Open Access

Protective effect of VK2 on glucocorticoid-treated MC3T3-E1 cells

  • Authors:
    • Yue-Lei Zhang
    • Jun-Hui Yin
    • Hao Ding
    • Wei Zhang
    • Chang-Qing Zhang
    • You-Shui Gao
  • View Affiliations

  • Published online on: December 1, 2016     https://doi.org/10.3892/ijmm.2016.2817
  • Pages: 160-166
  • Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Glucocorticoids (GCs) contribute to the increased incidence of secondary osteoporosis and osteonecrosis, and medications for the prevention and treatment of these complications have been investigated for many years. Vitamin K2 (VK2) has been proven to promote bone formation both in vitro and in vivo. In this study, we examined the effects of VK2 on dexamethasone (DEX)-treated MC3T3-E1 osteoblastic cells. We observed that VK2 promoted the proliferation and enhanced the survival of dexamethasone-treated MC3T3-E1 cells. In addition, VK2 upregulated the expression levels of osteogenic marker proteins, such as Runt-related transcription factor 2 (Runx2), alkaline phosphatase (ALP) and osteocalcin, which were significantly inhibited by dexamethasone. On the whole, our findings indicate that VK2 has the potential to antagonize the effects of GCs on MC3T3-E1 cells, and may thus prove to be a promising agent for the prevention and treatment of GC-induced osteoporosis and osteonecrosis.

Introduction

Glucocorticoids (GCs) have been extensively used in the treatment of a variety of diseases, due to their potent anti-inflammatory effects. However, the long-term and excessive use of GCs is one of the most common causes of atraumatic osteonecrosis of the femoral head and likely increases the incidence of secondary osteoporosis (1). These complications are partially attributed to modifications in the bioactivity of bone marrow-derived stem cells, osteoblasts/osteocytes and osteoclasts (24). Previous studies have indicated that GCs antagonize Runt-related transcription factor 2 (Runx2) during the osteoblast differentiation of mesenchymal cells and inhibit the osteogenesis of bone marrow-derived stem cells (3,5). GCs have also been reported to directly suppress the osteogenic differentiation of osteoblasts (6), induce osteoblast and osteocyte apoptosis, and decrease the number of bone-forming cells (79). Another study indicated that GC-induced bone resorption is caused by a direct effect of the GCs on extending the lifespan of osteoclasts (10).

Vitamin K (VK), whose active form has been demonstrated to be a coenzyme for γ-carboxylase, plays an important role in bone metabolism (11,12). There are two types of VK in nature, VK1 (phylloquinone) and VK2 (menatetrenone). VK1 is a single compound and is primarily found in plants, while VK2 is a series of vitamers with multiple isoprene units at the 3-position of the naphthoquinone and is named according to the number of these prenyl units (13,14). Studies have indicated that VK2 has a more pronounced osteoprotective effect than VK1 (15,16). In addition to the γ-carboxylation of osteocalcin (OCN), VK2 has been proven to promote osteoblast proliferation (13) and the osteoblast-to-osteocyte transition in vitro (15,1719), including OCN accumulation in the extracellular matrix, the upregulation of Runx2 and alkaline phosphatase (ALP), and the transcription of osteogenic genes. Additional studies also revealed the osteoprotective effects of VK2 in vivo. Akiyama et al and Iwamoto et al observed that VK2 prevented bone loss in rats with ovariectomy or sciatic neurectomies (20,21); bone healing was also promoted in the osteotomy model in the study by Iwamoto et al (22). Based on these findings, VK2 has been used in the treatment of osteoporosis in Asian countries for a number of years (23,24).

Several studies have reported the protective effects of VK2 on prednisolone-treated rats (22,25,26); however, few studies have reported similar findings in vitro. Thus, the purpose of this study was to examine the effects of VK2 on GC-treated osteoblasts.

