biology (Chinese Academy of Science, Shanghai, China). Cell culture materials were from Costar (Corning Incorporation, Corning, NY, USA). Atorvastatin was purchased from the National Institute for the Control of Pharmaceutical and Biological Products (China). Other reagents are indicated in the text.

Cell culture and reagent preparation

The EA.hy926 endothelial cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS) (Gibco-BRL, Gaithersburg, MD, USA) and 1% penicillin/streptomycin at 37°C in a humidified atmosphere containing 95% O2 and 5% CO2. Experiments were performed with cells grown to a confluency of 80%. EA.hy926 cells at passages 3–5 were used in this study. Atorvastatin was dissolved in dimethyl sulfoxide (DMSO; Sigma, St. Louis, MO, USA) (stock 10 mM) and added to the cells at the indicated concentrations for the entire incubation period. The equivalent amount of DMSO was added to the control samples. The final concentration of DMSO never exceeded 0.1% and did not affect cell viability (data not shown).

DNA microarray

After EA.hy926 cells were treated with atorvastatin (10 μM) or control (DMSO) for 24 h, gene expression profiles were determined with Affymetrix U133A plus 2.0 genechip (CapitalBio Corporation, Beijing, China), which included 47,000 characterized human genes. Each group had 3 biological repeats.

Total-RNA was isolated using TRIzol® (Invitrogen, Inc., Grand Island, NY, USA) and purified using RNeasy spin columns (Qiagen, Hilden, Germany). Total-RNA (7 μg) was used to synthesize cDNA by using the Superscript II double-stranded cDNA synthesis kit (Applied Biosystems, Carlsbad, CA, USA) and the cDNA was then used for in vitro transcription in the presence of biotin-labeled ribonucleotides (biotin-11-CTPs und biotin-16-UTPs) to yield biotin-labeled cRNA. The biotin-labeled RNA fragments were hybridized to the probe array during 16 h of incubation, and then the array was stained with streptavidin-phycoerythrin conjugate and scanned by the GeneChip® Scanner 3000. Raw data were analyzed using Affymetrix® GeneChip® Operating Software Version 1.4.

Semi-quantitative real-time polymerase chain reaction (PCR)

RNA was extracted using TRIzol and quantified by measuring the absorbance at 260 nm. Reverse transcription was performed using the One Step RT-PCR kit (Promega Corporation, Madison, WI, USA), according to the manufacturer’s instructions. cDNA samples (2 μl) were amplified in 20 μl of 1X SYBR-Green PCR master mix (Applied Biosystems) and real-time PCR was performed on duplicate samples by using the Applied Biosystems ABI PRISM® 7300 Real-Time PCR System with the following cycling parameters: initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 61°C for 31 sec. Data were normalized to human GAPDH mRNA levels as an endogenous control and were expressed relative to the DMSO-treated control using the 2-ΔΔCt method. The primers were designed using Primer Express® Primer Design Software V3.0 (Applied Biosystems) (Table I).

Table I

Primers for real-time quantitative RT-PCR.

Table I

Primers for real-time quantitative RT-PCR.

Gene namePrimer sequenceAmplicon size (bp)
GAPDHF: TGCGCAGAAAACAAGATGAG
R: CACCTTCACCGTTCCAGTTT
114
KLF2F: GCAAACGCACCGCCACTCACACCT
R: CTTCCAGCCGCAGCCGTCCCAGTT
140
KLF3F: GTGATTATGATGGATGCAACAAA
R: TTCATCAGACCGAGCAAACTT
134
KLF4F: GCGGGCTGCGGCAAAACCTACAC
R: CATCCACAGCCGTCCCAGTCACAG
104
KLF6F: AGCTCCTCTGTCACCTCCAC
R: CAGCTCCCCGGGCACGCAA
87
KLF7F: GTTTTGCACGAAGCGATGAG
R: ATGTGGAGGGCAAGATGGTC
118
KLF9F: GAAACACGCCTCCGAAAAG
R: TCACCTGTATGCACTCTGTAATGG
105
KLF13F: TCGGGAGAATACAGCTCCGATTTCT
R: TGTCCATAAAGGTACTGAAGCTG
112
Western blot analysis

Following treatment, cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with NucBuster™ protein extraction kit (Calbiochem Merck, Co., Darmstadt, Germany). Cell lysates were separated on SDS-PAGE and transferred to Whatman nitrocellulose membranes. The membranes were blocked with Blotto-Tween (5% nonfat milk and 0.05% Tween-20 in PBS) and incubated with primary antibodies against KLF2, KLF3, KLF4, KLF6 and KLF7 for 2 h at room temperature. After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies. The bands were detected by chemiluminesence detection agents. The blots were subjected to densitometry and the bands were analyzed by Gene Genius bio imaging system (Syngene, Frederick, MD, USA).

