This article is mentioned in:

Introduction

Diabetes mellitus (DM) is a complex metabolic syndrome, the prevalence of which is rapidly increasing worldwide. Among the pathophysiological mechanisms of diabetes, vascular complications are a main cause of morbidity and mortality in diabetic patients (1). Oxidative stress is the main pathophysiological mechanism of macrovascular injury and contributes to endothelial cell injury. The aggregation of reactive oxygen species (ROS) frequently damages the cytoplasm, lipids and proteins, thus resulting in vascular endothelial cell apoptosis (2–5). Cell apoptosis is the initial step in macrovascular injury and is critical to the development and progression of cardiovascular diseases (6). NADPH oxidase 4 (Nox4), a subunit of NADPH oxidase, is abundantly expressed in several types of tissue and generates free radicals in vascular endothelial cells (7,8). The inhibition of Nox4 activity has been shown to prevent adipose-derived stem cell apoptosis (9). Nevertheless, the molecular mechanisms responsible for Nox4-induced endothelial cell apoptosis remain unclear.

Transforming growth factor-β1 (TGF-β1) plays a role in the apoptosis and proliferation of a variety of cells (10–12). Smad2, a downstream cytokine of TGF-β1, is activated following the activation of TGF-β1. Activated Smad2 then translocates to the nucleus and modulates the transcription of TGF-β1 target genes (13,14). Previous studies have demonstrated that TGF-β1/Smad2 possesses potent proliferative activity in various cell types (15–17), whereas others have demonstrated that it induces apoptosis in a number of cells (18–20). Nevertheless, to the best of our knowledge, few studies have investigated whether the TGF-β1/Smad2 pathway is involved in vascular endothelial cell apoptosis in DM.

Astragaloside IV (AST IV), which is used in traditional Chinese medicine, is a monomer located in an extract of astragaloside (Fig. 1). Our previous studies confirmed that AST IV has pharmacological effects, including anti-inflammatory and antioxidant effects in some diseases (21–23). However, to the best of our knowledge, the protective effects of AST IV against vascular injury in DM in vitro have not been investigated to date.

Figure 1 Structure of astragaloside IV (AST IV).

In the present study, we aimed to investigate the role of Nox4-dependent ROS production and whether the TGF-β1/Smad2 signaling pathway plays a critical role in endothelial cell apoptosis in vitro induced by oxidative stress, which causes vascular injury in DM, and whether AST IV inhibits hydrogen peroxide (H2O2)-induced HUVEC apoptosis by suppressing Nox4 expression through the TGF-β1/Smad2 pathway.

Materials and methods

Cell culture and administration

Human umbilical vein endothelial cells (HUVECs; China Center for Type Culture Collection, Wuhan, China) were incubated in Dulbecco’s modified Eagle’s medium (DMEM) with 4.5 g/l D-glucose supplemented with 10% fetal bovine serum (FBS) (both from HyClone, Logan, UT, USA), 100 U/ml penicillin and 100 μg/ml streptomycin in a humidified atmosphere of 5% CO2 at 37°C. The HUVECs were subcultured at a 1:2 ratio interval of 2 days. Vascular injury associated with DM in vitro was mimicked by incubation with H2O2 100 μmol/l for 18 h to induce damage to the HUVECs, as previously described (24). The cells were treated with each agent in the medium for 1 h prior to exposure to H2O2.

The cells were divided into 3 groups as follows: i) the control group: cells were left untreated; ii) the model group: cells were treated with H2O2 100 μmol/l for 18 h; and iii) the AST IV group: cells were treated with AST IV for 1 h and then treated with H2O2. In addition, some cells were treated with diphenyliodonium (DPI, a specific inhibitor of Nox4; from Sigma, St. Louis, MO, USA) or LY2109761 (a selective inhibitor of TGF-β1/Smad2; from MedChem Express, LLC, Princeton, NJ, USA).

