Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
July 2013 Volume 32 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July 2013 Volume 32 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of common gene networks responsive to mild hyperthermia in human cancer cells

  • Authors:
    • Ayako Kariya
    • Yoshiaki Tabuchi
    • Tatsuya Yunoki
    • Takashi Kondo
  • View Affiliations / Copyright

    Affiliations: Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194, Japan, Division of Molecular Genetics Research, Life Science Research Center, University of Toyama, Toyama 930-0194, Japan
  • Pages: 195-202
    |
    Published online on: April 30, 2013
       https://doi.org/10.3892/ijmm.2013.1366
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Hyperthermia (HT) has been used as a possible treatment modality for various types of malignant tumors. Due to its pleiotropic effects, its combined use with radiotherapy and/or chemotherapy has proven to be beneficial. However, the molecular mechanisms underling the cellular responses to heat stress remain unclear. Therefore, the aim of this study was to identify common gene expression patterns responsive to mild HT (MHT) in human cancer cells. HeLa human cervical squamous cell carcinoma (SCC) and HSC-3 human oral SCC cells were exposed to MHT at 41˚C for 30 min, followed by culture at 37˚C for 0-24 h. MHT did not affect cell viability or the cell cycle. GeneChip microarray analysis clearly revealed that many probe sets were differentially expressed by a factor of ≥1.5 in both cell lines following exposure to MHT. Of the many differentially expressed probe sets, 114 genes were found to be commonly upregulated in both HeLa and HSC‑3 cells, and two significant gene networks were obtained from the commonly upregulated genes. Gene network A included several heat shock proteins, as well as BCL2-associated athanogene 3 (BAG3), and was found to be mainly associated with the biological functions of cellular function and maintenance. Gene network B included several anti-cell death genes, such as early growth response 1 (EGR1) and endothelin 1 (EDN1) and was found to be associated with the biological functions of cell death and survival. Real‑time quantitative polymerase chain reaction demonstrated that the gene expression patterns of the 12 genes selected were consistent with the microarray data in four cancer cell lines. These findings may provide further insight into the detailed molecular mechanisms of the MHT response in cancer cells.

Introduction

Hyperthermia (HT) is a well-established treatment modality that is used alone or in combination with other therapies, such as radiotherapy and chemotherapy, for the treatment of a variety of tumors (1). It has been indicated that only cancer cells treated at temperatures >42.5°C, the inflection point of HT, will undergo cell death as the temperature increases, whereas temperatures in the mild hyperthermia (MHT) range <42.5°C induce little or no cytotoxicity (2). However, HT monotherapy, maintaining a cancer temperature >42.5°C for direct cytotoxicity, has been associated with higher toxicity and less efficacy against cancer. Therefore, MHT, in combination with radiotherapy and/or chemotherapy, has been used for the treatment of various types of cancer, and its antitumor effects have been verified by several clinical trials (3–7). In addition, recent studies have demonstrated that an antitumor immune system including heat shock protein (HSP) chaperone tumor antigens may be effective as a cancer immunotherapy based on MHT (8,9).

The heat shock response, a universal cellular response to elevated temperatures, is a very important cellular event for cell adaptation. It has been well recognized that heat elicits a wide variety of stress responses, such as the induction of HSPs, DNA and RNA damage, protein aggregation, cell growth arrest and cell death (10–12). HSPs, which are are induced by heat in particular, behave as strong cytoprotective molecules preventing cell death (12) and participate in thermoresistance (13,14). Although heat affects several biological processes, the overall responses to heat in mammalian cells are not yet completely understood. To this end, a number of studies have found that the most effective approach for investigating heat responses is to use global-scale microarrays and bioinformatics tools. Several genes and biological functions in a wide variety of cell types affected by heat stress have thus been reported (15–27).

In the present study, in order to further elucidate the molecular mechanisms underlying cellular responses to MHT in cancer cells, we compared the gene expression profiles by using high-density oligonucleotide microarrays and computational gene expression analysis tools in two human cancer cell lines, HeLa cervical squamous cell carcinoma (SCC) and HSC-3 oral SCC cells, exposed to MHT at 41°C. Moreover, common expression patterns responsive to MHT in two other human cell lines, MCF-7 breast adenocarcinoma and HO-1-N-1 oral SCC, in addition to the HeLa and HSC-3 cell lines were determined by real-time quantitative polymerase chain reaction (qPCR).

Materials and methods

Cell culture

The human oral SCC cell lines, HSC-3 (derived from tongue carcinoma) and HO-1-N-1 (derived from buccal mucosa) were obtained from the Human Science Research Resources Bank of the Japan Health Sciences Foundation (Tokyo, Japan). The human cervical SCC cell line, HeLa, and the breast adenocarcinoma cell line, MCF-7, were provided by the RIKEN BioResource Center through the National BioResource Project of the Ministry of Education, Culture, Sports, Science and Technology (MEXT) (Tsukuba, Japan). The HeLa and MCF-7 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies Co., Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS). The HSC-3 and HO-1-N-1 cells were cultured in Eagle’s minimum Essential medium (Wako Pure Chemical Industries, Ltd., Osaka, Japan) and DMEM/Ham’s F-12 medium (Wako Pure Chemical Industries, Ltd.), respectively, each supplemented with 10% FBS. The cells were maintained at 37°C in a humidified atmosphere with 5% CO2 and 95% air.