Materials and methods

Chemicals

The cell culture medium, Dulbecco's modified Eagle's medium (DMEM; low glucose, 1 g/l), was obtained from HyClone, Logan, UT, USA. Fetal bovine serum (FBS) and the penicillin-streptomycin solution (10,000 U/ml penicillin; 10 mg/ml streptomycin) were purchased from Gibco Laboratories (Grand Island, NY, USA). VK2, L-ascorbic acid and β-glycerophosphate disodium salt hydrate were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Dexamethasone (DEX) was obtained from Sigma and was used at a concentration of 1 µM in all the experiments in this study. VK2 was dissolved in anhydrous ethanol and all other chemicals were dissolved in PBS.

Cell culture

Mouse osteoblastic MC3T3-E1 cells (GNM15) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM supplemented with 10% FBS, penicillin (100 U/ml) and streptomycin (10 µg/ml). Osteogenic differentiation was induced in DMEM supplemented with 10% FBS, penicillin (100 U/ml), streptomycin (10 µg/ml), L-ascorbic acid (50 µg/ml) and β-glycerophosphate disodium salt hydrate (10 mM). All cells were cultured at 37°C in a humidified atmosphere containing 5% CO2.

Cell proliferation assay

The MC3T3-E1 cells (5,000/well) were plated in 96-well plates and incubated overnight. Ten microliters of Cell Counting Kit-8 (CCK-8) solution were then added to 100 µl of culture medium and the wells were incubated for an additional 2 h. The absorbance values at 450 nm measured using a microplate reader (Bio-Rad, Hercules, CA, USA) were recorded as the initial values (0 day), and the cells were then treated with both DEX and various concentrations of VK2 (10−5, 10−6 and 10−7 M), with medium changes every 2 days. CCK-8 detection was performed again at appropriate time points (48, 96 and 144 h) following incubation with the different chemicals, and the absorbance values were recorded and analyzed.

Cell apoptosis and viability assay

The Annexin V-FITC cell apoptosis detection kit (Beyotime Biotechnology, Shanghai, China) was used to detect cell apoptosis. The MC3T3-E1 cells were incubated with or without DEX and various concentrations of VK2 (10−5, 10−6 and 10−7 M) for 6 days, collected, resuspended in 200 µl of Annexin V-FITC and 10 µl of propidium iodide, and incubated for 20 min at room temperature. Subsequently, flow cytometry was used to evaluate the number of apoptotic cells. The early apoptotic cells are labeled green and the dead and late apoptotic cells are labeled red, while the live cells are not stained.

Trypan blue staining was performed to evaluate cell viability. The MC3T3-E1 cells were treated with both DEX and various concentrations of VK2 (10−5, 10−6 and 10−7 M) in FBS-free medium for 6 days and then collected. Ten microliters of trypan blue (Invitrogen, Carlsbad, CA, USA) were mixed with 10 µl of the cell suspension, and 10 µl of the mixture were then added to the cell counting plate. The cell death rates were automatically calculated with a cell counter (Invitrogen). A ReadyProbes® Cell Viability Imaging kit (Life Technologies, Gaithersburg, MD, USA) was also used to detect cell viability at 6 days after the MC3T3-E1 cells were incubated under the different conditions. The blue dye stained all living cells, and the green dye stained the dead cells.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The cells were cultured in osteogenic differentiation medium and treated with DEX or DEX with various concentrations of VK2 (10−5, 10−6, and 10−7 M). Total RNA was extracted using TRIzol reagent (Invitrogen) at 1, 3 and 7 days following treatment, and the RNA was then reverse transcribed into cDNA using the EasyScript one-step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech Co., Ltd., Beijing, China), according to the manufacturer's instructions. RT-qPCR for ALP, OCN and Runx2 was performed using the TransStart Tip Green qPCR SuperMix (TransGen Biotech Co., Ltd.) with ABI Prism 7900 (Invitrogen). The reaction conditions were 1 cycle of 95°C for 30 sec and 40 cycles of 95°C for 5 sec and 60°C for 30 sec. Subsequently, a 65–95°C solubility curve was constructed. The relative amount of each mRNA was normalized to the β-actin mRNA. The primer sequences of each cDNA are presented in Table I.

