Analysis of genes causing hypertension and stroke in spontaneously hypertensive rats: Gene expression profiles in the brain

  • Authors:
    • Momoko Yoshida
    • Yuko Watanabe
    • Kyosuke Yamanishi
    • Akifumi Yamashita
    • Hideyuki Yamamoto
    • Daisuke Okuzaki
    • Kazunori Shimada
    • Hiroshi Nojima
    • Teruo Yasunaga
    • Haruki Okamura
    • Hisato Matsunaga
    • Hiromichi Yamanishi
  • View Affiliations

  • Published online on: January 22, 2014     https://doi.org/10.3892/ijmm.2014.1631
  • Pages: 887-896
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Spontaneously hypertensive rats (SHR) and stroke-prone SHR (SHRSP) are frequently used as rat models not only of essential hypertension and stroke, but also of attention-deficit hyperactivity disorder (ADHD). Normotensive Wistar-Kyoto rats (WKY) are used as the control rats in these cases. An increasing number of studies has demonstrated the critical role of the central nervous system in the development and maintenance of hypertension. In a previous study, we analyzed the gene expression profiles in the adrenal glands of SHR. Thus, in this study, we analyzed gene expression profiles in the brains of SHR in order to identify the genes responsible for causing hypertension and stroke, as well as those involved in ADHD. Using genome-wide microarray technology, we examined the gene expression profiles in the brains of 3 rat strains (SHR, SHRSP and WKY) when the rats were 3 and 6 weeks of age, a period in which the rats are considered to be in a pre-hypertensive state. Gene expression profiles in the brain were compared between SHR and WKY, and between SHRSP and SHR. A total of 179 genes showing a >4- or <-4-fold change in expression were isolated, and candidate genes were selected using two different web tools: the first tool was the Database for Annotation, Visualization and Integrated Discovery (DAVID), which was used to search for significantly enriched genes, and categorized them using Gene Ontology (GO) terms, and the second was the network explorer of Ingenuity Pathway Analysis (IPA), which was used to search for interaction networks among SHR- and SHRSP-specific genes. The IPA of SHR-specific genes revealed that prostaglandin E receptor 4 (Ptger4) is one of the candidate genes responsible for causing hypertension in SHR, and that albumin (Alb) and chymase 1 (Cma1) are also responsible for causing hypertension in SHR in the presence of angiotensinogen (Agt). Similar analyses of SHRSP-specific genes revealed that the angiotensin II receptor-associated gene (Agtrap) interacts with the FBJ osteosarcoma oncogene (Fos), and with the angiotensin II receptor type-1b (Agtr1b). As Agtrap and Agtr1b not only participate in the ‘uptake of norepinephrine’ and ‘blood pressure’, but also in the ‘behavior’ of SHRSP at 6 weeks of age, our data demonstrate a close association between hypertension and ADHD.

Introduction

Studies have been carried out to identify genes causing hypertension using 2 strains of hypertensive rats: spontaneously hypertensive rats (SHR) and a substrain derived from SHR, stroke-prone SHR (SHRSP) (1,2). Normotensive Wistar-Kyoto rats (WKY) are normally used as the control rats (1). Since SHR and SHRSP are not only used as rat models of essential hypertension and stroke, but also as rat models of attention-deficit hyperactivity disorder (ADHD), studies using these rat models are expected to reveal genes not only related to hypertension and stroke, but also those related to ADHD (36). In a previous study, as the first step of this project, we investigated gene expression profiles in adrenal glands in these 3 rats strains when the rats were 3 and 6 weeks of age (7).

An increasing number of studies has demonstrated the critical role of the central nervous system in the development and maintenance of hypertension and brain ventricular enlargement, accompanied by the loss of brain tissue and weight, as well as in the volume of grey matter (8,9). In this study, as a second step in identifying genes responsible for causing hypertension and stroke, as well as those related to ADHD, we compared gene expression profiles in the brains of 3 rat strains, between SHR and WKY, and between SHRSP and SHR. When the rats were at 3 and 6 weeks of age, a period in which the rats are considered to be in a pre-hypertensive state, a total of 179 genes presenting a >4- or <-4-fold change in expression were isolated.

After classifying the 179 genes according to their expression profiles, candidate genes were selected as significantly enriched genes, and categorized with Gene Ontology (GO) terms using the Database for Annotation, Visualization and Integrated Discovery (DAVID) web tools (10,11). Subsequently, the interactions of these genes were analyzed with Ingenuity Pathway Analysis (IPA). IPA of SHR-specific genes revealed that prostaglandin E receptor 4 (Ptger4) is one of the candidate genes responsible for causing hypertension in SHR (12,13), as well as albumin (Alb) and chymase 1 (Cma1), in the presence of angiotensinogen (Agt) (1416). Similar analyses of SHRSP-specific genes revealed that angiotensin II receptor-associated gene (Agtrap) interacts with FBJ osteosarcoma oncogene (Fos), and with angiotensin II receptor type-1B (Agtr1b) (1719). These interactions play pivotal roles among SHRSP-specific genes, and since Agtrap and Agtr1b not only participate in the ‘uptake of norepinephrine’ and ‘blood pressure’, but also in the ‘behavior’ of 6-week-old SHRSP, the data presented in the present study reveal a close association between hypertension and ADHD.

Materials and methods

Animals, RNA extraction, microarray design, microarray analysis and microarray data analysis

The details of these procedures have been described in our previous study [Yamamoto et al (7)].

Animals

The animals used in this study, SHR/Izm, SHRSP/Izm and WKY/Izm, were provided by the Disease Model Cooperative Research Association, Kyoto, Japan. Three-week-old rats were purchased and maintained for 2 days in our animal facility and used as 3-week-old rats. Five-week-old rats were purchased and, after having been maintained for 1 week in our animal facility, were used as 6-week-old rats. All the animals were handled according to the guidelines established by the Japanese Association for Laboratory Animal Science, while all experiments involving rats were approved by the Animal Care and Use Committee of Hyogo College of Medicine on September 27, 2010.

RNA extraction

Briefly, total RNA was purified using an miRNeasy kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

Microarray design

Expression profiling was performed using the 4x44K whole rat genome oligo microarray version 3.0 G2519F (Agilent Technologies Inc., Santa Clara, CA, USA). Eighteen 1-color microarray-based gene analyses were performed with WKY, SHR and SHRSP at 3 and 6 weeks of age as biological triplicates. Each gene expression profile was compared between SHR and WKY, as well as between SHRSP and SHR at 3 and 6 weeks of age.

Microarray analysis

Total RNA (200 ng) was reverse-transcribed into double-stranded cDNA using AffinityScript multiple temperature reverse transcriptase, and amplified. The resulting cRNA were labeled with cyanine-3-labeled cytosine triphosphate (Perkin-Elmer, Wellesley, MA, USA) using a Low Input Quick-Amp Labeling kit (Agilent Technologies Inc.). The labeled samples were hybridized with Agilent 4x44K whole rat genome arrays (Agilent Design #028282). After washing, the slides were scanned with an Agilent Microarray Scanner (G2505C). Feature extraction software (version 10.5.1.1) was used to convert the images into gene expression data.