Immunofluorescence and confocal microscopy

To explore the relationship between ox-LDL and the KLFs, we used immunofluorescence with specific primary antibodies against the members of the KLF family. EA.hy926 cells were plated onto glass coverslips, which were incubated in DMEM in the presence of DMSO control (A), 10 μM atorvastatin (B), 100 μg/ml ox-LDL (C) or 10 μM atorvastatin + 100 μg/ml ox-LDL (D) for 24 h. After incubation, the cells were fixed with 4% formaldehyde for 15 min, stained with anti-KLF antibody [goat KLF2, goat KLF3 and rabbit KLF6 antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), 1/500; mouse KLF4 antibody (ProMab Biotechnologies, Inc., Richmond, CA, USA), 1:800; rabbit KLF7 antibody (Proteintech Group, Inc., Chicago, IL, USA), 1:400] at 4°C overnight, and then incubated for 30 min with fluorescein-conjugated secondary antibodies (rabbit anti-goat IgG/HRP, 1:40,000; goat anti-mouse IgG/HRP,1:80,000 and goat anti-rabbit IgG/HRP, 1:40,000). Finally, immunostaining was performed, visualized and photographed using a Leica TCS-SP confocal laser-scanning microscope (11,12).

Statistical analysis

All experiments were performed in duplicate or triplicate with at least 2 biological replicates. All data are presented as mean ± standard deviation (SD). Comparisons among groups were performed by one-way ANOVA followed by a posteriori Tukey’s test. Differences were accepted as statistically significant when P<0.05.

Results

Ox-LDL downregulates KLF expression in EA.hy926 cells

To investigate the effect of ox-LDL on KLF expression, we used immunofluorescence and confocal microscopy to assess KLF protein levels in EA.hy926 cells treated with ox-LDL. As shown in Fig. 1A and B, KLF2, KLF3, KLF4, KLF6 and KLF7 (green) were all expressed in the nuclei, which are counter-stained with DAPI. KLF production was moderate without ox-LDL stimulation; however, incubation with 100 μg/ml ox-LDL for 24 h led to a significant decrease in KLF expression. The fluorescence intensity values of KLF2, KLF3, KLF4, KLF6 and KLF7 gene expression before and after ox-LDL treatment were quantitatively analyzed and the results indicate a >2-fold decrease in KLF expression after ox-LDL treatment (Fig. 1C).

Figure 1

Effect of ox-LDL on KLF protein expression in EA.hy926 cells. (A and B) Representative immunofluorescence images are shown here. KLF expression is shown for control (DMSO) and ox-LDL (100 μg/ml) groups. Arrows in images indicate KLF protein expression. Fluorescence intensity was significantly reduced in ox-LDL group compared with DMSO control. Blue fluorescence represents nuclear staining using DAPI; grey fluorescence represent the merged image. (C) Bar graphs show the mean KLF fluorescent intensity values ± SEM (n=3 each). *P<0.05 ox-LDL vs. DMSO group. DM, DMSO.

Atorvastatin upregulates KLF expression in quiescent EA.hy926 cells
DNA microarray analysis reveals that atorvastatin elevates the expression of KLF family members

To discover the molecular mechanism for the pleiotropic effects of atorvastatin, we conducted a cell-based microarray analysis to analyze the genome-wide transcriptional changes occurring in EA.hy926 cells after exposure to 10 μM atorvastatin for 24 h. Atorvastatin increased the expression of all KLF genes by >2-fold compared to DMSO. KLF4 showed the maximum change, with >4-fold upregulation (Table II).

Table II

KLF expression in EA.hy926 cells after 24-h atorvastatin treatment.

Table II

KLF expression in EA.hy926 cells after 24-h atorvastatin treatment.