Table I

Sequences of primers used for RT-qPCR.

Table I

Sequences of primers used for RT-qPCR.

GeneForward primerReverse Primer
Runx2 TGGCCGGGAATGATGAGAAC TGAAACTCTTGCCTCGTCCG
ALP CACTCTGTCCCGTTGGTGTC TTGACGTTCCGATCCTGCAC
OCN TCTGACAAAGCCTTCATGTCCA AGCCCTCTGCAGGTCATAGA
β-actin GTCGAGTCGCGTCCACC GTCATCCATGGCGAACTGGT

[i] Runx2, Runt-related transcription factor 2; ALP, alkaline phosphatase; OCN, osteocalcin.

Determination of ALP activity and staining

To assay the ALP activity in the cells subjected to the different treatments, the total protein was harvested at 1, 3 and 7 days after the different treatments, as described above. ALP activity was evaluated using the ALP assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer's instructions. The values were measured at 520 nm and normalized to the protein concentration determined using the BCA protein assay kit (Thermo Fisher Scientific, Rockford, IL, USA). In addition, ALP staining was performed 7 days following incubation with the conditioning medium using the BCIP/NBT ALP Color Development kit (Beyotime Biotechnology), according to the manufacturer's instructions.

Alizarin Red staining

Following incubation with DEX or DEX plus various concentrations of VK2 (10−5, 10−6, and 10−7 M), the cell cultures were rinsed 3 times with PBS, fixed with 4% paraformaldehyde for 30 min, and then stained with Alizarin Red (Beyotime Biotechnology) for a further 30 min. The cultures were then evaluated under a light microscope (CKX31; Olympus, Tokyo, Japan).

Immunofluorescence staining for Runx2 and OCN

Following 7 days of incubation with the different conditioning media, the MC3T3-E1 cells were fixed with 4% paraformaldehyde for 20 min, treated with 0.1% Triton X-100 for 15 min, and blocked with 10% FBS for 30 min at 37°C. The cells were then incubated with a rabbit anti-Runx2 monoclonal antibody (1:1,000 dilution; #12556; Cell Signaling Technology, Danvers, MA, USA) or an anti-OCN antibody (1:200 dilution; AB10911; Millipore, Billerica, MA, USA), followed by an anti-rabbit Alexa Fluor™ 488 secondary antibody (1:500 dilution; A32731; Invitrogen) for 1 h at 37°C. Finally, the MC3T3-E1 cells were stained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) for a further 30 sec, rinsed with PBS and then examined under a fluorescence microscope (Leica DM IL LED; Leica, Wetzlar, Germany).

Western blot analysis

To examine the effects of DEX or DEX and VK2 on the differentiation of the MC3T3-E1 cells, total protein was harvested from the cells cultured in the osteogenic medium described above for 1, 3 and 7 days. The protein concentrations were measured using the BCA protein assay kit (Thermo Fisher Scientific). The protein samples were then separated on a 10% SDS-PAGE gel and transferred onto a PVDF membrane. The membrane was blocked with 5% BSA and incubated with the primary antibodies overnight at 4°C, followed by incubation with a horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h. After rinsing 3 times with PBST, the membrane was scanned in an Odyssey scanner (Li-COR Biosciences, Lincoln, NE, USA). The antibodies used for the western blot analysis were as follows: monoclonal rabbit anti-rat GAPDH antibody (1:1,000 dilution; #2118), monoclonal rabbit anti-rat Runx2 antibody (1:1,000 dilution; #12556), and an HRP-conjugated rat anti-rabbit antibody (1:2,000 dilution; #7074) (all from Cell Signaling Technology, Danvers, MA, USA). The bands were quantified using Quantity One software and normalized to GAPDH.