Microarray data analysis

Raw data were imported into Subio platform version 1.12 (Subio Inc., Aichi, Japan), and raw intensity data were normalized to the 75th percentile intensity of probes above background level (gIsWellAbove=1). SHR- and SHRSP-specific genes were defined as those showing signal ratios with a >4- or <-4-fold change in expression. Raw data were accepted in Gene Expression Omnibus (GEO, accession no. GSE41452).

Quantitative real-time polymerase chain reaction (qRT-PCR)

To validate the results obtained by microarray analysis, 6 enriched genes were randomly selected from 27 unique enriched genes, and qRT-PCR was performed under 10 different experimental conditions. Total RNA (10 ng/reaction) extracted from WKY, SHR and SHRSP, was analyzed using the One-step qPCR kit (RNA-direct SYBR-Green Real-Time PCR Master Mix; Toyobo, Tokyo, Japan). Samples were run in duplicate reactions in 96-well plates, as previously described (20). Median threshold cycle values were used to calculate the fold change (FC) values between SHR and WKY, and between the SHRSP and SHR reference samples. The FC values were normalized to GAPDH levels. The following temperature profile was used: 30 sec at 90°C and 20 min at 61°C for reverse transcription according to the manufacturer’s instructions, followed by 45 cycles at 95°C for 15 sec, 65°C for 15 sec, and 74°C for 35 sec. Statistical comparisons between microarray and qRT-PCR data were performed using Spearman’s rank correlation test.

DAVID web tool analysis

An approach to annotation enrichment analysis was performed using DAVID (http://david.abcc.ncifcrf.gov/) web tools (version 6.7, 2010) (10,11). This web-based resource provides a set of functional annotation tools for the statistical enrichment of genes classified based on GO terms. We used the GO FAT category, which filters out very broad GO terms to identify statistically enriched functional groups. The annotated gene and protein symbols are presented in italics and regular font, respectively.

IPA

IPA software (Ingenuity® Systems, http://www.ingenuity.com) was used for the functional interpretation of gene expression data obtained from microarray analyses. The network explorer of IPA was used to identify relevant interactions among SHR- and SHRSP-specific genes, and to identify the shortest literature-supported paths between genes. This web tool was also used to overlay functions and diseases, and to categorize SHR- and SHRSP-specific genes by classifying them based on the disease-related functional annotations. IPA also identified the biological functions and/or diseases in the Ingenuity Knowledge Base that were most significant to each of the category sets. The level of support for the assignment was expressed by P-values calculated using the right-tailed Fisher’s exact test.

Results

Identification and classification of SHR- and SHRSP-specific genes

Since we expected the expression levels of the candidate genes to be regulated long before the increase in blood pressure occurred, i.e., during the pre-hypertensive period, we examined the expression profiles of each probe using RNA samples prepared from brain tissue obtained from rats at 3 and 6 weeks of age, and isolated a total of 388 SHR- and SHRSP-specific probes showing a >4- or <-4-fold change in expression (Table I).

Table I

Number and classification of SHR- and SHRSP-specific probes compared between the 2 pairs of rat strains.

Table I

Number and classification of SHR- and SHRSP-specific probes compared between the 2 pairs of rat strains.

SHR/WKYSHRSP/SHR


G-1G-2G-3G-4
3 weeks old6 weeks old3 weeks old6 weeks oldAll
All probes isolated6617719126388
 Mapped probes45741551185
 Unmapped probes21103475203
Identified unique genes42731450179
 Upregulated14518881
 Downregulated282264298
Enriched GO terms321a39
 Enriched genes121021135

{ label (or @symbol) needed for fn[@id='tfn1-ijmm-33-04-0887'] } Number of SHR- and SHRSP-specific probes isolated from the brain as described in Materials and methods; 179 of the 388 isolated probes corresponded to unique genes with Entrez IDs. Using DAVID web tools, 179 unique genes were categorized based on GO terms, from which 35 were identified as enriched genes based on 9 significantly enriched GO terms (Table II).

a Since none of these 14 SHRSP-specific genes were categorized using a GO term with P<0.01, we exceptionally categorized 2 of them into GO:0008015 (blood circulation) with P=0.068 (Table II, G-3).

{ label (or @symbol) needed for fn[@id='tfn3-ijmm-33-04-0887'] } SHR, spontaneously hypertensive rats; SHRSP, stroke-prone SHR; WKY, Wistar-Kyoto rats; GO, Gene Ontology.

We classified 388 probes into 4 groups (G-1 to G-4) depending on the 2 rat strain pairs (SHR/WKY and SHRSP/SHR) and their age (Table I) as follows: G-1 probes were isolated when the rats were 3 weeks of age and contained 66 SHR-specific probes. These 66 probes corresponded to 42 unique genes: 14 of them showed a >4-fold increase, and 28 showed a <-4-fold decrease in expression. G-2 contained 73 SHR-specific unique genes isolated when the rats were 6 weeks of age. G-3 contained 14 SHRSP-specific unique genes isolated when the rats were 3 weeks of age. G-4 contained 50 SHRSP-specific genes isolated when the rats were 6 weeks of age. As shown in Table I, 388 probes were identified, representing 179 unique genes.

Isolation of candidate genes as significantly enriched genes

Firstly, candidate genes responsible for causing hypertension, stroke and ADHD were selected from each group as significantly enriched genes using DAVID (10,11). We isolated a total of 35 enriched genes: G-1 contained 12 enriched genes categorized with 3 GO terms, G-2 contained 10 enriched genes categorized with 2 GO terms, G-3 contained 2 enriched genes categorized with 1 GO term, and G-4 contained 11 enriched genes categorized with 3 GO terms (Table I).

These 35 enriched genes consisted of 27 unique genes (Table II). To verify the results obtained by microarray analyses, we randomly selected 6 out of the 27 genes (Table III-A), performed 10 qRT-PCR experiments (Table III-B), and compared the results with those of obtained from microarray analyses by applying Spearman’s rank correlation test. The results supported the significant correlation between qRT-PCR and microarray analyses, showing an rs value of 0.697 with a two-tailed P-value of 0.025.

Table II

Classification and enrichment of SHR- and SHRSP-specific genes.

Table II

Classification and enrichment of SHR- and SHRSP-specific genes.