MTT assay

The half maximal effective concentration (EC50) of AST IV in preventing the H2O2-induced damage to HUVECs was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Sigma). In brief, the cells were seeded at a density of 1×104 cells/well in 96-well plates. They were then exposed to serial dilutions of AST IV in DMEM-high glucose medium and allowed to grow for the indicated periods of time. Following treatment, the cells were incubated with 100 μl DMEM-high glucose medium containing 5 mg/ml MTT. Following incubation for 4 h at 37°C, the supernatants were discarded, MTT crystals were dissolved in 100 μl dimethyl sulfoxide (DMSO) and the optical density (OD) was measured at 570 nm using a Bio-Rad microplate reader (Bio-Rad, Hercules, CA, USA).

ROS assay

Intracellular ROS production was detected using a probe, the redox-sensitive fluorophore carboxy-2′,7′-dichlorodihydrofluorescein diacetate (H2DCFDA; Sigma) as the following steps. After delivery, the cells were washed with phosphate-buffered saline (PBS) and incubated with 20 μmol/l H2DCFDA in the dark for 30 min. The cells were then briefly exposed to 0.5 g/l trypsin. The deactivation of trypsin was accomplished by the addition of PBS supplemented with 3% FBS. All cells were examined using a FACScan flow cytometer (Beckman Coulter, Miami, FL, USA) and the data were processed using FlowJo 7.6 software (Tree Star, Inc., Ashland, OR, USA) (25).

Annexin-V and propidium iodide (PI) staining to detect apoptosis

Following treatment, apoptosis was determined according to the following steps: the cells were collected by 0.25% ethylenediaminetetraacetic acid (EDTA)-free trypsin to digest the cells followed by centrifugation (at 1,500 rpm) to collect the cells; the cells then were suspended with 500 μl binding buffer, and the concentration was then adjusted to 1×106 followed by the addition of 5 μl Annexin V-FITC staining fluid, gentle blending and incubation at 4°C in the dark for 15 min; the cells were then treated with PI dyeing liquid at 4°C in the dark for 5 min. Finally the cells were immediately examined using a FACScan flow cytometer (Beckman Coulter). Annexin V-FITC detection was carried out using the FL-1 and PI detection using the FL-2 channel.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed using the First-Strand cDNA Synthesis kit (Life Technology, Carlsbad, CA, USA) according to the manufacturer’s instructions. The cDNA were used as the template for the qPCR amplification using oligo primers, and the internal control for the qPCR reaction was glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primer sequences of the Nox4, TGF-β1, Smad2, Bax, Bcl-2 and caspase-3 genes (Shanghai Sangon Biotech, Shanghai, China) are presented in Table I. qPCR was performed using an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). qPCR was performed with a total volume of 12 μl in each well, containing 5 μl of SYBR-Green® PCR Master Mix (Applied Biosystems), 5 μl of cDNA, and 1 μmol forward primers and 1 μmol reverse primers. Each sample was run in triplicate in a separate tube. The qPCR conditions were conducted as follows: 40 cycles of denaturation at 95°C for 15 sec, annealing at 60°C for 1 min, and extension at 72°C for 1 min. Initial heating at 95°C for 10 min and a final extension at 72°C for 7 min was performed for all qPCR reactions. The cycle threshold (CT) values from all the qPCR experiments were calculated using the 2−ΔΔCT method.

Table I Sequence of primers used for RT-qPCR.

Table I

Sequence of primers used for RT-qPCR.

Gene	Sequence forward primer 5′→3′	Sequence reverse primer 5′→3′	Length (bp)
Nox4	TGGACCTTTGTGCCTGTACTGT	TGAGGATGACTTATGACCGAAA	89
Smad2	CTTTTGTTGTGTAAGCTCTCACTG	GACCTTCTACCACTTTCAGAGTTG	243
TGF-β1	TGGACACGCAGTACAGCAAG	GCCCACGTAGTACACGATGG	119
Bax	TGGCAGCTGACATGTTTTCTGAC	TCACCCAACCACCCTGGTCTT	195
Bcl-2	TTTGAGTTCGGTGGGGTCATG	TCACTTGTGGCTCAGATAGGC	269
Caspase-3	AGAGGGGATCGTTGTAGAAGTC	ACAGTCCAGTTCTGTACCACG	81
GAPDH	TCCCTGAGCTGAACGGGAAG	GGAGGAGTGGGTGTCGCTGT	217

