Molecular cloning, characterization and differential expression of a Sporothrix schenckii STE20-like protein kinase SsSte20

  • Authors:
    • Zhenying Zhang
    • Binbin Hou
    • Fangliang Zheng
    • Xiaohong Yu
    • Xiaoming Liu
  • View Affiliations

  • Published online on: April 16, 2013     https://doi.org/10.3892/ijmm.2013.1352
  • Pages: 1343-1348
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Dimorphic switching requires fungal cells to undergo changes in polarized growth in response to environmental stimuli. The Ste20-related kinases are involved in signaling through mitogen-activated protein kinase pathways and in morphogenesis through the regulation of cytokinesis and actin-dependent polarized growth. In this report, we isolated and characterized an Ste20 homologue gene, designated SsSte20, from yeast-form Sporothrix schenckii (S. schenckii). The full length SsSte20 cDNA sequence is 2846 bp in size, and contains an open reading frame of 2505 bp encoding 835 amino acids. The predicted molecular mass of SsSte20 is 91.31 kDa with an estimated theoretical isoelectric point of 5.76. SsSte20 kinase domain shows 63% identity with that of Don3, a germinal centre kinase (GCK) from Ustilago maydis. Two exons and one intron are identified within the 2578 bp SsSte20 genomic DNA sequence of S. schenckii. Differential expression of the SsSte20 was demonstrated by real-time RT-PCR. The expression of SsSte20 was much higher in the yeast stage compared with that in the mycelial stage, which indicated that the SsSte20 may be involved in the pathogenesis of the yeast phase of S. schenckii.

Introduction

Sporothrix schenckii (S. schenckii), the etiologic agent of sporotrichosis, is a dimorphic fungus that produces lymphocutaneous lesions. The mechanisms involved in the morphological transitions of S. schenckii remain unknown, although knowledge on the experimental control of these processes has increased in the past years (1,2). Inhibition of the differentiation of S. schenckii mycelial into the parasitic yeast forms may be a noteworthy alternative for the design of antifungal drugs to be used in sporothrichosis. Therefore, understanding the morphological transition process and, consequently, how the morphological transition can be inhibited, may aid in the development of novel strategies to effectively manage this increasingly important clinical problem.

Dimorphic switching requires fungal cells to undergo changes in polarized growth in response to environmental stimuli. Polarity establishment allows the development of a wide variety of cell morphologies and the differentiation of distinct cell types (3). The family of Ste20-related kinases is conserved from yeast to mammals and includes the p21 activated kinases (PAKs) and germinal centre kinases (GCKs). These kinases have been shown to be involved in signaling through mitogen activated protein kinase (MAPK) pathways and in morphogenesis through the regulation of cytokinesis and actin-dependent polarized growth (4). Saccharomyces cerevisiae (S. cerevisiae) Ste20 is required for efficient activity of the pheromone response pathway and an effective Hog1-mediated hypertonic stress response. It appears to play a role in the activation of myosin, adhesion of mating partners and vegetative functions relating to budding (5). Homologues of S. cerevisiae Ste20 have been described in a number of other fungal species. These include Candida albicans (C. albicans) Ste20 (Q92212), Cryptococcus neoformans (C. neoformans) Ste20 (AF542531.1), Ustilago maydis Ste20 (AF299352.1) and Pneumocystis carinii Ste20 (AF332388). These Ste20 proteins were proved to play important roles in mediating the regulation of various aspects of morphogenesis, conjugation, mating and pathogenicity (6). We previously reported differentially expressed proteins between the mold and early yeast stage of S. schenckii using 2DE (7). The protein spot J is homologous to the Ste20-like protein kinase from Paracoccidioides brasiliensis and increases in the early yeast form of S. schenckii.

In this study, we described the molecular cloning of the S. schenckii Ste20 homologue, designated SsSte20. We performed necessary function analysis of the SsSte20 gene and detected the differential gene expression in dimorphic switch of S. schenckii. These will establish the primary foundation of understanding the function of the SsSte20 gene from S. schenckii. The cloning and characterization of the SsSte20 gene from S. schenckii is reported for the first time.