Enzyme-linked immunosorbent assay (ELISA) for OCN in the media

Following incubation in the conditioning medium for 1, 3 and 7 days, the MC3T3-E1 cells were incubated with regular medium for a further 24 h. The media were then harvested and the concentrations of OCN in the media were detected using an ELISA kit (Mlbio, Shanghai, China); the values were normalized to the total protein concentration, which was determined using a BCA kit (Invitrogen).

Statistical analysis

SPSS 20.0 software (Microsoft, SPSS, Inc., Chicago, IL, USA) was used to analyze the values in each group. All the experiments in this study were performed in triplicate and the data are expressed as the means and standard deviation (SD). A statistical comparison of the data between the groups was performed using one-way analysis of variance (ANOVA) with a Student-Newman-Keuls (SNK) post hoc test. A P-value <0.05 was considered to indicate a statistically significant difference.

Results

VK2 promotes MC3T3-E1 cell proliferation and enhances MC3T3-E1 cell survival in the DEX-treated cultures

A CCK-8 assay was performed at 48, 96 and 144 h following treatment with DEX alone or with DEX and VK2. The results revealed that MC3T3-E1 cell proliferation was significantly suppressed at 96 and 144 h by DEX, although no significant change was observed at 48 h. However, the addition of VK2 promoted cell proliferation at these 3 time points, particularly following treatment with 10−6 and 10−7 M VK2. We did not observe a dose-dependent effect of VK2 (Fig. 1A).

The results of cell apoptosis assay indicated that VK2 inhibited apoptosis and enhanced the survival of the DEX-treated cells, which was also demonstrated by trypan blue staining. In this experiment, only 65.3% of the MC3T3-E1 cells in the DEX group survived after being treated with DEX in FBS-free medium for 6 days, while significantly more cells survived in the other groups. Cell viability imaging also yielded similar results (Fig. 1B–D).

VK2 improves the osteogenic differentiation potential of DEX-treated MC3T3-E1 cells

To verify whether VK2 enhances the osteogenic differentiation potential of DEX-treated MC3T3-E1 cells, we also detected the mRNA expression levels of both early and mature osteogenic markers in the MC3T3-E1 cells. The results revealed that, following incubation, the mRNA levels of Runx2, ALP and OCN were downregulated by DEX and upregulated by VK2, particularly following treatment with 10−6 M VK2 (Fig. 2).

VK2 upregulates Runx2 expression in DEX-treated MC3T3-E1 cells

We performed immunofluorescence staining and western blot analysis to detect the expression of Runx2, an early osteogenic marker. We observed that the Runx2 level in the DEX-treated MC3T3 cells was significantly decreased, while the Runx2 protein levels were significantly upregulated in the presence of VK2, particularly 10−6 M VK2 (Fig. 3).

VK2 promotes ALP expression in the DEX-treated MC3T3-E1 cells

Following 7 days of incubation with DEX or DEX and various concentrations of VK2, we performed ALP staining to detect osteogenesis in the MC3T3-E1 cells. As shown in Fig. 4, treatment with 10−5 M DEX markedly decreased the number of ALP-positive cells, while VK2 antagonized this effect, showing more bluish violet-coloured cells. ALP activity was also detected following 1, 3 and 7 days of incubation. The results revealed that ALP activity increased over time. The MC3T3-E1 cells in the DEX group displayed less ALP activity than those of the control group, particularly on days 3 and 7, while the MC3T3-E1 cells in the VK2 groups exhibited an increased ALP expression, particularly the cells treated with 10−6 M VK2 on day 7 (Fig. 4).

VK2 promotes OCN expression in the DEX-treated MC3T3-E1 cells

OCN is a mature stage osteogenic marker; therefore, the OCN levels in the media of the MC3T3-E1 cells treated with DEX and VK2 were detected on days 1, 3 and 7. The results revealed that the OCN levels in the media increased over time. The DEX-treated MC3T3-E1 cells secreted evidently less OCN than the controls at all time points, while the MC3T3-E1 cells treated with DEX and VK2 had more OCN in the media, particularly the cells treated with 10−6 M VK2 (Fig. 5). We also detected OCN expression in the MC3T3-E1 cells using immunofluorescence staining, and observed less OCN expression in the DEX-treated MC3T3-E1 cells and increased OCN expression in the VK2 groups. In addition, Alizarin Red staining revealed a similar antagonism of VK2 toward the DEX-treated MC3T3-E1 cells (Fig. 5).