[i] qPCR, quantitative polymerase chain reaction; Nox4, NADPH oxidase 4; TGF-β1, transforming growth factor-β1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Western blot analysis

Following treatment, the cells were lysed using RIPA buffer (Beyotime, Shanghai, China) containing 1% phenylmethanesulfonyl fluoride (PMSF; Sigma) on ice. The total protein concentrations were measured using the BCA Protein Assay kit (Beyotime). Proteins were separated by 8 or 10% SDS-PAGE and then transferred onto PVDF membranes (Millipore Corp., Billerica, MA, USA). Subsequently, the membranes were blocked with 5% non-fat milk at room temperature (RT) for 1 h, and incubated with primary antibodies as follows: anti-Nox4 (ab109225; Abcam, Cambridge, UK), anti-TGF-β1 (3712S; Cell Signaling Technology Inc., Beverly, MA, USA), anti-Smad2 (ab33875; Abcam), anti-Bax (sc-6236), anti-Bcl-2 (sc-783) (both from Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), anti-caspase 3 (9665S; Cell Signaling Technology Inc.) and anti-β-actin (A1978; Sigma) antibodies overnight at 4°C. Subsequently, the membranes were incubated with horseradish peroxidase-conjugated secondary anti-mouse, anti-rabbit antibodies (1:2,000 dilution) for 1 h at RT. Moreover, the proteins were visualized using an ECL advanced western blot detection kit (Pierce, Thermo, Rockford, IL, USA). Densitometric measurements of band intensity in the western blot analysis were performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Statistical analysis

All experiments were carried out 3 times. All quantified results are expressed as the means ± SEM in graphical representation. Data analysis of all results was carried out using one-way analysis of variance (ANOVA) followed by Fisher’s LSD-based post-hoc analysis. All P-values were two sided and considered significant when P<0.05. Statistical analyses were performed with SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA).

Results

EC50 of AST IV in HUVECs treated with H2O2

MTT (Sigma) assay was performed to determine the EC50 of AST IV in inhibiting H2O2-induced damage to HUVECs. The cells were treated with AST IV at 5, 10, 25, 50, 100, 200, 400 and 800 μmol/l for 1 h prior to treatment with H2O2 and cell viability was then examined by MTT assay. The results revealed that the EC50 of AST IV in inhibiting H2O2-induced injury to HUVECs was 100 μmol/l [calculated by regression equation (x, drug concentration; y, cell survival rate)].

Protective effect of AST IV against H2O2-induced HUVEC apoptosis

To assess the protective effects of AST IV against H2O2-induced HUVEC apoptosis, the mRNA and protein expression levels of Nox4, TGF-β1, Smad2, Bcl-2, Bax and caspase-3 were determined; the intercellular ROS level and the apoptotic rate were also determined. Nox4 expression in the model group was significantly increased in comparison to the control group (P<0.01; Fig. 2B and C). The geometric mean fluorescence intensity indicating ROS production in the control group was lower, whereas that in the model group was markedly increased (P<0.01; Fig. 2A). In comparison with the control group, the expression of TGF-β1/Smad2 was markedly elevated in the model group (P<0.01). In addition, the expression of Bax (pro-apoptotic gene) was lower and that of Bcl-2 (anti-apoptotic gene) was higher in the control group compared to the model group (P<0.01; Fig. 2B and C). The expression of caspase-3, a main terminal shear enzyme involved in apoptosis, was barely detectable in the control group; by contrast, its expression was upregulated in the model group (P<0.01; Fig. 2B and C). In comparison with the control group, the apoptotic rate was significantly increased in the model group (P<0.01; Fig. 2D). However, treatment with AST IV100 μmol/l reversed these effects (P<0.01).

Figure 2 Protective effects of astragaloside IV (AST IV) on H2O2-induced human umbilical vein endothelial cell (HUVEC) apoptosis. (A) FACS analysis was performed to determine intercellular reactive oxygen species (ROS) levels in the HUVECs in the model, control and AST IV groups. (B) Western blot analysis was performed to determine protein expression in the HUVECs in the model, control and AST IV groups. (C) RT-qPCR was performed to determine mRNA expression in the HUVECs in the model, control and AST IV groups. (D) Annexin V-FITC/PI staining was performed to determine the apoptotic rate of the HUVECs in the model, control and AST IV groups. **P<0.01 vs. control group; ##P<0.01 vs. model group. Nox4, NADPH oxidase 4; TGF-β1, transforming growth factor-β1.