Materials and methods

Fungal strain, media and growth conditions

The strain of S. schenckii used, ATCC10268, was maintained at the Research Center for Pathogenic Fungi, Dalian Medical University, China. To obtain a mycelial culture, the ATCC10268 isolate was inoculated on Sabouraud dextrose agar (SDA) medium and incubated at 25°C. The mycelial colonies thus obtained were inoculated in Sabouraud's fluid medium and cultured with shaking at 100 rpm at 25°C for 96 h. To achieve the switch of S. schenckii from the mycelial phase to the yeast phase, mycelial colonies were transferred to brain heart infusion (BHI) liquid medium at 37°C and shaken at 100 rpm for 96 h. Mycelial and yeast pellets were collected by centrifugation and stored at −80°C.

Total RNA, genomic DNA isolation and gene cloning

Approximately 100 mg samples of S. schenckii mycelial and yeast were separately pulverized under liquid nitrogen with a mortar and pestle. Total RNA isolation was carried out according to the manufacturer's protocol using the TRIzol Reagent Kit (Invitrogen, Carlsbad, CA, USA) and treated with the RNase-free DNase I kit from Takara to eliminate DNA contamination. Genomic DNA was isolated from yeast phase colonies following the manufacturer's protocol using the InstaGene™ Matrix kit (Bio-Rad, Hercules, CA, USA). cDNA was synthesized from 500 μg of total RNA of ATCC10268 by murine leukemia virus reverse transcriptase (MLV-RT) (Takara, Tokyo, Japan) primed with oligo(dT) following the manufacturer's instructions, and used as template for PCR. Degenerate primers, SsSte20-F1 and SsSte20-R1, were designed based on multiple alignments of the high conserved Ste20 domains of C. albicans Ste20 (Q92212), C. neoformans Ste20 (AF542531.1), Ustilago maydis Ste20 (AF299352.1), and Pneumocystis carinii Ste20 (AF332388) amino acid sequences. PCR product of expected size was cloned into pMD18 vector (Takara) and sequenced. The degenerate primers yielded a 302 bp fragment homologous to known Ste20. To obtain the full-length cDNA sequence of the SsSte20 gene, 5′-RACE and 3′-RACE were performed with 5′-Full RACE Kit and 3′-Full RACE Core Set Ver.2.0 kit (Takara) according to the manufacturer's instructions. Nest-PCR was performed. Briefly, five specific primers CTE869 F and CTE869 R of 3′-RACE and R132-1, R132-2 and R132-3 of 5′-RACE were synthesized based on the cDNA sequence obtained by the degenerate primers. PCR products of 5′- and 3′-RACE were both cloned into pMD18 vector (Takara) and sequenced.

To determine the nucleotide sequence of the genomic DNA corresponding to the SsSte20, PCR was performed using the primers SsSte20-P1 and SsSte20-B3 and genomic DNA as template. The PCR products were then sequenced. The sequences of all the primers used in this study are listed in Table I.

Table I

Sequence of primers in this study.

Table I

Sequence of primers in this study.

PrimerSequence (5′-3′)
SsGCK-F1 CAYAARYTNTGGATHGTNATGGA
SsGCK-R1 TGYTGDATNACYTCNGGNGCCATCCA
CTE869F AGAAGCTCCACCGCGATATCAAGGCC
CTE869R CGCCACCATGACCAAGAAGAACACCT
R132-1(GSP1) TGGAGCCTAACAAGACA
R132-2(GSP2) TTCTTGTCGGCGTGGAGGTAG
R132-3(GSP3) CAATGATGGCAATGTAGTCTTCG
P1 ATGGCGAGCAGAGATGACG
B3 CACGGCCTCTTCGTCGAG
F GCAACAGCAACAATTAGC
R GACACGTTCTCTTCCATG
24T(FAM) CCAACAGCAACTACAACAGCAACAG

[i] Degenerate primers designed based on multiple alignments of the high conserved STE20 domains for gene cloning: GCK-F1 and GCK-R1. Primers of 3′-RACE: CTE869 F3, CTE869 F4; 5′-RACE: R132-1, R132-2 and R132-3. To determine the nucleotide sequence of the genomic DNA corresponding to the SsGCK PCR was performed using the primers P1 and B3. Primers and a TaqMan probe of real-time RT-PCR: 8F, 58R and 24T.