Discussion

GC-induced osteoporosis greatly increases the risk of fracture, and pharmacological therapy is recommended as soon as possible and has been studied for many years (27). VK2 has been reported to be a promising therapy for GC-induced osteoporosis (28). Studies have indicated that VK2 inhibits bone loss and increases bone formation in GC-treated rats (25,29). Clinical studies have also reported increased serum levels of carboxylated OCN and lumbar bone mass volume in GC-treated patients (26,30). This study further confirmed the protective effects of VK2 against GC-induced damage in osteoblasts in vitro.

Several studies have indicated that GCs inhibit osteoblast proliferation in vivo (31,32), and VK2 has also been reported to promote osteoblast proliferation (13). In this study, we further confirmed the proliferative-promoting effect of VK2 on GC-treated MC3T3-E1 cells. This effect may be related to growth arrest-specific gene 6 (Gas6), which is a VK-dependent protein that is involved in cell proliferation by activating Axl (33,34). GC-induced osteoblast apoptosis has been clearly demonstrated in both in vivo and clinical studies (7,35). In this study, we observed significant apoptosis of the DEX-treated MC3T3-E1 cells and an anti-apoptotic effect of VK2. Studies have demonstrated that VK2 has some biological effects as a co-factor, including anti-apoptotic effects in erythroid progenitors (36), maintaining endothelial cell survival (37) and protecting neurons from methylmercury-induced cell death (38). The anti-apoptotic effects of VK2 are believed to be related to its role as an electron carrier in the regulation of mitochondrial function (39).

The critical role of Runx2 in osteoblasts has been well described by previous studies (40,41). Runx2 is a master transcription factor in osteoblast differentiation and bone formation, and strongly impacts the expression of osteoblast marker genes and related proteins, such as ALP. The study by Koromila et al demonstrated that GC markedly antagonized Runx2 and Runx2-mediated ALP activity in mesenchymal cells (3). In this study, we also observed that Runx2 was downregulated by GCs in osteoblastic cells, similar to a previous study by Kim et al (6). Furthermore, we observed a higher expression of Runx2 in the MC3T3-E1 cells treated with both GCs and VK2, which indicated that VK2 promoted the osteoblast differentiation of GC-treated osteoblastic cells partly by upregulating Runx2.

OCN is a non-collagenous, VK-dependent protein that is secreted in the late stage of osteoblast differentiation. One role of VK2 in bone metabolism is to act as a coenzyme for the γ-carboxylation of OCN, which combines with hydroxyapatite to ultimately promote bone mineralization (42). With the exception of its role as a regulator of bone mineralization, OCN has also been reported to regulate bone remodeling by modulating osteoblast and osteoclast activity (43). Runx2 has been recognized as a key regulator of OCN transcription, and both Runx2 and OCN transcription are inhibited by GCs (3,43). Studies have also shown that VK2 enhances OCN accumulation in human osteoblasts (43,19). In this study, we observed an evident downregulation in the proteins levels of Runx2 and OCN in the DEX-treated MC3T3-E1 cells and further confirmed the stimulatory effect of VK2 on osteoblast differentiation. Furthermore, we observed the upregulated expression of osteogenesis-related genes in the MC3T3-E1 cells treated with DEX and VK2; this may be attributed to the transcriptional effect of VK2 as VK2 can activate steroid and xenobiotic receptor (SXR) and regulate the transcription of extracellular matrix-related genes and collagen accumulation in osteoblastic cells (4446).

