This article is mentioned in:

Introduction

Atherosclerosis is a multifactor cardiovascular disease, which is associated with physiological and behavioral risk factors, such as age, gender, hypertension, hypercholesterolemia, obesity, diabetes, smoking and a sedentary lifestyle (1). Studies have indicated that chronic inflammatory responses and oxidative stress conditions in vascular tissue are associated with the pathogenesis of atherosclerosis (2). Oxidized low-density lipoprotein (ox-LDL) is a particularly important risk factor for the pathogenesis of atherosclerosis. It is well known that ox-LDL promotes the occurrence and development of atherosclerosis through various mechanisms, including the induction of endothelial cell damage. In addition, ox-LDL causes endothelial cell activation, dysfunction and death, as well as impaired vasorelaxation, which contribute causally to the development and progression of atherosclerosis (3–5). Accumulating has indicated that ox-LDL-mediated biological processes may be related to the increased activity of NADPH oxidase (6–8). NADPH oxidase, a multisubunit enzymatic complex comprised of two membrane-bound subunits, gp91 and p22phox, is the major source of intracellular reactive oxygen species (ROS) in vascular cells. Moreover, cytoplasmic subunits, such as p47phox and p67phox are critical components of endothelial NADPH oxidase. For example, it has been demonstrated that the activation of Rac-1 and p47phox is involved in the generation of superoxide, a molecule that stimulates inflammatory gene expression through a redox-sensitive signaling pathway in vascular endothelial cells (9).

Green tea is a one of the most ancient and popular beverages consumed worldwide, and it has been suggested to prevent the development of a variety of diseases, including diabetes, hypertension, cancer and cardiovascular diseases (10). The effects of green tea are attributed to its abundant and biologically active catechin, epigallocatechin-3-gallate (EGCG), which has antioxidant (11), anti-inflammatory (12), anti-tumorigenic (13) and anti-angiogenic (14) effects. Accumulating evidence has indicated that EGCG plays an important role in the protection against the initiation and/or development of atherosclerosis (15). Previous studies have demonstrated that EGCG possesses potent antioxidant properties, which attenuate oxidative injury induced by ox-LDL in endothelial cells (16–19). In a recent study, Cai et al demonstrated that green tea EGCG attenuated Porphyromonas gingivalis-induced atherosclerosis (15). Based on the findings of previous studies, we hypothesized that EGCG may protect endothelial cells against ox-LDL-induced damage by suppressing the ox-LDL-induced activity of NADPH oxidase.

The Notch pathway is an evolutionary highly conserved signaling system. Thus far, 4 Notch receptors (Notch1–4) and 5 ligands [Delta-like (Dll)-1, -3, -4 and Jagged (JAG)-1 and -2] have been identified in vertebrates. The Notch signaling pathway shows functional significance in neural development (20,21), multiple cellular processes, embryonic development and self-renewing adult tissues (22,23). Recently, Notch signaling was proven to be critical for arterial specification, sprouting angiogenesis and vessel maturation (24–27). However, little is known about the function of the Jagged-1/Notch pathway in the protective effects exerted by EGCG against ox-LDL-induced endothelial cell damage.

In this study, ox-LDL-exposed endothelial cells were treated with various concentrations of EGCG, to examine the hypothesis that 50 µM EGCG may hamper ox-LDL-induced endothelial cell damage by modulating the Jagged-1/Notch pathway.

Materials and methods

Cell culture

Human umbilical vein endothelial cells (HUVECs) were purchased from the American Type Culture Collection (ATCC; Rockville, MD, USA) and cultured in RPMI-1640 (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) and 100 µg/ml penicillin/streptomycin (both from Invitrogen).

Isolation of endothelial progenitor cells (EPCs)