Bioinformatic and phylogenetic analysis of SsSte20

Nucleotide sequences and deduced amino acid sequences of the cloned SsSte20 gene were analyzed. The nucleotide sequences were analyzed as previously described by us (8) using Sequencer software (Sequencer, USA) and the BLAST network service of the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/blast). The open reading frame (ORF) was found by the ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). For the exact localization of the exon/intron boundaries, the mRNA-to-genomic alignment program Spidey (http://www.ncbi.nlm.nih.gov/IEB/Research/Ostell/Spidey/index.html) was used. The deduced amino acid sequence was analyzed with the Expert Protein Analysis System (http://www.expasy.org/) and the protein domain features of SsSte20 were determined by using Simple Modular Architecture Research Tool (http://hits.isb-sib.ch/cgi-bin/PFSCAN). Isoelectric point and molecular weight prediction were carried out at (http://cn.expasy.org/tools/pi_tool.html). Multiple alignments of SsSte20 were performed with the ClustalW Multiple Alignment Program (http://www.ebi.ac.uk/clustalw/).

Differential expression of SsSte20 in two stages during dimorphic switch

The expression of SsSte20 transcript in different stages (mycelial, yeast) was measured by real-time RT-PCR. Primers and a TaqMan probe for target genes were designed with Primer Select in DNASTAR software (Lasergene) and are listed in Table I (24T, 8F and 58R). Fifty nanograms of total RNA were assayed from two stages of S. schenckii in triplicate using the PrimeScript RT-PCR Kit (Takara). The minus-reverse transcriptase control was also performed in triplicate. The amplification conditions were optimized for the ABI-PRISM-7500 instrument (Applied Biosystems). The cycling conditions using TaqMan probe detection were 95°C for 2 min followed by 40 cycles at 95°C for 10 sec, 61°C for 10 sec, 72°C for 40 sec. 18srDNA was selected as the endogenous control. Relative quantification of target gene expression was evaluated using the comparative cycle threshold (CT) method as previously described by Livak and Schmittgen (9). The ΔCT value was determined by subtracting the target CT of each sample from its respective 18srDNA CT value. Calculation of ΔΔCT involved using the mycelial sample ΔCT value as an arbitrary constant to subtract from yeast sample ΔCT values. Differences in expression of target genes were determined by 2−ΔΔCT. Data are expressed as arithmetic means ± SD unless otherwise indicated. Comparison between mycelial and yeast samples was performed using the Student's t-test. Differences with a P-value of <0.05 were considered statistically significant.

Results

Cloning and genomic structure of SsSte20

A full-length SsSte20 cDNA (2,846 bp) including an ORF of 2505 bp, encoding 835 amino residues, was flanked by a 41 bp 5′-untranslated region (5′-UTR) and a 297 bp 3′-UTR. The SsSte20 genomic DNA is 2578 bp in length. The aligned results revealed that there is one intron between the sequences of the genomic DNA and the cDNA. Its 5′ and 3′ ends conformed to the basic consensus, GT/AG, for the eukaryotic splice donor and acceptor site. Based on the sequence of cDNA, the molecular weight of the predicted amino acid is ∼91.31 kDa, the theoretical pI is 5.76.

Motif searches and sequence comparison showed that SsSte20 consists of a 251-amino acid N-terminal kinase domain (residues 21–271) (Fig. 1). In the N-terminal extremity of the catalytic domain there is a glycine-rich stretch of residues in the vicinity of a lysine residue (K), which has been proved to be involved in ATP binding. In the central part of the catalytic domain there is a conserved aspartic acid residue (N) which is important for the catalytic activity of the enzyme (Fig. 2). One proline/glutamic acid/serine/threonine (PEST) motif was searched using Epestfind in the C-terminal domain of SsSte20 (residues 514–529) (Fig. 1). Database searches revealed that SsSte20 is a member of the Ste20 family of protein kinases. SsSte20 displays high homology throughout the kinase domain and contains the amino acid sequence GTPYFWMAPEV in the kinase domain (Fig. 2). This sequence motif, known as the Ste20 signature, is characteristic of the Ste20 family of protein kinases and is critical for the kinase activity of Ste20 (10).