GroupGO categoryGenBank IDDescriptionGSFCP-valueRefs.
G-1GO:0051657 (P=0.009), maintenance of OLaXM_001073636Hypothetical LOC501349 LOC501349−4.40.001
NM_134326AlbuminAlb−12.40.000(15)
GO:0047760 (P=0.010), butyrate-CoA ligase activityNM_001014162Acyl-CoA synthetase medium-chain family 5Acsm55.30.005(32,33)
NM_144748Acyl-CoA synthetase medium-chain family 2Acsm2−4.50.004(32,33)
GO:0005576 (P=0.011), extracellular regionNM_013092Chymase 1Cma17.40.008(16)
NM_053549Vascular endothelial growth factor BVegfb−732.50.000(34)
NM_001108356α-fetoprotein LOC360919−4.20.000
NM_019274Collagen-like tail asubunit of asymmetric ACHEColq−4.10.000(35)
NM_053560Chitinase 3-like 1Chi3l14.20.000(36)
NM_001010970α-amylase 1Amy1a−5.20.009(23,24)
NM_001108533 Sparc/osteonectinSpock210.10.000(37)
NM_053918Glycoprotein hormones α-chainCga16.50.007(38)
G-2GO:0008015 (P=0.002), blood circulationNM_001007654Angiotensin II receptor-associated proteinAgtrap−23.60.000(17)
NM_017305Glutamate-cysteine ligase modifier subunitGclm5.40.001(39)
NM_031009Angiotensin II receptor type-1BAgtr1b5.80.000(19)
NM_134326AlbuminAlb−9.20.001(15)
NM_022936Epoxide hydrolase 2Ephx2−13.90.003(40)
GO:0006952 (P=0.002), defense responseNM_138522C-X-C motif chemokine 3Cxcl3−10.70.001(41)
NM_001128494Lysozyme C type 2Lyc25.10.001
NM_012950Coagulation factor II receptorF2r5.30.001(42)
NM_001037534Defensin β17Defb1788.40.000
NM_019169α-synucleinSnca10.80.001(26,27)
G-3GO:0008015 (P=0.068), blood circulationNM_001007654Angiotensin II receptor-associated proteinAgtrap−16.60.000(17)
NM_022936Epoxide hydrolase 2Ephx2−15.10.000(40)
G-4GO:0042592 (P=0.004), homeostatic processXM_002725502Similar to paired-Ig-like receptor A11 LOC6909484.60.000
NM_212504Heat shock 70-kDa protein 1BHspa1b−4.90.000(31)
NM_053633Early growth response 2Egr2−5.30.000(29,30)
NM_001037357Leukocyte IG-like receptor B3-likeLilrb3l25.70.000(43)
NM_012654Solute carrier family 9 member 3Slc9a3−4.00.009(44)
NM_019169α-synucleinSnca−9.40.000(26,27)
GO:0008015 (P=0.005), blood circulationNM_001007654Angiotensin II receptor-associated proteinAgtrap23.70.000(17)
NM_017305Glutamate cysteine ligase modifier subunitGclm−5.00.008(39)
NM_031009Angiotensin II receptor type-1BAgtr1b−5.90.001(19)
NM_022936Epoxide hydrolase 2Ephx212.60.000(40)
GO:0048168 (P=0.005), reg. of synaptic plasticitybNM_019361Activity-regulated cytoskeleton-associated proteinArc−4.60.000(28)

{ label (or @symbol) needed for fn[@id='tfn4-ijmm-33-04-0887'] } SHR- and SHRSP-specific genes were classified into 4 groups (Table I). Members of each group were further categorized with GO terms using DAVID web tools, and genes with significantly enriched GO terms (P<0.01) were identified. In the case where one gene was categorized using more than one GO term within the same group, one GO term was arbitrarily assigned to the gene.

a Maintenance of OL, maintenance of organelle location;

b reg. of synaptic plasticity, regulation of neuronal synaptic plasticity; ACHE, acetylcholinesterase; GS, gene symbol; FC, fold change of >4-fold upregulation and <-4-fold downregulation; SHR, spontaneously hypertensive rats; SHRSP, stroke-prone SHR; GO, Gene Ontology.

Table III

Validation of microarray data with qRT-PCR data.

Table III

Validation of microarray data with qRT-PCR data.

A, Primers used for qRT-PCR experiments

Gene symbolForward primer (5′-3′)Reverse primer (5′-3′)
Vegfb TACCTGCAGATCATCAGAAACTTAGCTC CTCTCACCATCTGATTTGTGCAT
Defb17 CCCGACTACAAAACAAACTGACT TCCTTTTGCCTGTTAGTATTGTGATCGAA
Agtrap AAGCCCAAGATGTTTTCTCGT CTTCCTTCCGACAAGAACCCT
Ephx2 AGGCCCTCTAAACTGGTATCGAA ATCTTCCTTCCCAACGCCTT
Lilrb3l GCCCTTTGACCTCCAACCAG GTTCACTAGGAGCTGACCACAC
LOC690948 ATGTTATGGTTACTACAAGAATACCCCACA ATGGCTTCCTCAATGGTCCT

B, Data used for Spearman’s correlation analysis

GroupGenBank IDGene symbolFC (qRT-PCR)FC (microarray)

G-1NM_053549Vegfb−10.915−732.490
G-2NM_001007654Agtrap1.603−16.619
G-2NM_001037534Defb173.40298.601
G-2NM_022936Ephx2−3.794−15.072
G-3NM_001007654Agtrap−1.115−23.563
G-3NM_022936Ephx2−3.310−13.898
G-4NM_001007654Agtrap1.32423.702
G-4NM_022936Ephx23.02812.647
G-4NM_001037357Lilrb3l3.41425.717
G-4XM_002725502 LOC6909486.8234.594

[i] qRT-PCR, quantitative real-time polymerase chain reaction; FC (qRT-PCR), fold change based on the results obtained with qRT-PCR; FC (microarray), fold change based on the results obtained with microarray analyses.

Categorization of enriched genes

Enriched G-1 genes were categorized into 3 GO terms: i) GO:0051657 (maintenance of organelle location) included 2 genes: LOC501349 and Alb (Table II, G-1). Alb was also categorized into GO:0008015 (blood circulation) (Table II, G-2); ii) GO:0047760 (butyrate-CoA ligase activity) included 2 genes: acyl-CoA synthetase medium-chain family 5 and 2 (Acsm5 and Acsm2, respectively); and iii) GO:0005576 (extracellular region) included 8 genes: Cma1, vascular endothelial growth factor B (Vegfb), α-fetoprotein (LOC360919), collagen-like tail subunit of asymmetric acetylcholine-esterase (Colq), chitinase 3-like 1 (Chi3l1), α-amylase 1 (Amy1a), sparc/osteonectin (Spock2) and glycoprotein hormones α chain (Cga) (Table II, G-1).

Enriched G-2 genes were categorized into 2 GO terms: i) GO:0008015 (blood circulation) included 5 genes: Agtrap, glutamate-cysteine ligase modifier subunit (Gclm), Agtr1b, Alb, and epoxide hydrolase 2 (Ephx2); and ii) GO:0006952 (defense response) included 5 genes: C-X-C motif chemokine 3 (Cxcl3), lysozyme C type 2 (Lyc2), coagulation factor II receptor (F2r), defensin β17 (Defb17) and α-synuclein (Snca) (Table II, G-2).