The isolation and culture of EPCs was performed as previously described (28). Mononuclear cells were isolated from the bone marrow of apolipoprotein E (ApoE) knockout (ApoE-KO or ApoE−/−) mice by flushing the femurs and tibias of the mice. Briefly, the mice (n=5) were anesthetized by an intraperitoneal injection of 10% chloral hydrate (0.3 ml/100 g) and then sacrificed by cervical dislocation. After disinfecting the area with alcohol and performing muscle incision, the whirlbone of the thigh was clipped and a needle was inserted into the bone tube to flush out the bone marrow using sterilized PBS. The bone marrow was then cultured in selective medium (EGM-2; CC-3162; Lonza, Walkersville, MD, USA) for 14 days. The Institutional Animal Care and Use Committee of Central South University approved all the animal protocols. Following isolation, the cells were plated immediately onto 6-well plates pre-coated with fibronectin (Sigma-Aldrich, St. Louis, MO USA) at a density of 5×106 cells/well and cultured in RPMI-1640 (Gibco Life Technologies, Grand Island, NY, USA) with 10% FBS (Gibco Life Technologies). The cells were incubated at 37°C in 5% CO2. The culture medium was changed every 3 days. After 4 days in culture, the non-adherent cells were washed away with 0.01 mol/l phosphate-buffered saline (PBS; pH 7.4) and fresh medium was then added. The EPCs after 7 days of culture were used in the experiments. To confim the identity of the EPCs prior to use, western blot analysis was performed to detect EPC-specific surface markers [CD34, CD133 and vascular endothelial growth factor receptor (VEGFR)-2] (data not shown).

Preparation of ox-LDL

Human ox-LDL was obtained from Shanghai Luwen Biotech Inc. (LW-6002; Shanghai, China). LW Human LDL had been purified to homogeneity via ultra-centrifugation (1.019–1.063 g/cc) and had been oxidized using 5 µM Cu2SO4 (oxidant) ihn PBS at 37°C for 20 h. The reaction was terminated by the addition of EDTA-Na2. The concentration of ox-LDL used in the present study was 100 mg/l.

Mice and treatments

Six-week-old male ApoE-KO mice were obtained from Xiangya Hospital of Central South University, Changsha, China. The mice were randomly divided into 3 groups (n=5) and administered for 7 weeks (via their drinking water) with the treatments: 2 groups were administered distilled water, and the other group was administered 0.8 g/l EGCG (Sigma-Aldrich). As previously described (15), the mice in the EGCG group and those in the distilled water groups were fed a high-fat diet (HFD). All the mice were monitored until sacrifce (by cervical dislocation) at the age of 15 weeks and the tissue samples of the ApoE−/− mice were then collected. All the animal protocols were approved by the Institutional Animal Care and Use Committee of Central South University.

Manipulation of Jagged-1 expression levels

pCDNA3.1 vectors containing Jagged-1 (pCDNA3.1-Jagged-1) and pRNAT-U6.1/Neo vectors containing Jagged-1 shRNA (pRNAT-U6.1/Neo-Jagged-1-sh) were constructed and transfected into the HUVECs. To confirm the effects of the vectors on the expression of Jagged-1, western blot analysis was performed to measure the protein expression levels of Jagged-1 in the HUVECs. The transfected cells were expanded and harvested for further analysis. Untransfected cells were used as controls (Con) and cells transfected with empty carrier vectors (pCDNA3.1 or pRNAT-U6.1/Neo) served as the negative control (NC).

Isolation of mRNA and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from the HUVECs or the EPCs using TRIzol reagent (Invitrogen) and then reverse transcribed into cDNA using the RevertAid™ First Stand cDNA Synthesisi kit (Thermo Fisher Scientific, Waltham, MA, USA). The relative expression levels were detected using Real-Time PCR SYBR-Green Reagents (Dongsheng, Xian, China) in accordance with the manufacturer's instructions. Target RNA levels were normalized to β-actin. The primer sequences used in this study are listed in Table I.

Table I Primer sequences used for RT-qPCR.

Table I

Primer sequences used for RT-qPCR.

Gene		Primer sequence (5′→3′)
p22phox	Sense	ATTGTGGCGGGCGTGTT
	Antisense	GCACCGAGAGCAGGAGAT
p47phox	Sense	CCTGACGAGACGGAAGACC
	Antisense	CTTTCCTGATGACCCACCA
p67phox	Sense	CAGACAGAGAAATATGATTTGGC
	Antisense	GGATCACCACTGGCTCATATAG
HES1	Sense	GAAGGAAGTGGTCGAAGCTC
	Antisense	ATGCGCGTCACTTTCCAG
Jagged-1	Sense	ACCTGCCAGTGCCTGAATG
	Antisense	AGGCAAGGTCGAGGGCC
β-actin	Sense	AGGGGCCGGACTCGTCATACT
	Antisense	GGCGGCACCACCATGTACCCT

Cell survival assay

The 3-(4,5-dimethylthiazal-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay was used to estimate cell viability, as prevoiusly described (29). Briefly, the cells were plated at a density of 1×104 cells/well in 96-well plates. After being subjected to the specific treatments, the cells were incubated with MTT solution at a final concentration of 0.5 mg/ml for 4 h at 37°C. After the removal of the medium, 150 mM DMSO were added to dissolve the formazan crystals. The absorbance was read at 570 nm using a multi-well scanning microplate reader (Thermo Fisher Scientific). The cells in the control group were considered 100% viable.