Average gray values in 3 biological repeats
Fold change (ranking)
Accession numberGene nameDMSOATaAT/DMSO
NM_016270Kruppel-like factor 2 (lung) (KLF2)4122.301504.642.74 (72)
NM_016531Kruppel-like factor 3 (basic) (KLF3)351.96841.052.38 (131)
NM_004235Kruppel-like factor 4 (gut) (KLF4)101.20433.284.27 (14)
NM_001160124Kruppel-like factor 6 (KLF6)960.312044.952.13 (225)
NM_003709Kruppel-like factor 7 (KLF7)211.80451.062.14 (215)
NM_001206Kruppel-like factor 9 (KLF9)49.81104.612.03 (276)
NM_015995Kruppel-like factor 13 (KLF13)205.64460.732.25 (170)

a AT, atorvastatin.

Real-time PCR analysis validates the effect of atorvastatin on KLF gene expression

To validate the effect of atorvastatin on KLF gene expression, we used real-time PCR to measure mRNA levels in the EA.hy926 cells treated with atorvastatin for 24 h. Under control (DMSO) conditions, KLF mRNA levels were low. Stimulation of EA.hy926 cells with 0.1–10 μM atorvastatin led to a concentration- and time-dependent increase in KLF mRNA expression that peaked 24 h after treatment with 10 μM atorvastatin (data not shown). After 24 h, the levels of KLF2, KLF4 and KLF13 mRNA were significantly higher in these cells than in the control cells (P<0.05) (as shown in Fig. 3C)

Figure 3

Relative quantification of KLF expression in EA.hy926 cells by real-time PCR and detection of KLF protein by immunofluorescence confocal microscopy. Incubation for 24 h with atorvastatin (10 μM) increases KLF mRNA and KLF protein expression in EA.hy926 endothelial cells. (A and B) Representative immunofluorescence images of KLF protein treated with 10 μM atorvastatin after 24 h compared with DMSO. Green represents anti-KLF2, KLF3, KLF4, KLF6 and KLF7 antibodies. Blue fluorescence represents DAPI nuclear staining. (C) Data are normalized to GAPDH and the KLF expression in the control (DMSO) group was set to 1. Data are expressed as the mean ± SD from 3 separate experiments. *P<0.05 vs. control group; AT, atorvastatin.

Atorvastatin promotes the expression of KLF protein in quiescent EA.hy926 cells

To confirm whether the change in KLF protein levels was consistent with PCR and DNA microarray results, KLF protein was analyzed and quantified by immunofluorescence and western blot analyses. As shown in Fig. 2, the expression of KLF2 and KLF4 protein in quiescent EA.hy924 cells was significantly higher than that of KLF3, KLF6 and KLF7. After incubation with 10 μM atorvastatin for 24 h, KLF2, KLF3, KFL4, KLF6 and KLF7 were all increased compared with the DMSO control, but protein levels were not altered to the same degree as the mRNA levels. The increase in KLF2 protein expression was <2-fold over that of the control and we found the same result by immunofluorescence analysis. Green fluorescence intensity values based on the binding intensity of the KLF antibodies were enhanced in the atorvastatin group compared to the DMSO group, but the change was <2-fold (Fig. 3A and B).

Figure 2

KLF protein was detected by western blot analysis. Incubation for 24 h with atorvastatin (10 μM) increases KLF mRNA and KLF protein expression in EA.hy926 endothelial cells. (A) Representative western blot analyses of KLF2, KLF3, KLF4, KLF6, KLF7 and GAPDH expression. (B) Bar graphs show the mean gray values ± SEM from analysis of DMSO group and atorvastatin group (n=3 each). *P<0.05 AT vs. control group (DMSO). AT, atorvastatin.

Atorvastatin counteracts ox-LDL-induced downregulation of KLF expression in EA.hy926 cells

As mentioned above, ox-LDL sharply decreased the levels of KLF protein, while atorvastatin upregulated the KLF expression at both the mRNA and protein levels. We further examined the effects of atorvastatin on ox-LDL-induced KLF expression by using immunofluorescence. In the nuclei of these cells, we observed a >2-fold decrease in KLF protein in the 100 μg/ml ox-LDL group compared to the DMSO control group (Fig. 1A and B), while the fluorescence intensity values of KLF2, KLF3, KLF4, KLF6 and KLF7 in ox-LDL + atorvastatin group were all elevated >3-fold over the ox-LDL alone group. These results demonstrate that atorvastatin counteracts the inhibitory effect induced by ox-LDL on KLF expression (Fig. 4).