Expression of Nox4 is an important promoting event in the onset of H2O2-induced HUVEC apoptosis

To explore the molecular mechanisms responsible for H2O2-induced HUVEC apoptosis, the HUVECs were treated with diphenyliodonium (DPI; 10 μmol, a Nox4 inhibitor) prior to treatment with H2O2. We found that treatment with DPI or AST IV decreased the expression of Nox4 (Fig. 3B and C), as well as the intercellular ROS levels in the HUVECs treated with H2O2 (Fig. 3A). Our results revealed that DPI or AST decreased TGF-β1/Smad2 expression in the HUVECs damaged by H2O2 (Fig. 3B and C). Our results also revealed that treatment with DPI or AST IV decreased Bax and caspase-3 expression, and increased Bcl-2 expression (Fig. 3B and C). In addition, treatment with DPI or AST IV decreased the HUVEC apoptotic rate (Fig. 3D). The exposure of the cells to AST IV at 100 μmol/l had a similar effect to that of treament with DPI (Fig. 3).

Figure 3 The overexpression of Nox4 is an important promoting event in the onset of H2O2-induced human umbilical vein endothelial cell (HUVEC) apoptosis. (A) FACS analysis was performed to determine intercellular reactive oxygen species (ROS) production in the HUVECs in the control, model, astragaloside IV (AST IV), and diphenyliodonium (DPI) groups. (B) Western blot analysis was performed to determine protein expression in the HUVECs in the control, model, AST IV and DPI groups. (C) RT-qPCR was performed to determine mRNA expression in the HUVECs in the control, model, AST IV and DPI groups. (D) Annexin V-FITC/PI staining was performed to determine the apoptotic rate of the HUVECs in the control, model, AST IV and DPI groups. **P<0.01 vs. control group; ##P<0.01 vs. model group. Nox4, NADPH oxidase 4; TGF-β1, transforming growth factor-β1.

Inhibition of the TGF-β1/Smad2 signaling pathway decreases H2O2-induced HUVEC apoptosis, but not oxidative stress

To further investigate the role of the TGF-β1/Smad2 signaling pathway in H2O2-induced HUVEC apoptosis, LY2109761 (0.1 μmol/l), a selective inhibitor of TGF-β1/Smad2, was used to suppress the activation of the TGF-β1/Smad2 pathway. The results revealed that TGF-β1 and Smad2 mRNA and protein expression was detected at extremely low levels in the control group, whereas the overexpression of TGF-β1 and Smad2 was observed in the model group; there was a statistically significant difference between the control group and the model group (P<0.01; Fig. 4B and C). However, treatment with LY2109761 decreased TGF-β1 and Smad2 expression, as well as Bax and caspase-3 expression, and increased Bcl-2 expression (P<0.01; Fig. 4B and C). In addition, treatment with LY2109761 decreased HUVEC apoptosis (P<0.01; Fig. 4D), but had no effect on Nox4 expression and the ROS levels (P>0.05; Fig. 4A–C). Treatment with AST IV at 100 μmol/l significantly ameliorated these risk factors; it downregulated Nox4 expression (Fig. 4B and C), decreased ROS levels (Fig. 4A), decreased TGF-β1, Smad2, Bax and caspase-3 expression (Fig. 4B and C) and upregulated Bcl-2 expression (Fig. 4B and C) (P<0.05 and P<0.01 compared to model group), further decreasing HUVEC apoptosis (Fig. 4D).

Figure 4 Inhibition of the TGF-β1/Smad2 pathway decreases H2O2-induced human umbilical vein endothelial cell (HUVEC) apoptosis, but not oxidative stress.(A) FACS analysis was performed to determine intercellular reactive oxygen species (ROS) production in the HUVECs in the control, model, astragaloside IV (AST IV) and LY2109761 groups. (B) Western blot analysis was performed to determine protein expression in the HUVECs in the control, model, AST IV and LY2109761 groups. (C) RT-qPCR was performed to determine mRNA expression in the HUVECs in the control, model, AST IV and LY2109761 groups. (D) Annexin V-FITC/PI staining was performed to determine the apoptotic rate of the HUVECs in the control, model, AST IV and LY2109761 groups. **P<0.01 vs. control group; ##P<0.01 vs. model group. Nox4, NADPH oxidase 4; TGF-β1, transforming growth factor-β1.