Western blot analysis

Protein lysates were separated by 10% SDS-polyacrylamide gel electrophoresis and then electroblotted onto PVDF membranes. Primary antibodies against inducible nitric oxide synthase (iNOS), endothelial nitric oxide synthase (eNOS), NADPH (p47phox), NADPH (p67phox), NADPH (p22phox), Jagged-1, hairy and enhancer of split (HES)1, HES5 and Math1 were used, with β-actin antibody as an internal control. Densitometric analysis was performed using LabWorks Image Acquisition and Analysis software (UVP, Inc., Upland, CA, USA).

Annexin V and propidium iodide (PI) binding assay

The HUVECs were cultured in 6-well plates and exposed to ox-LDL (50 µg/ml) for 0, 12, 24 and 48 h. The cells were harvested and stained using the Annexin V-FITC Apoptosis Detection kit (Beyotime Biotech, Jiangsu, China) according to the manufacturer's instructions. Briefly, 5×105 cells were suspended in 500 µl 1X binding buffer (10 mM HEPES pH 7.4, 140 mM NaCl, 2.5 mM CaCl2). The cells were then incubated with Annexin V (1:20) for 5 min followed by incubation with PI (1 mg/ml) for 15 min. The apoptotic rate was evaluated by flow cytometry.

Adhesion assay

The HUVECs (1×105 cells/ml) were cultured in 96-well flat-bottom plates (0.1 ml/well) for 1–2 days. The cells were then pre-treated with the indicated concentrations of EGCG and incubated with ox-LDL. The wells were incubated at 37°C for 50 min in a 5% CO2 incubator and washed 3 times with PBS to remove the non-adherent cells.

Morphological and immunohistochemistry analysis

The root of the aorta was obtained from the ApoE−/− mice and fixed in 4% paraformaldehyde overnight. Tissue specimens were then cut at 5 µm thickness for subsequent hematoxylin and eosin (H&E) staining or immunohistochemical analysis. The method for H&E staining of the aortic tissues was conducted as previously described (30). Immunohistochemical analysis was performed according to the manufacturer's instructions. The staining results were observed and captured using an AE31 light microscope (Motic, Xiamen, China).

Statistical analysis

Each experiment was repeated at least 3 times. Data are presented as the means ± SE and analyzed using SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA). Statistical comparisons between the groups were analyzed using a Student's t-test and a two-tailed value of P<0.05 was considered to indicate a statistically significant difference.

Results

ox-LDL induces the apoptosis of endothelial cells

It has been previously demonstrated that ox-LDL induces endothelial cell apoptosis (31). As shown in Fig. 1A, MTT assay revealed that the incubation of HUVECs with ox-LDL (100 mg/l) enhanced endothelial cell apoptosis in a time-dependent manner. This result was also confirmed by flow cytometry (Fig. 1B and C). The HUVECs that were incubated with ox-LDL for 72 h were used in the subsequent experiments.

Figure 1 Oxidized low-density lipoprotein (ox-LDL) induces the apoptosis of endothelial cells. (A) Cell survival curve by MTT assay. (B and C) Cell apoptosis was examined by flow cytometry. Error bars represent the means ± SE; *P<0.01 vs. control (no treatment).

Jagged-1 affects the apoptosis of endothelial cells

To determine the potential effect of Jagged-1 on endothelial cell apoptosis, we transfected pCDNA3.1 vectors containing Jagged-1 (pCDNA3.1-Jagged-1) and transfected pRNAT-U6.1/Neo vectors containing Jagged-1 shRNA (pRNAT-U6.1/Neo-Jagged-1-sh) into the HUVECs in order to induce the overexpression or to silence Jagged-1, respectively. Western blot analysis revealed that the Jagged-1 levels were effectively downregulated following transfection of the cells with Jagged-1 shRNA, and significantly enhanced following transfection with pCDNA3.1-Jagged-1 (Fig. 2A). As shown in Fig. 2B and C, the silencing of Jagged-1 significantly enhanced the apoptosis of the HUVECs compared with the control group, and this effect was reversed by the overexpression of Jagged-1.

Figure 2 Jagged-1 affects apoptosis of the endothelial cells. (A) Western blot analysis of the expression of Jagged-1. (B and C) Cell apoptosis was examined by flow cytometry. Error bars represent the means ± SE; *P<0.01 vs. control (no treatment).