Figure 4

Atorvastatin upregulates ox-LDL-inhibited KLF protein expression as observed by immunofluorescence and confocal microscopy. (A) Representative immunofluorescence images are shown here. ox-LDL and ox-LDL + AT in the upper right corner of the pictures represent 2 groups: ox-LDL, cells were exposed to 100 μg/ml ox-LDL for 24 h, and ox-LDL + AT, cells were exposed to 100 μg/ml ox-LDL + 10 μM AT for 24 h. (B) Bar graphs show the mean KLF fluorescent intensity values ± SEM (n=3 each). *P<0.05 ox-LDL + AT group vs. ox-LDL group. AT, atorvastatin.

Discussion

KLFs are members of the zinc finger family of transcription factors and previous studies have implicated these transcription factors as the key regulators of the endothelial pathways in vascular biology (18). KLF2 is the most widely studied KLF in endothelial cells and it is known as a ‘molecular switch’ that regulates the important aspects of vascular function and disease. KLF2 regulates endothelial thrombotic function by inducing the expression of potent anti-thrombotic and anti-inflammatory genes such as eNOS, thrombomodulin and plasminogen activator inhibitor 1 (PAI-1). These results were further substantiated by siRNA knockdown experiments (8). In addition, KLF2 blocks endothelial cell activation by inhibiting interleukin (IL)-1β (19) and TNF-α (20), and inhibits angiogenesis by reducing endothelial cell proliferation and migration (21).

Both KLF4 and KLF10 are novel regulators of the inflammatory response (22,23). KLF10 plays a central role in the anti-proliferative response via the TGFβ-Smad pathway, which explains why KLF10 knockout mice develop cardiac hypertrophy (24). KLF4, which acts as a novel regulator of macrophage polarization, was robustly induced in M2 macrophages, whereas it was strongly reduced in M1 macrophages (25). KLF6 plays a key role in vascular development, remodeling and response to injury (12). KLF7 was recently reported to be a novel candidate for conferring susceptibility to type 2 diabetes (26). However, the underlying mechanisms responsible for endothelial cell injury with decreased KLF expression, remain to be elucidated.

In atherosclerosis, ox-LDL accumulates in the vessel walls and causes endothelial dysfunction, leading to the initiation and progression of atherosclerosis. However, the association between ox-LDL accumulation and KLF expression, as well as the effect of atorvastatin on ox-LDL-induced KLF expression, has not been determined. Therefore, we examined the effect of atorvastatin on ox-LDL-induced regulation of endothelial cell KLF expression.

Several studies have demonstrated that KLF2 is a novel nuclear mediator of the effects of statin in endothelial cells (27–30). In the present study, we found that ox-LDL can significantly decrease the mRNA expression of KLF2, KLF3, KLF4, KLF6, KLF7, KLF9 and KLF13. We further demonstrated that the downregulation of KLF expression by ox-LDL was counteracted by treatment with atorvastatin. These findings suggest that other KLFs, in addition to KLF2 and KLF4, play a role in the pathogenesis of atherosclerosis (13,31). Downregulation of KLF expression by ox-LDL might be an effective target of atorvastatin in atherosclerosis. The signaling mechanisms orchestrating endothelial KLF2 expression as well as the expression of other KLFs in the vascular endothelium deserve further investigation.

Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) is a major receptor for ox-LDL in the endothelial cells and is important for tumor growth, suggesting a molecular connection between atherogenesis and tumorigenesis (32–34). Recent studies show a positive correlation between increased serum ox-LDL levels and an increased risk of colon, breast, ovarian and esophageal cancers (35–37). Studies have revealed that KLF4, KLF9 and KLF10 have important tumor suppressor functions (23,26,38–40). Based on our results that ox-LDL downregulates KLF expression, which would increase the risk of cancer, we hypothesized that KLFs were the targets of the pro-carcinogenic effect of ox-LDL and the anti-carcinogenic effect of atorvastatin.

Maintenance of the cellular participants of inflammatory reactions in a quiescent or inflammatory state is equally important. Therefore, we investigated these two states. Atorvastatin upregulated KLF expression in both the quiescent and ox-LDL-induced inflammatory states. This suggests that KLFs are involved in the control of cell proliferation and differentiation in normal as well as in pathological situations.