Enriched G-3 genes included Agtrap and Ephx2, which were categorized into GO:0008015 (blood circulation). These 2 genes were also categorized as enriched G-2 genes (Table II, G-2). Enriched G-4 genes were categorized into 3 GO terms: i) GO:0042592 (homeostatic process) included 6 genes: similar to paired-immunoglobulin-like receptor A11 (LOC690948), heat shock 70-kDa protein 1B (Hspa1b), early growth response 2 (Egr2), leukocyte immunoglobulin-like receptor B3-like (Lilrb3l), solute carrier family 9 member 3 (Slc9a3) and Snca; ii) GO:0008015 (blood circulation) included 4 genes: Agtrap, Gclm, Agtr1b and Ephx2; and iii) GO:0048168 (regulation of neuronal synaptic plasticity) included 1 gene: activity-regulated cytoskeleton-associated protein (Arc) (Table II, G-4).

Interactions among SHR-specific genes

We found that the G-1 genes did not include most of the hypertension-related genes, and that the G-2 genes included typical hypertension-related genes, such as Agtrap, Gclm, Agtr1b and Ephx2 (Table II, G-2). As these results suggested that G-1 genes included regulatory genes that control the expression of hypertension-related G-2 genes, we searched for interaction networks between G-1 and G-2 genes, using IPA software, and identified 2 interaction networks, one between Ptf1a and Amy1a, and the other between Ptger4 and neutrophil cytosolic factor 2 (Ncf2) (Fig. 1). The former interaction was also observed among G-1 genes, and the latter was also observed among G-2 genes (Fig. 1). Of note, Ptf1a and Ptger4 were not categorized with the enriched GO terms: Ptf1a encodes a protein related to transcriptional regulation, and Ptger4 encodes a receptor related to the regulatory expression of several genes (Table IV-A). For each non-enriched gene that participated in either interaction or was self-controlled, relevant references are presented (Table IV).

Table IV

List of non-enriched SHR- and SHRSP-specific genes.

Table IV

List of non-enriched SHR- and SHRSP-specific genes.

A, Genes participating either in interactions between genes or are self-controlled (Figs. 1 and 2)

GroupGenBank IDDescriptionGSFCP-valueRefs.
G-1NM_001106493ETS homologous factorEhf−5.00.003
NM_053964Pancreas-specific transcription factor 1aPtf1a4.40.001(21,22)
NM_032076Prostaglandin E receptor 4Ptger4−4.80.005(12,13)
NM_019232 Serum/glucocorticoid regulated kinase 1Sgk14.10.001(4547)
NM_001024297Spermatogenic leucine zipper 1Spz1−4.10.004
G-2NM_001010970α-amylase 1Amy1a−5.40.009(23,24)
NM_001034944GRB2-related adaptor protein 2Grap2−7.80.004
NM_001100984Neutrophil cytosolic factor 2Ncf2−4.30.000(25)
NM_032076Prostaglandin E receptor 4Ptger4−6.50.005(12,13)
XM_574516Tripartite motif protein 30-likeTrim30−4.70.000
NM_153732Zinc finger protein 597Zfp5975.80.000(48)
G-3NM_153732Zinc finger protein 597Zfp5976.90.000(48)
G-4NM_022197FBJ osteosarcoma oncogeneFos−4.50.000(18)
NM_030865MyocilinMyoC4.10.000
NM_001100984Neutrophil cytosolic factor 2Ncf2−4.30.000(25)
NM_153732Zinc finger protein 597Zfp597−7.00.000(48)

B, Genes annotated to disease-related functions (Table V)

GroupGenBank IDDescriptionGSFCP-valueRefs.

G-1NM_019184Cytochrome P450, subfamily 2, polypeptide 11Cyp2c11−6.70.003(49)
NM_031713Leukocyte immunoglobulin-like receptor B3Lilrb3−4.60.003(43)
NM_133412Solute carrier organic anion transporter family, member 6b1Slco6b1−7.20.002(50)
XM_001068965Lymphocyte antigen 75Ly757.20.000(51)
G-2BC126094Coenzyme Q3 homolog, methyltransferaseCoq34.20.002(52)
NM_001105859 ST6-N-acetylgalactosaminide α-2,6-sialyltransferase 1 St6galnac1−6.00.007
NM_001105880Zinc finger and BTB domain containing 20Zbtb207.90.001(53)
NM_145770Acyl-Coenzyme A oxidase 2Acox25.30.000
XM_001068965Lymphocyte antigen 75Ly754.70.000(51)
NM_001107541 ADP-ribosyltransferase 1Art1−4.50.009
G-3NM_019338Regulator of G-protein signaling 11Rgs115.00.000(54)
NM_053549Vascular endothelial growth factor BVegfb768.10.000(33)
G-4NM_001105880Zinc finger and BTB domain containing 20Zbtb20−10.80.000(53)
NM_019338Regulator of G-protein signaling 11Rgs11−4.20.000(54)

[i] SHR, spontaneously hypertensive rats; SHRSP, stroke-prone SHR; GS, gene symbol; FC, fold change of >4-fold upregulation and <-4-fold downregulation.

Interactions among SHRSP-specific genes

Since we expected the candidate genes responsible for causing stroke in SHRSP to be included in the SHRSP-specific genes, we were interested in the interactions between the G-3 and G-4 genes (Fig. 2), and identified 2 interactions: Agtrap expression was observed in the rats at 3 and 6 weeks of age and seemed to interact with 2 genes whose expression was observed in the rats at 6 weeks of age, Agtr1b and Fos (Fig. 2). Moreover, Fos expression, observed in the rats at 6 weeks of age seemed to be self-controlled, and also showed interactions with Agtrap, Agtr1b, Gclm, Egr2, as well as with Snca via Hspa1b (Fig. 2). Of note, Fos expression in the rats at 6 weeks of age seemed to control Egr2, Ephx2 and Ncf2 expression (Fig. 2), and seemed to play a pivotal role among the genes expressed in SHRSP at 6 weeks of age.

Functions and disease-related annotations of SHR- and SHRSP-specific genes

SHR- and SHRSP-specific genes were evaluated for biological relevance using IPA, and we identified significantly enriched ‘Functions’, such as molecular transport (‘uptake of norepinephrine’), the cardiovascular system (‘blood pressure’) and ‘behavior’ (Table V).

Table V

SHR- and SHRSP-specific genes classified based on the disease-related functional annotations.

Table V

SHR- and SHRSP-specific genes classified based on the disease-related functional annotations.