EGCG protects against ox-LDL-induced endothelial dysfunction

It has been previously demonstrated that the activation of NADPH oxidase is associated with ox-LDL-induced endothelial dysfunction (32,33). As active NADPH oxidase is assembled on the membrane, the effects of EGCG on the membrane translocation of p22phox, p47phox and p67phox were examined by RT-qPCR. As shown in Fig. 3, the levels of membrane-bound p22phox and p47phox were markedly decreased in the cells treated with ox-LDL for 72 h compared with the untreated cells (Fig 3). Of note, this decreasing effect on p47phox was enhanced by treatment with EGCG in a dose-dependent manner. In addition, treatment with EGCG enhanced p22phox expression, with a significant increase in expression being observed following treatment with 50 µM EGCG (P<0.01). As regards p67phox, the expression levels were slightly increased by ox-LDL and then decreased following treatment with 12.5 µM EGCG. However, treatment with 50 and 200 µM EGCG increased the levels of p67phox even further than ox-LDL did. The most significant effect on p67phox expression was observed following treatment with 200 µM EGCG (Fig. 3A–C). Moreover, ox-LDL decreased the expression of Jagged-1, and this effect was attenuated by treatment with 50 µM EGCG (Fig. 3D). Western blot analysis revealed that treatment with 12.5 µM EGCG further decreased Jagged-1 protein expression. However, treatment with 50 µM EGCG attenuated this effect (Fig. 4).

Figure 3 Effects of epigallocatechin-3-gallate (EGCG) on oxidized low-density lipoprotein (ox-LDL)-induced p22phox, p47phox and p67phox membrane translocation. Human umbilical vein endothelial cells (HUVECs) were treated with the indicated concentrations of EGCG (12.5–200 µM) for 24 h followed by exposure to 100 mg/l ox-LDL for 72 h. RT-qPCR was used to measure the mRNA expression levels of (A) NADPH p22phox, (B) p47phox and (C) p67phox. (D) RT-qPCR of the expression of Jagged-1. (E) Summary of the data indicating that EGCG prevents the ox-LDL-induced NADPH oxidase translocation to the plasma membrane. Error bars represent the means ± SE; *P<0.01 vs. control (no treatment) and **P<0.01 vs. ox-LDL group.

Figure 4 Western blot analysis revealed the expression of Jagged-1, HES1, HES5, iNOS, Math1, eNOS in human umbilical vein endothelial cells (HUVECs). HUVECs were treated with the indicated concentrations of epigallocatechin-3-gallate (EGCG) (12.5–200 µM) for 24 h followed by exposure to 100 mg/l ox-LDL for 72 h. Error bars represent the means ± SE; *P<0.01 vs. control (no treatment) and **P<0.01 vs. ox-LDL group.

Notch signaling has been proven to be critical for arterial specification, sprouting angiogenesis and vessel maturation (24–27). Thus, in this study, we examined the effects of Notch signaling on the EGCG-mediated protection against ox-LDL-induced endothelial cell dysfunction. As shown in Fig. 4, the expression level of HES1 was significantly decreased following the exposure of the cells to ox-LDL. However, EGCG had no effect on HES1 expression in the ox-LDL + EGCG (12.5, 50 and 200 µM) groups compared with the ox-LDL group. The expression level of HES5 was increased following exposure of the cells to ox-LDL, and this effect was attenuated by treatment with 50 µM EGCG. EGCG (12.5 and 200 µM) did not affect HES5 expression in the ox-LDL + EGCG (12.5 and 200 µM) groups compared with the ox-LDL group. Exposure of the cells to ox-LDL did not affect Math1 expression; however, treatment with EGCG decreased Math1 expression in a dose-dependent manner (Fig. 4).

It has been previously demonstrated that ox-LDL reduces the expression of eNOS, thereby altering endothelial biology (34). In the present study, we examined the effects of EGCG on the protein expression levels of eNOS and iNOS in endothelial cells exposed to ox-LDL. Our results revealed that ox-LDL significantly reduced eNOS protein expression and increased iNOS protein expression compared with the control group. This effect was attenuated significantly in the cells treated with 50 µM EGCG. Treatment with 50 µM EGCG signficantly increased eNOS protein expression compared with the cells in the ox-LDL group. Treatment with EGCG at 12.5 µM promoted ox-LDL-induced endothelial dysfunction, whereas EGCG at 50 µM protected the cells against ox-LDL-induced endothelial cell dysfunction through the Notch signaling pathway. Thus, the concentration of 50 µM EGCG was used in the subsequent experiments.