Exposure to MHT

The cells were exposed to MHT by immersing plastic culture vessels containing the attached cells in a water bath at 41°C for 30 min. Following exposure to heat, the cells were incubated for 0–24 h at 37°C.

Analyses of cell viability and cell cycle

For cell viability, the trypan blue dye exclusion test was performed. The cells excluding the dye were counted using a hematocytometer. For the cell cycle, cells were fixed with 70% ice-cold ethanol and then treated with RNase A and propidium iodide (PI). The samples were run on an Epics XL flow cytometer (Beckman Coulter, Fullerton, CA, USA) as previously described (28).

RNA isolation

Total RNA was extracted from the cells using an RNeasy Total RNA Extraction kit (Qiagen, Valencia, CA, USA) along with On-Column DNase I treatment. The RNA concentration was measured using a Nanodrop spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). RNA integrity was determined using a Bioanalyzer 2100 (Agilent Technologies, Inc., Santa Clara, CA, USA). RNA samples with RNA integrity number (RIN) values >9.5 were considered acceptable.

Global-scale gene expression analysis

Global-scale gene expression analysis was performed using a GeneChip® microarray system with a Human Genome U133-plus 2.0 array, which was spotted with 54,675 probe sets (Affymetrix Inc., Santa Clara, CA, USA) according to the manufacturer’s instructions. In brief, 500 ng of total RNA were used to synthesize cRNA with a GeneChip® 3′ IVT Express kit (Affymetrix Inc.). Following fragmentation, biotin-labeled cRNA was hybridized to the array at 45°C for 16 h. The arrays were washed, stained with streptavidin-phycoerythrin, and scanned using a probe array scanner. The obtained hybridization intensity data were analyzed using GeneSpring® GX (Agilent Technologies Inc.) to extract the significant genes. To examine gene ontology, including biological processes, cellular components, molecular functions and gene networks, the obtained data were analyzed using Ingenuity® Pathway Analysis tools (Ingenuity Systems Inc., Mountain View, CA, USA), a web-delivered application that enables the identification, visualization and investigation of molecular interaction networks in gene expression data (29,30).

Real-time qPCR assay

The reverse transcriptase reaction was carried out with total RNA using a random 6-mer and an oligo(dT) primer. Real-time qPCR was performed on an M×3005P real-time PCR system (Agilent Technologies Inc.) using SYBR PreMix ExTaq (Takara Bio Inc., Shiga, Japan) or Premix Ex Taq (for the use of TaqMan probes; Takara Bio Inc.). The specific primer and probe sequences for B-cell CLL/ lymphoma 2 (BCL2)-associated athanogene 3 (BAG3), B-cell CLL/lymphoma 6 (BCL6), bone morphogenetic protein 2 (BMP2), connective tissue growth factor (CTGF), DnaJ (Hsp40) homolog, subfamily B, member 1 (DNAJB1), endothelin 1 (EDN1), early growth response 1 (ERG1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), heat shock 70 kDa protein 1A/B (HSPA1A/B), heat shock 105/110 kDa protein (HSPA1H), heat shock 70 kDa protein 6 (HSP70B’) (HSPA6), MAX dimerization protein 1 (MXD1) and suppressor of cytokine signaling 3 (SOCS3) are listed in Table I. GAPDH was used as a control for normalization.

Table I.

Nucleotide sequences of primers and TaqMan probes for target genes.

Table I.

Nucleotide sequences of primers and TaqMan probes for target genes.

GeneOrientationNucleotide sequence (5′-3′)GenBank accession no.
BAG3Sense CGACCAGGCTACATTCCCATNM_004281
Antisense TCTGGCTGAGTGGTTTCTGG
BCL6Sense AATCGTCTCCGGAGTCGAGACANM_002357
Antisense TGATGTTGCCCTCCCGCAAA
BMP2Sense ATGCTGTGTCCCGACAGAACNM_001200
Antisense AACCCTCCACAACCATGTCC
CTGFSense CTGCAGGCTAGAGAAGCAGANM_001901
Antisense CCGTCGGTACATACTCCACA
DNAJB1Sense ACCCGGACAAGAACAAGGAGNM_006145
Antisense GCCACCGAAGAACTCAGCAA
EDN1Sense CTTGCCAAGGAGCTCCAGAANM_001955
Antisense GGCTTCCAAGTCCATACGGAA
HSPA1A/BSense AGGTGCAGGTGAGCTACAAGNM_005346
Antisense ATGATCCGCAGCACGTTGAG
HSPH1Sense ACCATGCTGCTCCTTTCTCCNM_006644
Antisense CTGGGTTTTCTGGTGGTCTC
HSPA6Sense GGCCATGACCAAGGACAACANM_002155
Antisense AACCATCCTCTCCACCTCCT
MXD1Sense AGACGGGCTCATCTTCGCTTNM_002357
Antisense GCTGAAGCTGGTCGATTTGGTG
SOCS3Sense TCTGTCGGAAGACCGTCAACNM_003955
Antisense TAAAGCGGGGCATCGTACTG
EGR1Sense GGAGCAAAATAAGGAAGAGNM_001964
Antisense GAGAGTTCAGATTTTGTTTTAG
Probe FAM-AGCTGAGCTTCGGTTCTCCA-TAMRA
GAPDHSense AAGGACTCATGACCACAGTCCATNM_002046
Antisense CCATCACGCCACAGTTTCC
Probe FAM-CCATCACTGCCACCCAGAAGACTGTG-TAMRA

[i] BAG3, BCL2-associated athanogene 3; BCL6, B-cell CLL/lymphoma 6; BMP2, bone morphogenetic protein 2; CTGF, connective tissue growth factor; DNAJB1, DnaJ (Hsp40) homolog, subfamily B, member 1; EDN1, endothelin 1; HSPA1A/B, heat shock 70 kDa protein 1A/B; HSPA6, heat shock 70 kDa protein 6 (HSP70B’); MXD1, MAX dimerization protein ; SOCS3, suppressor of cytokine signaling 3; EGR1, early growth response 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Statistical analysis

Data are presented as the means ± SD. Differences between pairs of data sets were analyzed using the Student’s t-test, with values of P<0.05 considered to indicate statistically significant differences.