Homology and phylogenetic analysis of SsSte20

To clarify the relationship between SsSte20 and other Ste20-related kinases, we calculated multiple sequence alignments of these sequences. The derived evolutionary tree is split into two main branches, one formed by some PAKs, the other one by GCKs including SsSte20 sequence (Fig. 3). Further alignment clearly showed that the SsSte20 kinase domain is highly homologous to that of other GCKs, such as Don3 (Ustilago maydis, AF463451.1), Ppk11 (Schizosaccharomyces pombe, NM_001019946.1), Sid1 (Schizosaccharomyces pombe, NM_001018997.1), Nak1 (Schizosaccharomyces pombe NM_001021931.1) and polarity-defective 6 (Neurospora crassa, DQ336953.1). These proteins share a similar structure and have 63, 56, 54, 47 and 38% amino acid similarities in the catalytic domains, respectively. These proteins have a highly conserved catalytic domain in common but differ in their C-terminal regulatory domain, which does not contain any identifiable sequence motifs.

Expression of SsSte20 in two stages of S. schenckii

The mRNA expression of SsSte20 in different stages was analyzed by real-time RT-PCR normalized against 18srDNA levels. Expression was determined as fold increased 2−ΔΔCT levels relative to the stage with lowest expression (mycelial) set to 1. The SsSte20 gene was expressed in two stages of S. schenckii, with higher mRNA levels observed in yeast (15.14-fold). There were significant differences between the mycelial and the yeast form (Table II).

Table II

Relative abundance of differential expression gene as determined by real-time RT/PCR (mean ± SD) (P<0.01).

Table II

Relative abundance of differential expression gene as determined by real-time RT/PCR (mean ± SD) (P<0.01).

cDNA namePhaseTarget CT18srDNA CTΔCTΔΔCT 2−ΔΔCT
SsSte20Mycelial22.48±0.9220.66±0.251.81±1.130±1.131
Yeast19.99±0.2322.09±0.60−2.11±0.79−3.92±0. 7915.14

[i] ΔCT, target transcript CT-18srDNA CT normalization of CT for target gene relative to 18srDNA CT. Statistical analysis of normalized expression levels between mycelial form and yeast form. Each of the target genes differs significantly (U-test, P<0.05). ΔΔCT, mean yeast ΔCT, mean mycelial ΔCT. The mean value for the mycelial ΔCT was used as a calibrator to set the baseline for comparing mean differences in the ΔCT values of yeast form. 2−ΔΔCT, normalized target amount relative to the mycelial form.

Accession number

The full length of cDNA sequence and the genomic DNA sequence of the SsSte20 gene were submitted to the GenBank database under the accession numbers JX312329 and JX857536, respectively.

Discussion

The Ste20-like protein kinase family can be divided into two subfamilies based on their domain structure and regulation. The PAK/Ste20 subfamily contains a C-terminal catalytic domain and an N-terminal binding site for the small G proteins Cdc42 and Rac1, which are considered to be key regulatory molecules linking surface receptors to the organization of the actin cytoskeleton (11,12). By contrast, the kinases of the second subfamily, the GCK subfamily, have an N-terminal kinase domain and a C-terminal regulatory domain that does not have a recognizable GTPase binding site (13). Furthermore, GCKs are subdivided into two broad groups based on their structure. Group I GCKs have a highly conserved C-terminal domain containing at least two PEST motifs, two polyproline Src homology-3 (SH3) domains and an additional highly conserved region of approximately 350 amino acids. Group II GCKs share similarity to the catalytic domain of group I; however, the C-terminal domain differs significantly. In present study, SsSte20 was labelled as a GCK based on catalytic domain located in the N-terminal site, which was also confirmed by phylogenetic relationship analysis. We further identified SsSte20 as a group II GCK for its one PEST motif, no SH3 domain and no conserved sequence in C-terminal domain.