Jagged-1 is the key effector protein through which EGCG exerts its protective effects against ox-LDL-induced endothelial cell dysfunction

The overexpression and silencing of Jagged-1 was induced in order to determine the role of Jagged-1 in the EGCG-mediated protection against ox-LDL-induced endothelial dysfunction. EPCs were obtained from ApoE−/− mice and treated with EGCG (50 µM) for 24 h followed by exposure to 100 mg/l ox-LDL for 72 h. As shown in Fig. 5, the overexpression of Jagged-1 markedly decreased the expression levels of HES5, iNOS and Math1, and increased the expression levels of eNOS in the Jagged-1 + ox-LDL + EGCG group compared with the ox-LDL + EGCG group. By contrast, the silencing of Jagged-1 markedly increased the expression levels of HES5, iNOS and Math1, and decreased the expression levels of eNOS in the Jagged-1-sh + ox-LDL + EGCG group compared with the ox-LDL + EGCG group.

Figure 5 Western blot analysis of the expression of Jagged-1, HES5, iNOS, Math1 and eNOS in endothelial progenitor cells (EPCs). EPCs were treated with epigallocatechin-3-gallate (EGCG) (50 µM) for 24 h followed by exposure to 100 mg/l oxidized low-density lipoprotein (ox-LDL) for 72 h. Error bars represent the means ± SE; *P<0.01 vs. the control (no treatment) and **P<0.01 vs. the ox-LDL group.

Furthermore, we examined the effects of Jagged-1 on apoptosis, as well as on the adhesiveness of EPCs. As shown in Fig. 6A and B, MTT assay and flow cytometric analysis revealed that EGCG suppressed ox-LDL-induced cell apoptosis. This effect was enhanced by the overexpression of Jagged-1, but inhibited by the silencing of Jagged-1. In addition, EGCG attenuated the decrease in cell adhesion induced by ox-LDL, and this effect was inhibited by the silencing of Jagged-1 (Fig. 6C). Thus, our results indicate that Jagged-1 is the key effector protein through which EGCG exerts its protective effects against ox-LDL-induced endothelial dysfunction.

Figure 6 Effects of Jagged-1 and epigallocatechin-3-gallate (EGCG) on oxidized low-density lipoprotein (ox-LDL)-induced apoptosis and the adhesion of endothelial progenitor cells (EPCs). EPCs were pre-treated with EGCG (50 µM) for 24 h followed by exposure to 100 mg/l ox-LDL for 72 h. (A) Cell survival curve by MTT assay. (B) Cell apoptosis was examined by flow cytometry. (C) Cell adhesion was examined. Error bars represent the means ± SE; *P<0.01 vs. control (no treatment), **P<0.01 vs. ox-LDL + EGCG group and ***P<0.01 vs. ox-LDL group.

Histomorphometric analysis of the aortic sinus

To directly determine the protective effects of EGCG against the development of atherosclerosis, the characteristics of arterial lesions were examined by pathological section H&E staining using light microscopy (Fig. 7). In the control group, the vessel walls were round with even thicknesses. The endothelial cell core was stained and evenly arranged. In the HFD group, the vessel walls were uneven, and significant intimal hyperplasia was present. The inner elastic plates were broken. Treatment with EGCG resulted in more even blood vessels and smoother intima. Histomorphological analysis revealed that EGCG attenuated the HFD-induced accumulation of atherosclerotic plaque. Furthermore, we found that the expression of Jagged-1 and HES5 was upregulated in the HFD group (shown by increased dark brown staining), and this effect was attenuated in the HFD + EGCG group. These results indicated that impairment of the vascular endothelium induced the activation of the Jagged-1/Notch pathway, which was associated with significant intimal hyperplasia.

Figure 7 Formation of atherosclerotic plaque in the aortic sinuses of ApoE knockout (ApoE-KO) mice. Pathological sections of arterial lesions were examined by H&E staining, and the protein expression of Jagged-1 and HES5 was examined by immunohistochemistry. Three 10-week-old ApoE-KO mice were used as normal controls. In the control group, the vessel walls were thin and smooth with even thicknesses. Four mice were fed a high-fat diet (HFD) in the HFD group. In the HFD + EGCG group, 4 mice were fed a HFD and then treated with 0.8 g/l ECGC. Magnification, ×400.