Results

Effects of MHT on cell viability and the cell cycle in cancer cell lines

We used a trypan blue dye exclusion test to assess cell viability. Fig. 1A and B indicate the number of HeLa and HSC-3 cells following exposure to MHT at 41°C for 30 min followed by culture at 37°C for 24 h. MHT did not inhibit cell viability compared to the control (37°C treatment) in either cell line. Moreover, the cell cycle distribution was monitored by PI staining with flow cytometry. The percentages of control HeLa and HSC-3 cells in the G0/G1, S and G2/M phase were 26.9±4.8, 18.5±3.3 and 52.3±1.2% for the HeLa cells and 17.5±4.2, 19.3±2.5 and 62.2±3.4% for the HSC-3 cells (means ± SD), respectively. Changes in cell cycle distribution were not observed in the cells exposed to MHT (Fig. 1C and D). Exposure to MHT at 41°C for 30 min did not affect cell viability or the cell cycle distribution in the other cancer cell lines, MCF-7 and HO-1-N-1 (data not shown). These data demonstrated that the cells exposed to MHT at 41°C for 30 min did not undergo cell damage and cell cycle arrest.

Figure 1.

Effects of mild hyperthermia (MHT) on cell viability and the cell cycle in HeLa and HSC-3 cells. The cells were incubated at 37°C (control) or 41°C (MTH) for 30 min and then cultured at 37°C for 24 h. (A and B) The cell viability and (C and D) cell cycle were analyzed. (A and C) HeLa cells. (B and D) HSC-3 cells. Data are presented as the means ± SD (n=4).

Global-scale gene expression analysis

Global-scale gene expression analysis was performed using a GeneChip microarray system and GeneSpring software. Of the 54,675 probe sets analyzed, many probe sets that were differentially expressed by ≥1.5-fold were detected. We identified 1,053 and 1,278 upregulated, and 701 and 673 downregulated probe sets in the HeLa and HSC-3 cells exposed to MHT at 41°C for 30 min, respectively. Fig. 2 demonstrates the time course of changes in gene expression. In all, 248 and 52 probe sets were also found to be commonly upregulated and downregulated in these respective cell lines (Fig. 2). The complete lists of genes from the HeLa and HSC-3 cell samples have been deposited in the Gene Expression Omnibus (GEO), a public database (accession numbers: GSE43701 and GSE43862).

Figure 2.

Global-scale gene expression analysis. HeLa and HSC-3 cells were incubated at 41°C for 30 min and then cultured at 37°C for 0-3 h. Gene expression analysis was performed using a GeneChip® microarray system and GeneSpring® software. The expression patterns of upregulated and downregulated probe sets in both cell lines are presented. Each number of probe sets is shown.

Identification of biological functions and gene networks

To identify the biological functions and gene networks in the differentially expressed probe sets in the HeLa and HSC-3 cells exposed to MHT, either functional category or gene network analysis was conducted by use of the Ingenuity Pathways Knowledge Base. We identified several functionally annotated genes: 494 and 637 upregulated genes, and 303 and 330 down-regulated genes in the HeLa and HSC-3 cells exposed to MHT, respectively (Table II). The top three biological functions in each group are summarized in Table II. Biological functions including cell death and survival, gene expression and cellular function and maintenance, were observed in the upregulated genes in both cell lines, and the most prominent functions of commonly upregulated genes were cellular functions and maintenance (48 genes), as well as cell death and survival (60 genes). In the downregulated genes in both cell lines, biological functions including cell cycle, gene expression and cell death and survival were observed. The specific biological functions were cell cycle (13 genes) and cell death and survival (18 genes) in commonly downregulated genes (Table II). Furthermore, we identified two significant gene networks, A and B, that were obtained from commonly upregulated genes in both cell lines (Figs. 3 and 4). Gene network A included several HSPs, such as HSPA1A/B, heat shock 70 kDa protein 1-like (HSPA1L), heat shock protein 4 like (HSPA4L), HSPA6, heat shock 27 kDa protein 1 (HSPB1), HSPH1, DNAJB1, and DnaJ (Hsp40) homolog, subfamily B, member 4 (DNAJB4), as well as BAG3, and was associated with the biological functions of cellular function and maintenance (Fig. 3). Gene network B included ten genes: BCL6, basic helix-loop-helix family, member e40 (BHLHE40), BMP2, CTGF, dual specificity phosphatase 1 (DUSP1), EDN1, EGR1, MXD1, SOCS3 and SRY (sex determining region Y)-box 6 (SOX6) and was associated with the biological functions of cell death and survival (Fig. 4).

Figure 3.

Gene network A. Commonly upregulated probe sets for the mild hyperthermia (MHT) conditions were analyzed by the Ingenuity Pathways Analysis software. The network is shown graphically as nodes (genes) and edges (the biological associations between the nodes).