Discussion

As is known, Nox4, a subunit of NADPH oxidase, mainly catalyzes and generates intracellular ROS in vascular endothelial cells (26). The elevation of intracellular ROS production results in pathophysiological changes, including vascular inflammation in DM (27,28). This study confirmed that incubation with H2O2 at 100 μmol/l for 18 h induced Nox4 expression and ROS generation, and that the aggregation of ROS in HUVECs led to the development of endothelial cell disorders, finally resulting in vascular complications in vitro, as those observed in DM (28,29). On the one hand, increased ROS freely transmits the cell membrane and induces membrane lipid peroxidation and DNA damage. On the other hand, ROS augments the cell oxidative reaction system and induces cell apoptosis (30–33). In this study, following treatment with DPI, a compound which inhibits Nox4 generation, or AST IV markedly suppressed Nox4 expression, significantly decreased the generation of intracellular ROS, markedly decreased the expression of apoptosis-related genes and the apoptotic rate of the HUVECs, as demonstrated in previous studies using other agents (34–42). Therefore, the expression of Nox4 is an important promoting event in the onset of H2O2-induced HUVEC apoptosis. AST IV may thus inhibit H2O2-induced HUVEC apoptosis by suppressing Nox4 expression.

Moreover, apoptosis, or programmed cell death, is associated with the activation of multiple genes and multiple signaling pathways. The TGF-β signaling pathway is associated with oxidative stress and the apoptotic process (43–45). In this study, our results also revealed that the TGF-β1/Smad2 pathway was activated in the H2O2-treated HUVECs. TGF-β1 stimulates cell responses by signaling through the canonical Smad protein pathway, as well as using alternative pathways involving Smads, mitogen-activated protein kinases (MAPKs), protein kinase C (PKC) and phosphoinositide 3-kinase (PI3K). Activated Smad2, a downstream effector of TGF-β1 signaling, then promotes cell apoptosis (46–48). In this study, treatment with LY2109761, a selective TGF-β1/Smad2 pathway inhibitor, produced results similar to those obtained with DPI; however, LY2109761 had no effect on Nox4 expression and ROS levels. Nevertheless, AST IV decreased Nox4 expression and ROS levels, decreased TGF-β1 and Smad2 expression, decreased Bax and caspase-3 expression, and increased Bcl-2 expression and decreased HUVEC apoptosis.

Taken together, these results suggest that AST IV exerts an anti-inflammatory effect by decreasing the apoptosis of HUVECs induced by H2O2 through the inhibition of the activation of the TGF-β1/Smad2 signaling pathway. A previous study also demonstrated that AST IV possessed strong antioxidant capabilities by scavenging and neutralizing free radicals, as well as anti-inflammatory properties by inhibiting ROS formation and accumulation (23). Nevertheless, the findings of this study indicate that AST IV exerts effects similar to those of DPI, but not LY2109761. Thus, the protective effects of AST IV against vascular injury in DM in vitro, are mainly related to the decrease in Nox4 expression. Moreover, our results also suggest that potential therapeutic strategies to combat anti-vascular complications in DM may be developed through the manipulation of the redox status in DM. Furthermore, the inhibition of the activation of the TGF-β1/Smad2 signaling pathway may be another potential therapeutic strategy in the treatment of DM. However, the signaling pathways related to apoptosis are complex, multiple, and a number of pathways interact with each other. In this study, we only investigated the TGF-β/Smad signaling pathway; further investigations are warranted to investigate the other pathways involved. At the present time, the pharmacological effects of AST IV on vascular injury in DM need to be explored and further studies are required to determine the role of other signaling pathways.

Acknowledgments

This study was supported by a grant form the National Natural Science Foundation of China (no. 81173624).

Abbreviations:

References