Discussion

Atherosclerosis is a multifactor cardiovascular disease, and ox-LDL is a particularly important factor in the pathogenesis of atherosclerosis and it contributes to endothelial damage. In the present study, we demonstrate that EGCG at a concentration of 50 µM protected against ox-LDL-induced endothelial cell apoptosis and inhibited the development and progression of atherosclerosis. We also investigated the possible mechanisms responsible for these effects.

EGCG is found in green tea, and it has potent antioxidant, anti-mitotic and anti-angiogenic properties (35). The antioxidant activity of EGCG has been widely demonstrated in vitro and in vivo (15,36). The antioxidant activity of EGCG is repsonsibel for its protective effects against atherosclerosis (37). Consistent with these results, the present study demonstrated that treatment with 50 µM EGCG evidently reduced ox-LDL-induced cell apoptosis and the ox-LDL-induced decrease in the adhesion of endothelial cells. However, treatment with a lower concentration of EGCG (12.5 µM) for 24 h may not be sufficient to exert antioxidant effects, and the higher concentration of EGCG (200 µM) may promote the apoptosis of damaged endothelial cells. Taken together, these findings suggest that treatment with EGCG at the concentration of 50 µM exerts the optimal antioxidant effects.

iNOS is known to play a role in producing NO during inflammation, and thus it contributes to the initiation and development of inflammatory cardiovascular diseases, such as atherosclerosis. As previously demonstrated, mice lacking the endothelial isoform are generally hypertensive and have a more severe outcome to diet-induced atherosclerosis. Mice lacking the neuronal isoform have increased diet-induced atherosclerosis. Mice lacking the inducible isoform show reduced hypotension to septic shock (38). ox-LDL has been shown to reduce the expression of eNOS, thereby altering endothelial biology (34). It has also been demonstrated that EGCG prevents the ox-LDL-decrease in eNOS protein expression HUVECs (39). In this study, we found that treatment with 50 µM EGCG prevented the ox-LDL-induced decrease in eNOS expression and the ox-LDL-induced increase in iNOS protein expression in HUVECs. Accumulating evidence has indicated that the ox-LDL-mediated biological processes may be related to the increased activity of NADPH oxidase (6–8). It has been demonstrated that ox-LDL-induced endothelial dysfunction is caused by an increase in NADPH oxidase-generated superoxide concentrations and a decrease in antioxidant enzyme activity (40). This indicates that ox-LDL mediates endothelial cell damage by suppressing the activity of NADPH oxidase. In this study, we demonstrated that EGCG attenuated the ox-LDL-induced decrease in NADPH oxidase activity by significantly increasing the expression of p22phox in endothelial cells, indicating that EGCG protects against ox-LDL-mediated endothelial cell (HUVEC) damage by increasing the expression of NADPH oxidase p22phox in endothelial cells.

Notch signaling within endothelial cells plays a critical role during developmental angiogenesis, providing instructive cues to neighboring endothelial cells through Notch ligand-receptor interactions typical of the canonical Notch signaling pathway. The Notch pathway is a highly conserved signaling system that is essential for vascular development, homeostasis and angiogenesis. In growing blood vessels, the sprouting of endothelial tip cells is inhibited by Notch signaling and the precise equilibrium between two Notch ligands with distinct spatial expression patterns and opposing functional roles regulates angiogenesis (41). In the present study, ox-LDL suppressed Notch ligand Jagged-1 expression and induced Notch target gene HES5 expression. These effects were reversed by treatment with EGCG. Moreover, Jagged-1 suppressed apoptosis and promoted adhesion of EPCs. In conclusion, Jagged-1 is the key effector protein in the protective effects of EGCG against ox-LDL-induced endothelial dysfunction through the Notch pathway.

To directly determine the effects of EGCG on the development of atherosclerosis and the mechanisms involved, the characteristics of arterial lesions were examined by pathological section H&E staining using light microscopy. The results demonstrated that EGCG evidently inhibited HFD-induced atherosclerosis in ApoE-KO mice, which was associated with the expression of Jagged-1 and HES5, indicating that EGCG protects ApoE-KO mice from atherosclerosis through the Jagged-1/Notch pathway. These findings are consistent with those of a previous study indicating that EGCG prevented the development of atherosclerosis in ApoE-KO mice by reducing LDL-induced susceptibility to oxidation (42).

In conclusion, the findings of our study demonstrate that EGCG protects against ox-LDL-induced endothelial cell damage through the Jagged-1-mediated Notch pathway, both in vitro and in vivo. The manipulation of the components of this mechanism may prove to be a potential therapeutic strategy for preventing atherosclerosis.

References