Ste20 ortholog was proved to be involved in both the morphogenesis and the pathogenesis of consequence of an inability to grow in the pathogenic form. In C. albicans, filamentous growth allows adherence and penetration of tissues during infection. The cst20 (Ste20) mutants are unable to form hyphal filaments in vitro and consequently show reduced kidney colonization and virulence in a mouse model for systemic candidiasis (14). While in Penicillium marneffei (P. marneffei), infection occurs by the inhalation of conidia that are phagocytosed by host pulmonary alveolar macrophages where they germinate into yeast cells and divide by fission. PakA (Ste20) plays an essential role in conidial germination of P. marneffei at the host temperature of 37°C such that ΔPakA mutant conidia fail to germinate during macrophage infection (15). Although GCKs currently have no described role in virulence, this may be due to a lack of characterization rather than a lack of involvement. The Kic1 (GCK) mutants in C. albicans and C. neoformans probably have virulence defects as the C. albicans Kic1 mutant is unable to grow filamentously and the C. neoformans mutant is unable to grow at 37°C, the temperature of the human body, both of which are requirements for virulence in these organisms (16,17). In S. schenckii, the germination of conidia is a key pathogenicity determinant since conidia are the infectious propagules. Does SsSte20, a GCK, have the same function in the virulence of S. schenckii as Ste20 ortholog in other fungi? The mRNA expression of SsSte20 in yeast cells of both ATCC10268 and a clinical S. schenckii isolated from a patient with fixed sporotrichosis (data not shown) were higher than the mycelial ones, which suggested that SsSte20 may be involved in the morphogenesis or pathogenesis of S. schenckii.

What is the environmental signal that SsSte20 responds to to participate in morphogenesis and pathogenesis? In P. marneffei, PakB (Ste20) is essential for the formation of yeast cells within macrophages and the ΔPakB mutant grows as septate hyphae in vivo. PakB is not expressed at 37°C during in vitro yeast growth but expression is induced during macrophage infection (18). This suggests that unlike PakA, which responds to temperature, PakB responds to host cell inductive signals. In the present study, the mycelial cells of S. schenckii switched to yeast cells with obvious increased expression of SsSte20 when they were incubated in BHI liquid medium at 37°C in vitro, which suggests SsSte20, similar to PakA, can detect the change of temperature and nutrient deprivation in the environment. Whether SsSte20 also responds to other host signals remains to be elucidated. It is most likely that there are other proteins that fungal cells come into contact with in the early stages of infection. We are carrying out further experiments on generating SsSte20-mutants to study its detailed functions in this critical fungal pathogen.

Acknowledgements

This study was partly supported by a grant from the National Natural Science Foundation of China (Grant no. 81000069).

References

1 

Valle-Aviles L, Valentin-Berrios S, Gonzalez-Mendez RR and Rodriguez-Del Valle N: Functional, genetic and bioinformatic characterization of a calcium/calmodulin kinase gene in Sporothrix schenckii. BMC Microbiol. 7:1072007. View Article : Google Scholar : PubMed/NCBI

2 

Valentín-Berríos S, González-Velázquez W, Pérez-Sánchez L, et al: Cytosolic phospholipase A2: a member of the signalling pathway of a new G protein α subunit in Sporothrix schenckii. BMC Microbiol. 9:1002009.

3 

Boyce KJ, Hynes MJ and Andrianopoulos A: The Ras and Rho GTPases genetically interact to co-ordinately regulate cell polarity during development in Penicillium marneffei. Mol Microbiol. 55:1487–1501. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Boyce KJ and Andrianopoulos A: Ste20-related kinases: effectors of signaling and morphogenesis in fungi. Trends Microbiol. 19:400–410. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Calcagno AM, Bignell E, Rogers TR, Canedo M, Muhlschlegel FA and Haynes K: Candida glabrata Ste20 is involved in maintaining cell wall integrity and adaptation to hypertonic stress, and is required for wild-type levels of virulence. Yeast. 21:557–568. 2004. View Article : Google Scholar