Figure 4.

Gene network B. Commonly upregulated probe sets for the mild hyperthermia (MHT) conditions were analyzed by the Ingenuity Pathways Analysis software. The network is shown graphically as nodes (genes) and edges (the biological associations between the nodes). For edge labels, see Fig. 3.

Table II.

Top three biological functions.

Table II.

Top three biological functions.

NameP-valueNumbers of molecules
HeLa upregulated genes (494)a
  Cell death and survival 3.34E-05-3.39E-02224
  Gene expression 4.92E-05-3.39E-02169
  Cellular development 2.89E-04-3.39E-02202
HeLa downregulated genes (303)a
  Gene expression 6.21E-06-3.57E-02140
  Cellular assembly and organization 1.00E-04-3.57E-0290
  Cellular function and maintenance 1.00E-04-3.57E-0280
HSC-3 upregulated genes (637)a
  Cell death and survival 2.92E-13-2.85E-03292
  Gene expression 3.32E-13-2.71E-03248
  Cellular growth and proliferation 4.54E-10-2.99E-03299
HSC-3 downregulated genes (330)a
  Cell cycle 3.44E-06-3.24E-02102
  Cell death and survival 3.31E-05-3.25E-02148
  Cellular development 9.25E-05-3.26E-02111
Commonly upregulated genes (114)a
  Cellular function and maintenance 2.21E-07-1.89E-0248
  Cell death and survival 2.46E-06-2.01E-0260
  Cellular movement 2.97E-05-2.02E-0240
Commonly downregulated genes (35)a
  Cell cycle 9.35E-05-4.86E-0248
  Cell death and survival 6.09E-04-4.56E-0260
  Gene expression 6.17E-04-4.86E-0240

a Numbers of functionally annotated genes.

Verification of differentially expressed genes by real-time qPCR

To verify the alterations analyzed by the GeneChip microarray system, we used two cancer cell lines, MCF-7 and HO-1-N-1, in addition to the HeLa and HSC-3 cell lines. Time-dependent changes in the expression levels of selected genes that belonged to gene network A or B were measured using real-time qPCR. Among the genes in gene network A, the expression levels of HSPA1A/B, HSPA6, HSPH1, DNAJB1 and BAG3 were markedly elevated immediately following exposure to MHT in all four cell lines. The expression levels of BCL6, BMP2, CTGF, EDN1 and MXD1 in gene network B were significantly increased at 1 h following exposure to MHT in all four cell lines. The expression levels of EGR1 and SOCS3 were significantly increased at 0, 1 and 3 h following exposure to MHT in all four cell lines. These results are in very close agreement with those of the GeneChip® analysis with the HeLa and HSC-3 cells (Fig. 5).

Figure 5.

Verification of GeneChip® microarray results by real-time quantitative polymerase chain reaction (qPCR). The cancer cell lines, HeLa, HSC-3 (HSC), MCF-7 (MCF) and HO-1-N-1 (HO), were incubated at 41°C for 30 min and then cultured at 37°C for 0, 1 and 3 h. Real-time qPCR was performed. (A) BCL2-associated athanogene 3 (BAG3), (B) B-cell CLL/lymphoma 6 (BCL6), (C) bone morphogenetic protein 2 (BMP2), (D) connective tissue growth factor (CTGF), (E) DnaJ (Hsp40) homolog, subfamily B, member 1 (DNAJB1), (F) endothelin 1 (EDN1), (G) early growth response 1 (EGR1), (H) heat shock 70 kDa protein 1A/B (HSPA1A/B), (I) HSPH1, (J) heat shock 70 kDa protein 6 (HSP70B’) (HSPA6), (K) MAX dimerization protein 1 (MXD1) and (L) suppressor of cytokine signaling 3 (SOCS3). Each expression level was normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression level. Data are presented as the means ± SD (n=3–4). *P<0.05 vs. control (non-treated cells).

Discussion

HT is a well-established treatment modality that is used alone or in combination with radiotherapy and/or chemotherapy for the treatment of a variety of tumors (1). However, due to the complexity of the heat stress signal transduction, the elucidation of the molecular mechanisms involved in the cellular responses to heat stress has remained a major challenge in studies of HT. In this study, we used global-scale microarray analysis, in conjunction with bioinformatics tools, and identified unique common gene networks in response to MHT in cancer cells.

It is well known that a temperature of 42.5°C for cancer cells is the inflection point of HT. That is, cancer cells exposed to temperatures >42.5°C undergo cell death; however, the exposure of cells to a temperature of up to 42.5°C induces little or no cytotoxicity (2). In the present study, the exposure of HeLa and HSC-3 human SCC cells to MHT at 41°C, below the inflection point, did not affect cell viability or the cell cycle, as has also been shown in our previous studies (24–27). By contrast, several genes that were upregulated or downregulated by ≥1.5-fold were identified in both cancer cell lines following exposure to MHT. These results were comparable to those from previous studies on MHT conditions using cancer or normal cell lines (17,23–27). Previous studies have indicated that heat induces a significant decrease in mRNA and protein synthesis in order to increase the transcription of heat-responsive genes, such as HSPs, and that this overall reprogramming of gene expression permits the selective synthesis of HSPs (31,32). Therefore, in this study, we focused on the common and upregulated genes elicited by MHT. We successfully identified two significant gene networks, A and B, derived from commonly upregulated genes in HeLa and HSC-3 cells exposed to MHT. In addition, the expression levels of 12 out of 19 genes selected were increased in the four cancer cell lines. Gene network A included several HSPs, as well as BAG3, and was specifically associated with the biological functions of cellular function and maintenance. Several microarray studies have demonstrated that the induction of HSPs is a common response to heat stress with or without cell death (15–27). HSPs protect cells both by limiting the effects of protein-damaging agents through protein chaperoning and refolding and by directly blocking the pathway of cell death, such as apoptosis or necrosis (12). In gene network A, HSPA1A/B (33,34), HSPB1 (35), HSPH1 (36) and DNAJB1 (33) were found to be associated with cytoprotection. BAG3 is a family of co-chaperons that interact with Hsp70 (37,38). The interaction between BAG3 and DNAJB1 or DNAJB4 has also been observed in human cells (39). The siRNA-mediated inhibition of BAG3 expression has been shown to increase apoptosis, indicating that BAG3 plays a role in the prevention of cell death (37,38).