GroupIPA function (function and/or disease)P-valueGene symbol Genesa
G-1Renal damage (proximal tubular toxicity)0.000Alb, Cyp2c11, Slco6b13
Cell function and maintenance (function of leukocytes)0.001Chi3l1, Cma1, Lilrb3, Ly75, Ptger45
Cellular development (arrest in differentiation of amacrine cells)0.001Ptf1a1
Neurological disease (delay in hyperalgesia)0.001Sgk11
Developmental disorder (atresia)0.002Alb, Cga2
G-2Molecular transport (uptake of norepinephrine)0.000Agtrap, Agtr1b, Snca3
Carbohydrate metabolism (metabolism of carbohydrate)0.001Agtr1b, Coq3, F2r, Ptger4, Snca, St6galnac1, Zbtb207
Connective tissue disorders (rheumatoid arthritis)0.001Acox2, Alb, Art1, Cxcl3, Ephx2, Ptger4, Snca7
Cell function and maintenance (proliferation of pro-T3 thymocytes)0.002Grap21
Cell death (cell death of central nervous system cells)0.002Alb, Cxcl3, F2r, Gclm, Snca5
Cardiovascular system (blood pressure)0.002Agtrap, Agtr1b, Ephx2, F2r, Ncf25
Inflammatory response (inflammatory response)0.002Agtr1b, Cxcl3, Ephx2, F2r, Ly75, Ptger4, Snca7
G-3Lipid metabolism (quantity of 11,12-epoxyeicosatrienoic acid)0.000Ephx21
Nervous system development and function (delay in photoresponse of mice)0.001Rgs111
Post-translational modification (O-glycosylation of protein)0.004Vegfb1
Cardiovascular system (blood pressure)0.004Agtrap, Ephx22
Molecular transport (uptake of norepinephrine)0.004Agtrap1
Cardiovascular system (development of cardiovascular system)0.024Ephx2, Vegfb2
G-4Molecular transport (uptake of norepinephrine)0.000Agtrap, Agtr1b, Fos, Snca4
Organismal survival (survival of organism)0.000Agtr1b, Ephx2, Fos, Hspa1b, Snca, Zbtb206
Cell death (cytotoxicity)0.000Fos, Gclm, Hspa1b, Snca4
Molecular transport (reabsorption of bicarbonate)0.001Slc9a31
Cardiovascular system (blood pressure)0.002Agtrap, Agtr1b, Ephx2, Ncf24
Behavior (behavior)0.002Agtr1b, Arc, Egr2, Fos, Hspa1b, Snca6
Nervous system development and function (electrophysiology of the eye)0.003Fos, Rgs112

[i] IPA was used to evaluate the biological relevance (functions annotation) of SHR- and SHRSP-specific genes. The results were obtained after having taken into consideration the P-values, and number of genes. GenBank gene symbols are shown for each gene. IPA, Ingenuity Pathway Analysis; SHR, spontaneously hypertensive rats; SHRSP, stroke-prone SHR.

G-1 genes included 3 SHR-specific genes involved in renal damage [Alb, cytochrome P450 2c11 (Cyp2c11), and solute carrier organic anion transporter family member 6b1 (Slco6b1)], and 5 genes involved in cellular function and maintenance [Chi3l1, Cma1, leukocyte immunoglobulin-like receptor B3 (Lilrb3), lymphocyte antigen 75 (Ly75) and Ptger4] (Table V, G-1). Some of these G-1 genes, such as Cyp2c11, Slco6b1 and Ly75, were not categorized into any of the enriched gene groups, nor into any of the groups of genes that participated in the interactions between geens (Table IV-B), and for each non-enriched gene evaluated for biological relevance, relevant references are provided. G-2 genes included 3 SHR-specific genes involved in the ‘uptake of norepinephrine’ (Agtrap, Agtr1b and Snca), and 5 genes involved with ‘blood pressure’ (Agtr1b, Agtrap, Ephx2, F2r and Ncf2) (Table V, G-2). All these G-2 genes, apart from Ncf2, were categorized using enriched GO terms (Table II, G-2).

SHRSP-specific G-3 genes not only included Agtrap, involved in the ‘uptake of norepinephrine’, but also included Agtrap and Ephx2, which were involved in ‘blood pressure’ (Table V, G-3). SHRSP-specific G-4 genes included the following: i) 4 genes involved in the ‘uptake of norepinephrine’ (Agtr1b, Agtrap, Fos and Snca); ii) 4 genes involved in ‘blood pressure’ (Agtr1b, Agtrap, Ephx2 and Ncf2); and iii) 6 genes involved in the control of ‘behavior’ (Agtr1b, Arc, Egr2, Fos, Hspa1b and Snca) (Table V, G-4). Although Fos and Ncf2 were not categorized using the enriched GO terms, the remaining SHRSP-specific genes involved in the ‘uptake of norepinephrine’, ‘blood pressure’ and/or in ‘behavior’, were categorized with the enriched GO terms, i.e., GO:0008015 (blood circulation) or GO:0042592 (homeostatic process) (Table II, G-4).

Discussion

The first aim of the current study was to identify the candidate genes responsible for causing hypertension in SHR, the second was to identify genes leading to stroke, and the third was to identify genes related to ADHD. Since juvenile SHRSP present with a significant increase in motor activity, one of the typical symptoms of ADHD, as early as 6 weeks of age (3), we expected the genes isolated from the brain tissue of rats (SHR- or SHRSP-specific genes) at 3 and 6 weeks of age to include not only those related to hypertension and stroke, but also those related to ADHD.

Interactions among SHR-specific genes, and candidate genes responsible for causing hypertension in SHR

We found that G-1 genes included regulatory genes which control the expression of hypertension-related G-2 genes. We also identified interactions between G-1 and G-2 genes: one between Ptf1a and Amy1a, and another between Ptger4 and Ncf2 (Fig. 1). The first interaction (Ptf1a and Amy1a) affects carbohydrate metabolism, since Ptf1a encodes a protein that is a component of the transcription factor complex (21,22), and Amy1a encodes an amylase isoenzyme produced by the pancreas, which catalyzes the first step in the digestion of dietary starch and glycogen. However, its role in the genesis of hypertension is not clear at present (23,24). On the other hand, the interaction between Ptger4 and Ncf2 is expected to affect blood pressure, as Ncf2 was functionally involved in ‘blood pressure’ (Table V, G-2). Ptger4 encodes a member of the G-protein coupled receptor family, and leads to the phosphorylation of glycogen synthase kinase-3, which can act as a regulatory switch for numerous signaling pathways involved in the neonatal adaptation of the circulatory system, in osteoporosis, as well as in the initiation of skin immune responses (12,13). As Ncf2 encodes a 67-kDa cytosolic subunit of the multi-protein NADPH oxidase complex, its interaction with Ptger4 has been implicated in a number of cardiovascular pathologies, such as atherosclerosis, hypertension and stroke (25).