6 

Hazan I and Liu H: Regulation of morphogenesis by conserved developmental pathways in pathogenic fungi. Pathogenic Fungi: Structural Biology and Taxonomy. San-Blas G and Calderone RA: Caister Academic Press; Norfolk, UK: pp. 221–229. 2004

7 

Zhang ZY, Hou BB, Xin Y and Liu XM: Protein profiling of the dimorphic pathogenic fungus, Sporothrix schenckii. Mycopathologia. 173:1–11. 2012. View Article : Google Scholar

8 

Hou B, Zhang Z, Zheng F and Liu X: Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii. Int J Mol Med. 31:99–104. 2013.PubMed/NCBI

9 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001.

10 

Knighton DR, Zheng JH, Ten Eyck LF, Xuong NH, Taylor SS and Sowadski JM: Crystal structure of the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. Science. 253:407–414. 1991. View Article : Google Scholar

11 

Wu C, Whiteway M, Thomas DY and Leberer E: Molecular characterization of Ste20p, a potential mitogen-activated protein or extracellular signal-regulated kinase kinase (MEK) kinase kinase from Saccharomyces cerevisiae. J Biol Chem. 270:15984–15992. 1995. View Article : Google Scholar : PubMed/NCBI

12 

Herskowitz A, Choi S, Ansari AA and Wesselingh S: Cytokine mRNA expression in postischemic/reperfused myocardium. Am J Pathol. 146:419–428. 1995.PubMed/NCBI

13 

Hall A: Rho GTPases and the actin cytoskeleton. Science. 279:509–514. 1998. View Article : Google Scholar

14 

Leberer E, Harcus D, Clark KL, Dignard D, Ziegelbauer K, et al: Signal transduction through homologs of the Ste20p and Ste7p protein kinases can trigger hyphal formation in the pathogenic fungus Candida albicans. Proc Natl Acad Sci USA. 93:13217–13222. 1996. View Article : Google Scholar : PubMed/NCBI

15 

Boyce KJ and Andrianopoulos A: A p21-activated kinase is required for conidial germination in Penicillium marneffei. PLoS Pathog. 3:e1622007. View Article : Google Scholar : PubMed/NCBI

16 

Walton FG, Heitman J, Boone AC and Editor M: Conserved elements of the RAM signaling pathway establish cell polarity in the basidiomycete Cryptococcus neoformans in a divergent fashion from other fungi. Mol Biol Cell. 17:3768–3780. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Song Y, Cheon SA, Lee KE, Lee S, Lee B, et al: Role of the RAM network in cell polarity and hyphal morphogenesis in Candida albicans. Mol Biol Cell. 19:5456–5477. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Boyce KJ, Schreider L and Andrianopoulos A: In vivo yeast cell morphogenesis is regulated by a p21-activated kinase in the human pathogen Penicillium marneffei. PLoS Pathog. 5:e10006782009. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

June 2013
Volume 31 Issue 6

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhang Z, Hou B, Zheng F, Yu X and Liu X: Molecular cloning, characterization and differential expression of a Sporothrix schenckii STE20-like protein kinase SsSte20. Int J Mol Med 31: 1343-1348, 2013.
APA
Zhang, Z., Hou, B., Zheng, F., Yu, X., & Liu, X. (2013). Molecular cloning, characterization and differential expression of a Sporothrix schenckii STE20-like protein kinase SsSte20. International Journal of Molecular Medicine, 31, 1343-1348. https://doi.org/10.3892/ijmm.2013.1352
MLA
Zhang, Z., Hou, B., Zheng, F., Yu, X., Liu, X."Molecular cloning, characterization and differential expression of a Sporothrix schenckii STE20-like protein kinase SsSte20". International Journal of Molecular Medicine 31.6 (2013): 1343-1348.
Chicago
Zhang, Z., Hou, B., Zheng, F., Yu, X., Liu, X."Molecular cloning, characterization and differential expression of a Sporothrix schenckii STE20-like protein kinase SsSte20". International Journal of Molecular Medicine 31, no. 6 (2013): 1343-1348. https://doi.org/10.3892/ijmm.2013.1352