Furthermore, Ingenuity Pathway Analysis allowed us to identify the significant gene network B, which was associated with the biological functions of cell death and survival. Seven genes in network B, BCL6 (40), BMP2 (41), CTGF (42), EDN1 (43), EGR1 (44), MXD1 (45) and SOCS3 (46), have been described as anti-cell death molecules in several types of cells, including cancer cells. Of note, we elucidated the interactions among the genes in gene network B: that is, EDN1 is involved in the upregulation of mRNAs for EGR1 (47), CTGF (48) and SOCS3 (49). It has also been reported that the binding of MXD1 DNA and EGR1 protein (50), as well as the protein-protein interaction between CTGF and BMP2 (51), occur in mammalian cells. Genes having cytoprotective or anti-cell death activity in gene networks A and B may play a role in protecting cancer cells from MHT stress.

Although HT is an important modality in cancer treatment, the acquisition of thermoresistance in cancer cells due to the elevation of HSPs makes HT less effective (13,14). The induction of HSPs is regulated mainly at the transcriptional level by the activation of heat shock transcription factor 1 (HSF1) (52,53). In addition, the induction of BAG3 is mediated, at least in part, by the activation of HSF1, as in the case of HSPs (54). Of note, the inhibition of the functions of HSF1 (55–57) or Hsp70 (58) by the use of gene targeting has been shown to sensitize HT-induced cell death in cancer cells. The targeting of heat shock response pathways, including these molecules in combination with HT may become a promising therapeutic approach for the treatment of cancer. In this study, we identified two gene networks comprising of several cytoprotective genes in four cancer cell lines exposed to MHT. Thus, the findings presented in this study may prove useful towards the design of more effective therapeutic strategies involving MHT or HT for the treatment of cancer.

Abbreviations:

BAG3

BCL2-associated athanogene 3;

BCL2

B-cell CLL/lymphoma 2;

BCL6

B-cell CLL/lymphoma 6;

BHLHE40

basic helix-loop-helix family, member e40;

BMP2

bone morphogenetic protein 2;

CTGF

connective tissue growth factor;

DMEM

Dulbecco’s modified Eagle’s medium;

DNAJB1

DnaJ (Hsp40) homolog, subfamily B, member 1;

DNAJB4

DnaJ (Hsp40) homolog, subfamily B, member 4;

DUSP1

dual specificity phosphatase 1;

EDN1

endothelin 1;

ERG1

early growth response 1;

FBS

fetal bovine serum;

GAPDH

glyceraldehyde-3-phosphate dehydrogenase;

HSF1

heat shock transcription factor 1;

HSP

heat shock protein;

HSPA1A/B

heat shock 70 kDa protein 1A/B;

HSPA1H

heat shock 105/110 kDa protein;

HSPA1L

heat shock 70 kDa protein 1-like;

HSPA4L

heat shock protein 4 like;

HSPA6

heat shock 70 kDa protein 6 (HSP70B’);

HSPB1

heat shock 27 kDa protein 1;

HT

hyperthermia;

MHT

mild hyperthermia;

MXD1

MAX dimerization protein 1;

PI

propidium iodide;

qPCR

quantitative polymerase chain reaction;

SCC

squamous cell carcinoma;

SOCS3

suppressor of cytokine signaling 3;

SOX6

SRY (sex determining region Y)-box 6

Acknowledgements

The present study was supported in part by a Grant-in-Aid for Challenging Exploratory Research (23650303) from the Japan Society for the Promotion of Science, and by research grants from the University of Toyama.

References

1. 

Hall EJ: Hyperthermia. Radiobiology for the Radiologist. 5th edition. Hall EJ: Lippincott Williams & Wilkins; pp. 495–520. 2000

2. 

Dewey WC: Arrhenius relationships from the molecule and cell to the clinic. Int J Hyperthermia. 25:3–20. 2009. View Article : Google Scholar

3. 

van der Zee J, González González D, van Rhoon GC, van Dijk JD, van Putten WL and Hart AA: Comparison of radiotherapy alone with radiotherapy plus hyperthermia in locally advanced pelvic tumours: a prospective, randomised, multicentre trial. Dutch Deep Hyperthermia Group Lancet. 355:1119–1125. 2000.PubMed/NCBI

4. 

Wust P, Hildebrandt B, Sreenivasa G, et al: Hyperthermia in combined treatment of cancer. Lancet Oncol. 3:487–497. 2002. View Article : Google Scholar : PubMed/NCBI

5. 