Since these predicted interactions did not include most of the hypertension-related G-2 genes, we applied the IPA software, and suggested that G-1 and G-2 gene interactions are assisted by the presence of a gene. Agt, mutations of which are associated with susceptibility to essential hypertension, was found to aid the interactions between 2 G-1 and 4 G-2 genes (Fig. 1). These data suggest that Ptger4 is one of the candidate genes responsible for causing hypertension in SHR, and that Alb and Cma1, in the presence of Agt, also behave as candidate genes causing hypertension in SHR by interacting with hypertension-related G-2 genes, such as Ncf2, Agtr1b, Agtrap and Snca (Fig. 1).

Interactions among SHRSP-specific genes, and candidate genes responsible for causing stroke in SHRSP

Since candidate genes that cause stroke in SHRSP were expected to be included in the SHRSP-specific genes, we wished to determine the interactions between G-3 and G-4 genes (Fig. 2). IPA revealed 2 interactions: Agtrap not only interacted with Agtr1b, but also with Fos, which regulates the transcription from the RNA polymerase II promoter (Fig. 2). Moreover, Fos interacted with several other G-4 genes (Fig. 2). These results indicate that Agtrap and Fos play pivotal roles in the pathogenesis of stroke. All these interactions are expected to affect blood pressure, as Agtrap, Gclm, Agtr1b and Ephx2 were categorized by DAVID analysis into GO:0008015 (blood circulation) (Table II, G-4), and, using IPA, Agtrap, Agtr1b, Ephx2 and Ncf2 were functionally found to be involved in ‘blood pressure’ (Table V, G-4).

Genes possibly participating in the development of ADHD

Three G-2 genes were found to be involved in the ‘uptake of norepinephrine’(Agtrap, Agtr1b and Snca) (Table V, G-2). Agtrap and Agtr1b were categorized into GO:0008015 (blood circulation), and Snca was categorized into GO:0006952 (defense response) (Table II, G-2). Snca regulates the homeostasis of dopaminergic and serotonergic synapses, through the trafficking of dopamine and serotonin transporters, and plays a central role in the homeostasis of noradrenergic neurons (26,27). Accordingly, the SHR-specific G-2 genes involved in the ‘uptake of norepinephrine’ are expected not only to participate in the control of ‘blood pressure’, but also in the development of ADHD symptoms. Similarly, 4 G-4 genes, Agtrap, Agtr1b, Fos and Snca, were found to be involved in the ‘uptake of norepinephrine’ (Table V, G-4). Although Fos was not categorized using the enriched GO terms (Table IV-A), these 4 genes were expected to participate in ‘blood pressure’ control, and in the development of ADHD.

Six SHRSP-specific G-4 genes (Agtr1b, Arc, Egr2, Fos, Hspa1b and Snca), were found to be functionally involved in ‘behavior’ (Table V, G-4). Of note, 3 of these 6 genes, Agtr1b, Fos and Snca, were included among those functionally involved in the ‘uptake of norepinephrine’ (Table V, G-4). The remaining 3 genes, Arc, Egr2 and Hspa1b, functionally involved in ‘behavior’, were also expected to participate in ‘blood pressure’ control, as well as in the development of ADHD. Arc plays a critical role in the consolidation of enduring synaptic plasticity and memory storage (28), while Egr2 encodes a transcription factor with 3 tandem C2H2-type zinc fingers [since defects in this gene are associated with neurological diseases, such as Charcot-Marie-Tooth disease and Dejerine-Sottas syndrome, it has been suggested to play a role in learning and long-term potentiation (29,30)]. Hspa1b encodes a 70-kDa heat-shock protein, which is known to promote neurodegeneration in sporadic Parkinson’s disease through its functional interaction with other Parkinson’s disease-related genes (31). All the aforementioned results suggest that not only the genes involved in the ‘uptake of norepinephrine’ but also those functionally involved in ‘behavior’ participate in the development of ADHD.

In conclusion, in this study, we analyzed the gene expression profiles in the brains of 3- and 6-week-old SHR and SHRSP, and found that the G-4 genes involved in the ‘uptake of norepinephrine’ include Agtrap, Agtr1b, Snca and Fos, and those related to ‘blood pressure’ include Agtrap, Agtr1b, Ephx2 and Ncf2 (Table V, G-4). Moreover, Agtr1b, Snca, Fos, Arc, Egr2 and Hspa1b were the genes involved in ‘behavior’ (Table V, G-4). Since Agtrap expression in SHRSP at 3 and 6 weeks of age interacted with Agtr1b (Fig. 2), these 2 genes participated not only in the ‘uptake of norepinephrine’ and ‘blood pressure’, but also in ‘behavior’. These results reveal that Agtrap and Agtr1b participate in the development of hypertension and ADHD, indicating that there is a close association between hypertension and ADHD.

Acknowledgements

We would like to thank Dr Etsuro Yamanishi, President Emeritus of Hirakata General Hospital for Developmental Disorders, and Dr Aritomo Suzuki, Professor Emeritus of Kinki University, for their constant support and encouragement, and Miss Fumie Kanazawa for her expert secretarial assistance. We also thank the National Center for Biotechnology Information, USA, and DNA Data Bank of Japan for access to the network servers.

Abbreviations:

ADHD

attention-deficit hyperactivity disorder

DAVID

Database for Annotation, Visualization and Integrated Discovery

FC

fold change

GEO

Gene Expression Omnibus

GO

Gene Ontology

IPA

Ingenuity Pathway Analysis

qRT-PCR

quantitative real-time polymerase chain reaction

SHR

spontaneously hypertensive rats

SHRSP

stroke-prone SHR

WKY

normotensive Wistar-Kyoto rats

References

1 

Okamoto K and Aoki K: Development of a strain of spontaneously hypertensive rats. Jpn Circ J. 27:282–293. 1963. View Article : Google Scholar : PubMed/NCBI

2 

Okamoto K, Yamori Y and Nagaoka A: Establishment of the stroke-prone spontaneously hypertensive rat (SHR). Circ Res. 34–35(Suppl I): I143–I153. 1974.