Although the mechanism of KLF reduction by ox-LDL is not well understood in EA.hy926 endothelial cells, our observations suggest that KLFs regulate the endothelial phenotype under both basal and inflammatory conditions. The evidence suggests that KLFs play an important role in endothelial dysfunction. Moreover, statin-induced upregulation of KLF expression may play an important role in the pharmacological and clinical effects of statins observed in cardiovascular diseases and carcinoma. Downregulation of KLFs in patient plasma might occur during the early stages of cardiovascular disease and cancer, and this may be correlated with disease severity, because ox-LDL levels are related to both atherosclerosis and an increased risk of cancer (33). Further clinical research is required to provide more information on the potential benefits of using statins to treat atherosclerotic diseases at an earlier stage.

Acknowledgements

This study was supported by the National Science and Technology Support Program (no. 2009BAI86B04).

References

1. 

RA BoonJO FledderusOL VolgerKLF2 suppresses TGF-beta signaling in endothelium through induction of Smad7 and inhibition of AP-1Arterioscler Thromb Vasc Biol27532539200710.1161/01.ATV.0000256466.65450.ce17194892

2. 

S MitraT GoyalJL MehtaOxidized LDL, LOX-1 and atherosclerosisCardiovasc Drugs Ther25419429201110.1007/s10557-011-6341-521947818

3. 

S EharaM UedaT NarukoElevated levels of oxidized low density lipoprotein show a positive relationship with the severity of acute coronary syndromesCirculation10319551960200110.1161/01.CIR.103.15.195511306523

4. 

S TsimikasC BergmarkRW BeyerTemporal increases in plasma markers of oxidized low-density lipoprotein strongly reflect the presence of acute coronary syndromesJ Am Coll Cardiol41360370200310.1016/S0735-1097(02)02769-912575961

5. 

E Cuadrado-GodiaA OisE Garcia-RamalloBiomarkers to predict clinical progression in small vessel disease strokes: prognostic role of albuminuria and oxidized LDL cholesterolAtherosclerosis219368372201110.1016/j.atherosclerosis.2011.07.11421862014

6. 

S RyooA BhuniaF ChangA ShoukasDE BerkowitzLH RomerOxLDL-dependent activation of arginase II is dependent on the LOX-1 receptor and downstream RhoA signalingAtherosclerosis214279287201110.1016/j.atherosclerosis.2010.10.04421130456

7. 

D MohtyP PibarotJP DespresAssociation between plasma LDL particle size, valvular accumulation of oxidized LDL, and inflammation in patients with aortic stenosisArterioscler Thromb Vasc Biol28187193200810.1161/ATVBAHA.107.15498917975118

8. 

GT OhJH ChoiJJ HongDietary hematein ameliorates fatty streak lesions in the rabbit by the possible mechanism of reducing VCAM-1 and MCP-1 expressionAtherosclerosis1591726200110.1016/S0021-9150(01)00464-611689202

9. 

B ZhaoX LuoH ShiD MaTissue factor pathway inhibitor-2 is downregulated by ox-LDL and inhibits ox-LDL induced vascular smooth muscle cells proliferation and migrationThromb Res128179185201110.1016/j.thromres.2011.02.02521458846

10. 

HH WangHL HsiehCY WuCM YangOxidized low-density lipoprotein-induced matrix metalloproteinase-9 expression via PKC-delta/p42/p44 MAPK/Elk-1 cascade in brain astrocytesNeurotox Res175065201010.1007/s12640-009-9077-219554388

11. 

BL YuSP ZhaoXS HuangOxidized low-density lipoprotein: a double-edged sword on atherosclerosisMed Hypotheses69553556200710.1016/j.mehy.2007.01.04317368957

12. 

S YuSL WongCW LauY HuangCM YuOxidized LDL at low concentration promotes in-vitro angiogenesis and activates nitric oxide synthase through PI3K/Akt/eNOS pathway in human coronary artery endothelial cellsBiochem Biophys Res Commun4074448201110.1016/j.bbrc.2011.02.096

13. 

FF YanYF LiuY LiuYX ZhaoKLF4: a novel target for the treatment of atherosclerosisMed Hypotheses70845847200810.1016/j.mehy.2007.07.03117869009

14. 

G Villarreal JrY ZhangHB LarmanJ Gracia-SanchoA KooG Garcia-CardenaDefining the regulation of KLF4 expression and its downstream transcriptional targets in vascular endothelial cellsBiochem Biophys Res Commun391984989201010.1016/j.bbrc.2009.12.00219968965

15. 

Z LinA KumarS SenBanerjeeKruppel-like factor 2 (KLF2) regulates endothelial thrombotic functionCirc Res96e48e57200510.1161/01.RES.0000159707.05637.a115718498

16. 