Issels RD: Hyperthermia adds to chemotherapy. Eur J Cancer. 44:2546–2554. 2008. View Article : Google Scholar : PubMed/NCBI

6. 

Issels RD, Lindner LH, Verweij J, et al: Neo-adjuvant chemotherapy alone or with regional hyperthermia for localised high-risk soft-tissue sarcoma: a randomised phase 3 multicentre study. Lancet Oncol. 11:561–570. 2010. View Article : Google Scholar : PubMed/NCBI

7. 

Westermann A, Mella O, Van Der Zee J, et al: Long-term survival data of triple modality treatment of stage IIB-III-IVA cervical cancer with the combination of radiotherapy, chemotherapy and hyperthermia - an update. Int J Hyperthermia. 28:549–553. 2012. View Article : Google Scholar : PubMed/NCBI

8. 

Beachy SH and Repasky EA: Toward establishment of temperature thresholds for immunological impact of heat exposure in humans. Int J Hyperthermia. 27:344–352. 2011. View Article : Google Scholar : PubMed/NCBI

9. 

Frey B, Weiss EM, Rubner Y, et al: Old and new facts about hyperthermia-induced modulations of the immune system. Int J Hyperthermia. 28:528–542. 2012. View Article : Google Scholar : PubMed/NCBI

10. 

Lindquist S: The heat-shock response. Annu Rev Biochem. 55:1151–1191. 1986. View Article : Google Scholar

11. 

Richter K, Haslbeck M and Buchner J: The heat shock response: life on the verge of death. Mol Cell. 40:253–266. 2010. View Article : Google Scholar : PubMed/NCBI

12. 

Beere HM: ‘The stress of dying’: the role of heat shock proteins in the regulation of apoptosis. J Cell Sci. 117:2641–2651. 2004.

13. 

Li GC and Werb Z: Correlation between synthesis of heat shock proteins and development of thermotolerance in Chinese hamster fibroblasts. Proc Natl Acad Sci USA. 79:3218–3222. 1982. View Article : Google Scholar : PubMed/NCBI

14. 

Nollen EA, Brunsting JF, Roelofsen H, Weber LA and Kampinga HH: In vivo chaperone activity of heat shock protein 70 and thermotolerance. Mol Cell Biol. 19:2069–2079. 1999.PubMed/NCBI

15. 

Dinh HK, Zhao B, Schuschereba ST, Merrill G and Bowman PD: Gene expression profiling of the response to thermal injury in human cells. Physiol Genomics. 7:3–13. 2001.PubMed/NCBI

16. 

Sonna LA, Gaffin SL, Pratt RE, Cullivan ML, Angel KC and Lilly CM: Effect of acute heat shock on gene expression by human peripheral blood mononuclear cells. J Appl Physiol. 92:2208–2220. 2002. View Article : Google Scholar : PubMed/NCBI

17. 

Murray JI, Whitfield ML, Trinklein ND, Myers RM, Brown PO and Botstein D: Diverse and specific gene expression responses to stresses in cultured human cells. Mol Biol Cell. 15:2361–2374. 2004. View Article : Google Scholar : PubMed/NCBI

18. 

Zhou M, Zhang A, Lin B, Liu J and Xu LX: Study of heat shock response of human umbilical vein endothelial cells (HUVECs) using cDNA microarray. Int J Hyperthermia. 23:225–258. 2007. View Article : Google Scholar : PubMed/NCBI

19. 

Wong HR, Odoms K and Sakthivel B: Divergence of canonical danger signals: the genome-level expression patterns of human mononuclear cells subjected to heat shock or lipopolysaccharide. BMC Immunol. 9:242008. View Article : Google Scholar

20. 

Narita N, Noda I, Ohtsubo T, et al: Analysis of heat-shock related gene expression in head-and-neck cancer using cDNA arrays. Int J Radiat Oncol Biol Phys. 53:190–196. 2002. View Article : Google Scholar : PubMed/NCBI

21. 

Kato N, Kobayashi T and Honda H: Screening of stress enhancer based on analysis of gene expression profiles: enhancement of hyperthermia-induced tumor necrosis by an MMP-3 inhibitor. Cancer Sci. 94:644–649. 2003. View Article : Google Scholar : PubMed/NCBI

22. 

Borkamo ED, Dahl O, Bruland O and Fluge O: Global gene expression analyses reveal changes in biological processes after hyperthermia in a rat glioma model. Int J Hyperthermia. 24:425–441. 2008. View Article : Google Scholar : PubMed/NCBI

23. 

Laramie JM, Chung TP, Brownstein B, Stormo GD and Cobb JP: Transcriptional profiles of human epithelial cells in response to heat: computational evidence for novel heat shock proteins. Shock. 29:623–630. 2008.PubMed/NCBI

24. 

Tabuchi Y, Takasaki I, Wada S, et al: Genes and genetic networks responsive to mild hyperthermia in human lymphoma U937 cells. Int J Hyperthermia. 24:613–622. 2008. View Article : Google Scholar : PubMed/NCBI

25. 

Furusawa Y, Tabuchi Y, Wada S, Takasaki I, Ohtsuka K and Kondo T: Identification of biological functions and gene networks regulated by heat stress in U937 human lymphoma cells. Int J Mol Med. 28:143–151. 2011.PubMed/NCBI

26. 

Tabuchi Y, Wada S, Furusawa Y, Ohtsuka K and Kondo T: Gene networks related to the cell death elicited by hyperthermia in human oral squamous cell carcinoma HSC-3 cells. Int J Mol Med. 29:380–386. 2012.PubMed/NCBI

27. 