3 

Ueno KI, Togashi H, Mori K, et al: Behavioural and pharmacological relevance of stroke-prone spontaneously hypertensive rats as an animal model of a developmental disorder. Behav Pharmacol. 13:1–13. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Faraone SV and Mick E: Molecular genetics of attention deficit hyperactivity disorder. Psychiatr Clin North Am. 33:159–180. 2010. View Article : Google Scholar : PubMed/NCBI

5 

DasBanerjee T, Middleton FA, Berger DF, Lombardo JP, Sagvolden T and Faraone SV: A comparison of molecular alterations in environmental and genetic rat models of ADHD: a pilot study. Am J Med Genet B Neuropsychiatr Genet. 147B:1554–1563. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Russell VA, Oades RD, Tannock R, Killeen PR, Auerbach JG, Johansen EB and Sagvolden T: Response variability in Attention-Deficit/Hyperactivity Disorder: a neuronal and glial energetics hypothesis. Behav Brain Funct. 2:302006. View Article : Google Scholar : PubMed/NCBI

7 

Yamamoto H, Okuzaki D, Yamanishi K, et al: Genetic analysis of genes causing hypertension and stroke in spontaneously hypertensive rats. Int J Mol Med. 31:1057–1065. 2013.PubMed/NCBI

8 

Tajima A, Hans FJ, Livingstone D, Wei L, Finnegan W, DeMaro J and Fenstermacher J: Smaller local brain volumes and cerebral atrophy in spontaneously hypertensive rats. Hypertension. 21:105–111. 1993.PubMed/NCBI

9 

Lanari A, Silvestrelli G, De Dominicis P, Tomassoni D, Amenta F and Parnetti L: Arterial hypertension and cognitive dysfunction in physiologic and pathologic aging of the brain. Am J Geriatr Cardiol. 16:158–164. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Huang da W, Sherman BT and Lempicki RA: Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 4:44–57. 2009.PubMed/NCBI

11 

Huang da W, Sherman BT and Lempicki RA: Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 37:1–13. 2009.PubMed/NCBI

12 

Hoshino T, Namba T, Takehara M, et al: Prostaglandin E2 stimulates the production of amyloid-beta peptides through internalization of the EP4 receptor. J Biol Chem. 284:18493–18502. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Nguyen M, Camenisch T, Snouwaert JN, et al: The prostaglandin receptor EP4 triggers remodelling of the cardiovascular system at birth. Nature. 390:78–81. 1997. View Article : Google Scholar : PubMed/NCBI

14 

Dickson ME, Tian X, Liu X, Davis DR and Sigmund CD: Upstream stimulatory factor is required for human angiotensinogen expression and differential regulation by the A-20C polymorphism. Circ Res. 103:940–947. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Bakoush O, Tencer J, Torffvit O, Tenstad O, Skogvall I and Rippe B: Increased glomerular albumin permeability in old spontaneously hypertensive rats. Nephrol Dial Transplant. 19:1724–1731. 2004. View Article : Google Scholar : PubMed/NCBI

16 

Frank BT, Rossall JC, Caughey GH and Fang KC: Mast cell tissue inhibitor of metalloproteinase-1 is cleaved and inactivated extracellularly by alpha-chymase. J Immunol. 166:2783–2792. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Azuma K, Tamura K, Shigenaga A, et al: Novel regulatory effect of angiotensin II type 1 receptor-interacting molecule on vascular smooth muscle cells. Hypertension. 50:926–932. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Matsuo K, Owens JM, Tonko M, Elliott C, Chambers TJ and Wagner EF: Fosl1 is a transcriptional target of c-Fos during osteoclast differentiation. Nat Genet. 24:184–187. 2000. View Article : Google Scholar

19 

Gembardt F, Heringer-Walther S, van Esch JH, et al: Cardiovascular phenotype of mice lacking all three subtypes of angiotensin II receptors. FASEB J. 22:3068–3077. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Ishii T, Onda H, Tanigawa A, et al: Isolation and expression profiling of genes upregulated in the peripheral blood cells of systemic lupus erythematosus patients. DNA Res. 12:429–439. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Beres TM, Masui T, Swift GH, Shi L, Henke RM and MacDonald RJ: PTF1 is an organ-specific and Notch-independent basic helix-loop-helix complex containing the mammalian Suppressor of Hairless (RBP-J) or its paralogue, RBP-L. Mol Cell Biol. 26:117–130. 2006. View Article : Google Scholar

22 

Meredith DM, Masui T, Swift GH, MacDonald RJ and Johnson JE: Multiple transcriptional mechanisms control Ptf1a levels during neural development including autoregulation by the PTF1-J complex. J Neurosci. 29:11139–11148. 2009.PubMed/NCBI

23 

Fukui H, Miwa E, Iwachido T, Kitaura H and Furukawa H: Various emetogens increase the secretion of salivary amylase in rats: a potential model in emesis research. J Pharmacol Sci. 113:143–152. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Asanuma-Date K, Hirano Y, Le N, et al: Functional regulation of sugar assimilation by N-glycan-specific interaction of pancreatic α-amylase with glycoproteins of duodenal brush border membrane. J Biol Chem. 287:23104–23118. 2012.PubMed/NCBI

25 

Ju W, Eichinger F, Bitzer M, et al: Renal gene and protein expression signatures for prediction of kidney disease progression. Am J Pathol. 174:2073–2085. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Wersinger C, Jeannotte A and Sidhu A: Attenuation of the norepinephrine transporter activity and trafficking via interactions with alpha-synuclein. Eur J Neurosci. 24:3141–3152. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Outeiro TF, Kontopoulos E, Altmann SM, et al: Sirtuin 2 inhibitors rescue alpha-synuclein- mediated toxicity in models of Parkinson’s disease. Science. 317:516–519. 2007.PubMed/NCBI

28 

Plath N, Ohana O, Dammermann B, et al: Arc/Arg3.1 is essential for the consolidation of synaptic plasticity and memories. Neuron. 52:437–444. 2006. View Article : Google Scholar : PubMed/NCBI

29 

Nagarajan R, Svaren J, Le N, Araki T, Watson M and Milbrandt J: EGR2 mutations in inherited neuropathies dominant-negatively inhibit myelin gene expression. Neuron. 30:355–368. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Zaman G, Sunters A, Galea GL, et al: Loading-related regulation of transcription factor EGR2/Krox-20 in bone cells is ERK1/2 protein-mediated and prostaglandin, Wnt signaling pathway- and insulin-like growth factor-I axis-dependent. J Biol Chem. 287:3946–3962. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Kalia SK, Lee S, Smith PD, et al: BAG5 inhibits parkin and enhances dopaminergic neuron degeneration. Neuron. 44:931–945. 2004. View Article : Google Scholar : PubMed/NCBI

32 

Soupene E and Kuypers FA: Mammalian long-chain acyl-CoA synthetases. Exp Biol Med (Maywood). 233:507–521. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Boomgaarden I, Vock C, Klapper M and Döring F: Comparative analyses of disease risk genes belonging to the acyl-CoA synthetase medium-chain (ACSM) family in human liver and cell lines. Biochem Genet. 47:739–748. 2009. View Article : Google Scholar : PubMed/NCBI

34 

Barouk S, Hintz T, Li P, Duffy AM, MacLusky NJ and Scharfman HE: 17β-estradiol increases astrocytic vascular endothelial growth factor (VEGF) in adult female rat hippocampus. Endocrinology. 152:1745–1751. 2011.