RR AzarG BadaouiA SarkisEffect of ezetimibe/atorvastatin combination on oxidized low density lipoprotein cholesterol in patients with coronary artery disease or coronary artery disease equivalentAm J Cardiol106193197201010.1016/j.amjcard.2010.03.016

17. 

F AliSS HamdulayAR KinderlererStatin-mediated cytoprotection of human vascular endothelial cells: a role for Kruppel-like factor 2-dependent induction of heme oxygenase-1J Thromb Haemost525372546200710.1111/j.1538-7836.2007.02787.x17927807

18. 

H LiSB MiaoLH DongClinicopathological correlation of Kruppel-like factor 5 and matrix metalloproteinase-9 expression and cartilage degeneration in human osteoarthritisPathol Res Pract208914201110.1016/j.prp.2011.09.01522094285

19. 

AC RaccaSA CamolottoME RidanoJL BoccoS Genti-RaimondiGM Panzetta-DutariKruppel-like factor 6 expression changes during trophoblast syncytialization and transactivates sshCG and PSG placental genesPLoS One6e22438201110.1371/journal.pone.002243821799854

20. 

AB BialkowskaM CrispT BannisterIdentification of small-molecule inhibitors of the colorectal cancer oncogene Kruppel-like factor 5 expression by ultrahigh-throughput screeningMol Cancer Ther1020432051201110.1158/1535-7163.MCT-11-055021885866

21. 

HJ KeeJS KwonS ShinY AhnMH JeongH KookTrichostatin A prevents neointimal hyperplasia via activation of Kruppel like factor 4Vascul Pharmacol55127134201110.1016/j.vph.2011.07.00121763782

22. 

DT DangX ChenJ FengM TorbensonLH DangVW YangOverexpression of Kruppel-like factor 4 in the human colon cancer cell line RKO leads to reduced tumorigenecityOncogene2234243430200310.1038/sj.onc.120641312776194

23. 

A MihailovaH MikazaneJ KlovinsL Nikitina-ZakeAssociation of protein tyrosine phosphatase non-receptor 22 (PTPN22) rs2476601 and Kruppel-like factor 12 (KLF12) rs1324913 single nucleotide polymorphisms with rheumatoid arthritis in a Latvian populationScand J Rheumatol40491492201110.3109/03009742.2011.608715

24. 

S QinM LiuW NiuCL ZhangDysregulation of Kruppel-like factor 4 during brain development leads to hydrocephalus in miceProc Natl Acad Sci USA1082111721121201110.1073/pnas.111235110922160720

25. 

X LiaoN SharmaF KapadiaKruppel-like factor 4 regulates macrophage polarizationJ Clin Invest12127362749201110.1172/JCI4544421670502

26. 

Y KawamuraY TanakaR KawamoriS MaedaOverexpression of Kruppel-like factor 7 regulates adipocytokine gene expressions in human adipocytes and inhibits glucose-induced insulin secretion in pancreatic beta-cell lineMol Endocrinol20844856200610.1210/me.2005-013816339272

27. 

BB McConnellSS KimK YuKruppel-like factor 5 is important for maintenance of crypt architecture and barrier function in mouse intestineGastroenterology14113021313201110.1053/j.gastro.2011.06.08621763241

28. 

JL YoriDD SeachristE JohnsonKruppel-like factor 4 inhibits tumorigenic progression and metastasis in a mouse model of breast cancerNeoplasia13601610201121750654

29. 

LK ChangPH HuangWT ShenSH YangWJ LiuCF LoRole of Penaeus monodon Kruppel-like factor (PmKLF) in infection by white spot syndrome virusDev Comp Immunol36121129201210.1016/j.dci.2011.06.00821740926

30. 

KM ParmarV NambudiriG DaiHB LarmanMA Gimbrone JrG Garcia-CardenaStatins exert endothelial atheroprotective effects via the KLF2 transcription factorJ Biol Chem2802671426719200510.1074/jbc.C50014420015878865

31. 

S SenBanerjeeZ LinGB AtkinsKLF2 Is a novel transcriptional regulator of endothelial proinflammatory activationJ Exp Med19913051315200410.1084/jem.2003113215136591

32. 

J LuS MitraX WangM KhaidakovJL MehtaOxidative stress and lectin-like ox-LDL-receptor LOX-1 in atherogenesis and tumorigenesisAntioxid Redox Signal1523012333201110.1089/ars.2010.379221338316

33. 