Tabuchi Y, Furusawa Y, Kariya A, Wada S, Ohtsuka K and Kondo T: Common gene expression patterns responsive to mild temperature hyperthermia in normal human fibroblastic cells. Int J Hyperthermia. 29:38–50. 2013. View Article : Google Scholar : PubMed/NCBI

28. 

Furusawa Y, Iizumi T, Fujiwara Y, et al: Inhibition of checkpoint kinase 1 abrogates G2/M checkpoint activation and promotes apoptosis under heat stress. Apoptosis. 17:102–112. 2012. View Article : Google Scholar : PubMed/NCBI

29. 

Tabuchi Y, Takasaki I, Doi T, Ishii Y, Sakai H and Kondo T: Genetic networks responsive to sodium butyrate in colonic epithelial cells. FEBS Lett. 580:3035–3041. 2006. View Article : Google Scholar : PubMed/NCBI

30. 

Ahmed K, Furusawa Y, Tabuchi Y, et al: Chemical inducers of heat shock proteins derived from medicinal plants and cytoprotective genes response. Int J Hyperthermia. 28:1–8. 2012. View Article : Google Scholar : PubMed/NCBI

31. 

Mariner PD, Walters RD, Espinoza CA, et al: Human Alu RNA is a modular transacting repressor of mRNA transcription during heat shock. Mol Cell. 29:499–509. 2008. View Article : Google Scholar : PubMed/NCBI

32. 

Spriggs KA, Bushell M and Willis AE: Translational regulation of gene expression during conditions of cell stress. Mol Cell. 40:228–237. 2010. View Article : Google Scholar : PubMed/NCBI

33. 

Zhou H, Li SH and Li XJ: Chaperone suppression of cellular toxicity of huntingtin is independent of polyglutamine aggregation. J Biol Chem. 276:48417–48424. 2001.PubMed/NCBI

34. 

Hageman J, van Waarde MA, Zylicz A, Walerych D and Kampinga HH: The diverse members of the mammalian HSP70 machine show distinct chaperone-like activities. Biochem J. 435:127–142. 2011. View Article : Google Scholar : PubMed/NCBI

35. 

Lee YJ, Lee DH, Cho CK, et al: HSP25 inhibits radiation-induced apoptosis through reduction of PKCdelta-mediated ROS production. Oncogene. 24:3715–3725. 2005. View Article : Google Scholar : PubMed/NCBI

36. 

Yamagishi N, Goto K, Nakagawa S, Saito Y and Hatayama T: Hsp105 reduces the protein aggregation and cytotoxicity by expanded-polyglutamine proteins through the induction of Hsp70. Exp Cell Res. 316:2424–2433. 2010. View Article : Google Scholar : PubMed/NCBI

37. 

Rosati A, Ammirante M, Gentilella A, et al: Apoptosis inhibition in cancer cells: a novel molecular pathway that involves BAG3 protein. Int J Biochem Cell Biol. 39:1337–1342. 2007. View Article : Google Scholar : PubMed/NCBI

38. 

Jacobs AT and Marnett LJ: HSF1-mediated BAG3 expression attenuates apoptosis in 4-hydroxynonenal-treated colon cancer cells via stabilization of anti-apoptotic Bcl-2 proteins. J Biol Chem. 284:9176–9183. 2009. View Article : Google Scholar : PubMed/NCBI

39. 

Behrends C, Sowa ME, Gygi SP and Harper JW: Network organization of the human autophagy system. Nature. 466:68–76. 2010. View Article : Google Scholar : PubMed/NCBI

40. 

Kumagai T, Miki T, Kikuchi M, et al: The proto-oncogene Bc16 inhibits apoptotic cell death in differentiation-induced mouse myogenic cells. Oncogene. 18:467–475. 1999. View Article : Google Scholar : PubMed/NCBI

41. 

Chen S, Guttridge DC, Tang E, Shi S, Guan K and Wang CY: Suppression of tumor necrosis factor-mediated apoptosis by nuclear factor kappaB-independent bone morphogenetic protein/Smad signaling. J Biol Chem. 276:39259–39263. 2001. View Article : Google Scholar : PubMed/NCBI

42. 

Wang MY, Chen PS, Prakash E, et al: Connective tissue growth factor confers drug resistance in breast cancer through concomitant up-regulation of Bcl-xL and cIAP1. Cancer Res. 69:3482–3491. 2009. View Article : Google Scholar : PubMed/NCBI

43. 

Raymond MN, Bole-Feysot C, Banno Y, Tanfin Z and Robin P: Endothelin-1 inhibits apoptosis through a sphingosine kinase 1-dependent mechanism in uterine leiomyoma ELT3 cells. Endocrinology. 147:5873–5882. 2006. View Article : Google Scholar : PubMed/NCBI

44. 

Weisz L, Zalcenstein A, Stambolsky P, et al: Transactivation of the EGR1 gene contributes to mutant p53 gain of function. Cancer Res. 64:8318–8327. 2004. View Article : Google Scholar : PubMed/NCBI

45. 

Lüscher B: Function and regulation of the transcription factors of the Myc/Max/Mad network. Gene. 277:1–14. 2001.

46. 

Puhr M, Santer FR, Neuwirt H, et al: Down-regulation of suppressor of cytokine signaling-3 causes prostate cancer cell death through activation of the extrinsic and intrinsic apoptosis pathways. Cancer Res. 69:7375–7384. 2009. View Article : Google Scholar : PubMed/NCBI

47. 