35 

Ohno K, Brengman J, Tsujino A and Engel AG: Human endplate acetylcholinesterase deficiency caused by mutations in the collagen-like tail subunit (ColQ) of the asymmetric enzyme. Proc Natl Acad Sci USA. 95:9654–9659. 1998. View Article : Google Scholar : PubMed/NCBI

36 

Park JA, Drazen JM and Tschumperlin DJ: The chitinase-like protein YKL-40 is secreted by airway epithelial cells at base line and in response to compressive mechanical stress. J Biol Chem. 285:29817–29825. 2010. View Article : Google Scholar : PubMed/NCBI

37 

David SP, Hamidovic A, Chen GK, et al: Genome-wide meta-analyses of smoking behaviors in African Americans. Transl Psychiatry. 2:e1192012. View Article : Google Scholar : PubMed/NCBI

38 

Bièche I, Latil A, Parfait B, et al: CGA gene (coding for the alpha subunit of glycoprotein hormones) overexpression in ER alpha-positive prostate tumors. Eur Urol. 41:335–341. 2002.PubMed/NCBI

39 

Nakamura S, Sugiyama S, Fujioka D, Kawabata K, Ogawa H and Kugiyama K: Polymorphism in glutamate-cysteine ligase modifier subunit gene is associated with impairment of nitric oxide-mediated coronary vasomotor function. Circulation. 108:1425–1427. 2003. View Article : Google Scholar : PubMed/NCBI

40 

Sinal CJ, Miyata M, Tohkin M, Nagata K, Bend JR and Gonzalez FJ: Targeted disruption of soluble epoxide hydrolase reveals a role in blood pressure regulation. J Biol Chem. 275:40504–40510. 2000. View Article : Google Scholar : PubMed/NCBI

41 

Feuser K, Thon KP, Bischoff SC and Lorentz A: Human intestinal mast cells are a potent source of multiple chemokines. Cytokine. 58:178–185. 2012.PubMed/NCBI

42 

Damiano BP, Cheung WM, Santulli RJ, et al: Cardiovascular responses mediated by protease-activated receptor-2 (PAR-2) and thrombin receptor (PAR-1) are distinguished in mice deficient in PAR-2 or PAR-1. J Pharmacol Exp Ther. 288:671–678. 1999.PubMed/NCBI

43 

Ma G, Pan PY, Eisenstein S, Divino CM, Lowell CA, Takai T and Chen SH: Paired immunoglobin-like receptor-B regulates the suppressive function and fate of myeloid-derived suppressor cells. Immunity. 34:385–395. 2011. View Article : Google Scholar : PubMed/NCBI

44 

Crajoinas RO, Lessa LM, Carraro-Lacroix LR, et al: Posttranslational mechanisms associated with reduced NHE3 activity in adult vs. young prehypertensive SHR. Am J Physiol Renal Physiol. 299:F872–F881. 2010. View Article : Google Scholar : PubMed/NCBI

45 

Klaus F, Palmada M, Lindner R, Laufer J, Jeyaraj S, Lang F and Boehmer C: Up-regulation of hypertonicity-activated myo-inositol transporter SMIT1 by the cell volume-sensitive protein kinase SGK1. J Physiol. 586:1539–1547. 2008.PubMed/NCBI

46 

Lang F, Huang DY and Vallon V: SGK, renal function and hypertension. J Nephrol. 23(Suppl 16): S124–S129. 2010.PubMed/NCBI

47 

Loffing J, Flores SY and Staub O: Sgk kinases and their role in epithelial transport. Annu Rev Physiol. 68:461–490. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Tanabe Y, Hirano A, Iwasato T, et al: Molecular characterization and gene disruption of a novel zinc-finger protein, HIT-4, expressed in rodent brain. J Neurochem. 112:1035–1044. 2010. View Article : Google Scholar : PubMed/NCBI

49 

Martínéz-Jiménez CP, Castell JV, Gómez-Lechón MJ and Jover R: Transcriptional activation of CYP2C9, CYP1A1, and CYP1A2 by hepatocyte nuclear factor 4alpha requires coactivators peroxisomal proliferator activated receptor-gamma coactivator 1alpha and steroid receptor coactivator 1. Mol Pharmacol. 70:1681–1692. 2006.

50 

Suzuki T, Onogawa T, Asano N, et al: Identification and characterization of novel rat and human gonad-specific organic anion transporters. Mol Endocrinol. 17:1203–1215. 2003. View Article : Google Scholar : PubMed/NCBI

51 

Kato M, Neil TK, Clark GJ, Morris CM, Sorg RV and Hart DN: cDNA cloning of human DEC-205, a putative antigen-uptake receptor on dendritic cells. Immunogenetics. 47:442–450. 1998. View Article : Google Scholar : PubMed/NCBI

52 

Jonassen T and Clarke CF: Isolation and functional expression of human COQ3, a gene encoding a methyltransferase required for ubiquinone biosynthesis. J Biol Chem. 275:12381–12387. 2000. View Article : Google Scholar : PubMed/NCBI

53 

Sutherland AP, Zhang H, Zhang Y, et al: Zinc finger protein Zbtb20 is essential for postnatal survival and glucose homeostasis. Mol Cell Biol. 29:2804–2815. 2009. View Article : Google Scholar : PubMed/NCBI

54 

Cao Y, Pahlberg J, Sarria I, Kamasawa N, Sampath AP and Martemyanov KA: Regulators of G protein signaling RGS7 and RGS11 determine the onset of the light response in ON bipolar neurons. Proc Natl Acad Sci USA. 109:7905–7910. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

2014-April
Volume 33 Issue 4

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Yoshida M, Watanabe Y, Yamanishi K, Yamashita A, Yamamoto H, Okuzaki D, Shimada K, Nojima H, Yasunaga T, Okamura H, Okamura H, et al: Analysis of genes causing hypertension and stroke in spontaneously hypertensive rats: Gene expression profiles in the brain. Int J Mol Med 33: 887-896, 2014.
APA
Yoshida, M., Watanabe, Y., Yamanishi, K., Yamashita, A., Yamamoto, H., Okuzaki, D. ... Yamanishi, H. (2014). Analysis of genes causing hypertension and stroke in spontaneously hypertensive rats: Gene expression profiles in the brain. International Journal of Molecular Medicine, 33, 887-896. https://doi.org/10.3892/ijmm.2014.1631
MLA
Yoshida, M., Watanabe, Y., Yamanishi, K., Yamashita, A., Yamamoto, H., Okuzaki, D., Shimada, K., Nojima, H., Yasunaga, T., Okamura, H., Matsunaga, H., Yamanishi, H."Analysis of genes causing hypertension and stroke in spontaneously hypertensive rats: Gene expression profiles in the brain". International Journal of Molecular Medicine 33.4 (2014): 887-896.
Chicago
Yoshida, M., Watanabe, Y., Yamanishi, K., Yamashita, A., Yamamoto, H., Okuzaki, D., Shimada, K., Nojima, H., Yasunaga, T., Okamura, H., Matsunaga, H., Yamanishi, H."Analysis of genes causing hypertension and stroke in spontaneously hypertensive rats: Gene expression profiles in the brain". International Journal of Molecular Medicine 33, no. 4 (2014): 887-896. https://doi.org/10.3892/ijmm.2014.1631