M CaiazzoL Colucci-D’AmatoF VolpicelliKruppel-like factor 7 is required for olfactory bulb dopaminergic neuron developmentExp Cell Res317464473201110.1016/j.yexcr.2010.11.00621093432

34. 

L LebsonA GockeJ RosenzweigCutting edge: The transcription factor Kruppel-like factor 4 regulates the differentiation of Th17 cells independently of RORgammatJ Immunol18571617164201010.4049/jimmunol.100275021076063

35. 

D SivritasMU BecherT EbrahimianAntiproliferative effect of estrogen in vascular smooth muscle cells is mediated by Kruppel-like factor-4 and manganese superoxide dismutaseBasic Res Cardiol106563575201110.1007/s00395-011-0174-z21484412

36. 

H LuX WangT LiIdentification of poly (ADP-ribose) polymerase-1 (PARP-1) as a novel Kruppel-like factor 8-interacting and -regulating proteinJ Biol Chem2862033520344201110.1074/jbc.M110.21563221518760

37. 

JS MoonHE KimE KohKruppel-like factor 4 (KLF4) activates the transcription of the gene for the platelet isoform of phosphofructokinase (PFKP) in breast cancerJ Biol Chem2862380823816201110.1074/jbc.M111.23673721586797

38. 

H GuanL XieF LeithauserKLF4 is a tumor suppressor in B-cell non-Hodgkin lymphoma and in classic Hodgkin lymphomaBlood11614691478201010.1182/blood-2009-12-25644620519630

39. 

Y YangBG GoldsteinHH ChaoJP KatzKLF4 and KLF5 regulate proliferation, apoptosis and invasion in esophageal cancer cellsCancer Biol Ther412161221200510.4161/cbt.4.11.209016357509

40. 

C BureauN HanounJ TorrisaniJP VinelL BuscailP CordelierExpression and function of Kruppel like-factors (KLF) in carcinogenesisCurr Genomics10353360200910.2174/13892020978892101020119532

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao Y, Liu X, Lu X, Ma C, Cao J and Fan L: Protective effects of atorvastatin against oxidized LDL-induced downregulation of KLF expression in EA.hy926 cells. Int J Mol Med 30: 330-336, 2012.
APA
Gao, Y., Liu, X., Lu, X., Ma, C., Cao, J., & Fan, L. (2012). Protective effects of atorvastatin against oxidized LDL-induced downregulation of KLF expression in EA.hy926 cells. International Journal of Molecular Medicine, 30, 330-336. https://doi.org/10.3892/ijmm.2012.999
MLA
Gao, Y., Liu, X., Lu, X., Ma, C., Cao, J., Fan, L."Protective effects of atorvastatin against oxidized LDL-induced downregulation of KLF expression in EA.hy926 cells". International Journal of Molecular Medicine 30.2 (2012): 330-336.
Chicago
Gao, Y., Liu, X., Lu, X., Ma, C., Cao, J., Fan, L."Protective effects of atorvastatin against oxidized LDL-induced downregulation of KLF expression in EA.hy926 cells". International Journal of Molecular Medicine 30, no. 2 (2012): 330-336. https://doi.org/10.3892/ijmm.2012.999
Copy and paste a formatted citation
x
Spandidos Publications style
Gao Y, Liu X, Lu X, Ma C, Cao J and Fan L: Protective effects of atorvastatin against oxidized LDL-induced downregulation of KLF expression in EA.hy926 cells. Int J Mol Med 30: 330-336, 2012.
APA
Gao, Y., Liu, X., Lu, X., Ma, C., Cao, J., & Fan, L. (2012). Protective effects of atorvastatin against oxidized LDL-induced downregulation of KLF expression in EA.hy926 cells. International Journal of Molecular Medicine, 30, 330-336. https://doi.org/10.3892/ijmm.2012.999
MLA
Gao, Y., Liu, X., Lu, X., Ma, C., Cao, J., Fan, L."Protective effects of atorvastatin against oxidized LDL-induced downregulation of KLF expression in EA.hy926 cells". International Journal of Molecular Medicine 30.2 (2012): 330-336.
Chicago
Gao, Y., Liu, X., Lu, X., Ma, C., Cao, J., Fan, L."Protective effects of atorvastatin against oxidized LDL-induced downregulation of KLF expression in EA.hy926 cells". International Journal of Molecular Medicine 30, no. 2 (2012): 330-336. https://doi.org/10.3892/ijmm.2012.999
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team