Bruneau BG, Piazza LA and de Bold AJ: BNP gene expression is specifically modulated by stretch and ET-1 in a new model of isolated rat atria. Am J Physiol. 273:H2678–H2686. 1997.PubMed/NCBI

48. 

Koitabashi N, Arai M, Kogure S, et al: Increased connective tissue growth factor relative to brain natriuretic peptide as a determinant of myocardial fibrosis. Hypertension. 49:1120–1127. 2007. View Article : Google Scholar : PubMed/NCBI

49. 

Chang HH, Huang YM, Wu CP, et al: Endothelin-1 stimulates suppressor of cytokine signaling-3 gene expression in adipocytes. Gen Comp Endocrinol. 178:450–458. 2012. View Article : Google Scholar : PubMed/NCBI

50. 

Virolle T, Krones-Herzig A, Baron V, De Gregorio G, Adamson ED and Mercola D: Egr1 promotes growth and survival of prostate cancer cells. Identification of novel Egr1 target genes. J Biol Chem. 278:11802–11810. 2003. View Article : Google Scholar : PubMed/NCBI

51. 

Maeda S: An impact of CCN2-BMP-2 complex upon chondrocyte biology: evoking a signalling pathway bypasses ERK and Smads? J Biochem. 150:219–221. 2011. View Article : Google Scholar : PubMed/NCBI

52. 

Morimoto RI: Regulation of the heat shock transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators. Genes Dev. 12:3788–3796. 1998. View Article : Google Scholar

53. 

Akerfelt M, Morimoto RI and Sistonen L: Heat shock factors: integrators of cell stress, development and lifespan. Nat Rev Mol Cell Biol. 11:545–555. 2010. View Article : Google Scholar : PubMed/NCBI

54. 

Franceschelli S, Rosati A, Lerose R, De Nicola S, Turco MC and Pascale M: Bag3 gene expression is regulated by heat shock factor 1. J Cell Physiol. 215:575–577. 2008. View Article : Google Scholar : PubMed/NCBI

55. 

Rossi A, Ciafrè S, Balsamo M, Pierimarchi P and Santoro MG: Targeting the heat shock factor 1 by RNA interference: a potent tool to enhance hyperthermochemotherapy efficacy in cervical cancer. Cancer Res. 66:7678–7685. 2006. View Article : Google Scholar : PubMed/NCBI

56. 

Nakamura Y, Fujimoto M, Hayashida N, Takii R, Nakai A and Muto M: Silencing HSF1 by short hairpin RNA decreases cell proliferation and enhances sensitivity to hyperthermia in human melanoma cell lines. J Dermatol Sci. 60:187–192. 2010. View Article : Google Scholar : PubMed/NCBI

57. 

Tabuchi Y, Furusawa Y, Wada S, Ohtsuka K and Kondo T: Silencing heat shock transcription factor 1 using small interfering RNA enhances mild hyperthermia and hyperthermia sensitivity in human oral squamous cell carcinoma cells. Thermal Med. 27:99–108. 2011. View Article : Google Scholar

58. 

Gabai VL, Budagova KR and Sherman MY: Increased expression of the major heat shock protein Hsp72 in human prostate carcinoma cells is dispensable for their viability but confers resistance to a variety of anticancer agents. Oncogene. 24:3328–3338. 2005. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kariya A, Tabuchi Y, Yunoki T and Kondo T: Identification of common gene networks responsive to mild hyperthermia in human cancer cells. Int J Mol Med 32: 195-202, 2013.
APA
Kariya, A., Tabuchi, Y., Yunoki, T., & Kondo, T. (2013). Identification of common gene networks responsive to mild hyperthermia in human cancer cells. International Journal of Molecular Medicine, 32, 195-202. https://doi.org/10.3892/ijmm.2013.1366
MLA
Kariya, A., Tabuchi, Y., Yunoki, T., Kondo, T."Identification of common gene networks responsive to mild hyperthermia in human cancer cells". International Journal of Molecular Medicine 32.1 (2013): 195-202.
Chicago
Kariya, A., Tabuchi, Y., Yunoki, T., Kondo, T."Identification of common gene networks responsive to mild hyperthermia in human cancer cells". International Journal of Molecular Medicine 32, no. 1 (2013): 195-202. https://doi.org/10.3892/ijmm.2013.1366
Copy and paste a formatted citation
x
Spandidos Publications style
Kariya A, Tabuchi Y, Yunoki T and Kondo T: Identification of common gene networks responsive to mild hyperthermia in human cancer cells. Int J Mol Med 32: 195-202, 2013.
APA
Kariya, A., Tabuchi, Y., Yunoki, T., & Kondo, T. (2013). Identification of common gene networks responsive to mild hyperthermia in human cancer cells. International Journal of Molecular Medicine, 32, 195-202. https://doi.org/10.3892/ijmm.2013.1366
MLA
Kariya, A., Tabuchi, Y., Yunoki, T., Kondo, T."Identification of common gene networks responsive to mild hyperthermia in human cancer cells". International Journal of Molecular Medicine 32.1 (2013): 195-202.
Chicago
Kariya, A., Tabuchi, Y., Yunoki, T., Kondo, T."Identification of common gene networks responsive to mild hyperthermia in human cancer cells". International Journal of Molecular Medicine 32, no. 1 (2013): 195-202. https://doi.org/10.3892/ijmm.2013.1366
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team