Studies have demonstrated that treatment with 10−5 M VK2 alone promotes mineralization and increases the Ca2+ concentrations more effectively than lower concentrations (17,18). However, in this study, we found that treatment with 10−6 M VK2, which was comparable to the serum concentrations in patients treated with VK (47), exerted the most effective protection against DEX. Some other studies have observed similar results, where 10−6 M VK2 had a stimulatory effect on colony formation and the proliferation of hematopoietic progenitors, producing fewer apoptotic cells than those treated with 10−5 M VK2 (36). Koshihara and Hoshi (19) observed more OCN in the medium of cells treated with 0.5 µM and 1.5 µM VK2, and OCN release in the medium was significantly enhanced by 0.5 µM VK2 in the presence of 1,25 (OH)2-D3. Therefore, we speculate that 10−6 M VK2 may be the most appropriate concentration to antagonize DEX in vitro.

In conclusion, in this study, we demonstrated that VK2 promoted osteoblast proliferation and osteogenic differentiation, inhibited cellular apoptosis and enhanced cellular survival, supporting the view that VK2 is a promising option for the prevention and treatment of GC-induced osteoporosis and osteonecrosis.

Acknowledgments

This study was funded by the National Natural Science Foundation of China (no. 81301572) and the SMC-Chen Xing Plan for Splendid Young Teachers of Shanghai Jiao Tong University.

References

1 

Kim BY, Yoon HY, Yun SI, Woo ER, Song NK, Kim HG, Jeong SY and Chung YS: In vitro and in vivo inhibition of glucocorticoid-induced osteoporosis by the hexane extract of Poncirus trifoliata. Phytother Res. 25:1000–1010. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Weinstein RS: Glucocorticoid-induced osteonecrosis. Endocrine. 41:183–190. 2012. View Article : Google Scholar

3 

Koromila T, Baniwal SK, Song YS, Martin A, Xiong J and Frenkel B: Glucocorticoids antagonize RUNX2 during osteoblast differentiation in cultures of ST2 pluripotent mesenchymal cells. J Cell Biochem. 115:27–33. 2014. View Article : Google Scholar

4 

Kerachian MA, Séguin C and Harvey EJ: Glucocorticoids in osteonecrosis of the femoral head: a new understanding of the mechanisms of action. J Steroid Biochem Mol Biol. 114:121–128. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Tan G, Kang PD and Pei FX: Glucocorticoids affect the metabolism of bone marrow stromal cells and lead to osteonecrosis of the femoral head: a review. Chin Med J (Engl). 125:134–139. 2012. View Article : Google Scholar

6 

Kim J, Lee H, Kang KS, Chun KH and Hwang GS: Protective effect of Korean Red Ginseng against glucocorticoid-induced osteoporosis in vitro and in vivo. J Ginseng Res. 39:46–53. 2015. View Article : Google Scholar

7 

O'Brien CA, Jia D, Plotkin LI, Bellido T, Powers CC, Stewart SA, Manolagas SC and Weinstein RS: Glucocorticoids act directly on osteoblasts and osteocytes to induce their apoptosis and reduce bone formation and strength. Endocrinology. 145:1835–1841. 2004. View Article : Google Scholar

8 

Weinstein RS, Jilka RL, Parfitt AM and Manolagas SC: Inhibition of osteoblastogenesis and promotion of apoptosis of osteoblasts and osteocytes by glucocorticoids. Potential mechanisms of their deleterious effects on bone. J Clin Invest. 102:274–282. 1998. View Article : Google Scholar : PubMed/NCBI

9 

Yun SI, Yoon HY, Jeong SY and Chung YS: Glucocorticoid induces apoptosis of osteoblast cells through the activation of glycogen synthase kinase 3beta. J Bone Miner Metab. 27:140–148. 2009. View Article : Google Scholar

10 

Weinstein RS, Chen JR, Powers CC, Stewart SA, Landes RD, Bellido T, Jilka RL, Parfitt AM and Manolagas SC: Promotion of osteoclast survival and antagonism of bisphosphonate-induced osteoclast apoptosis by glucocorticoids. J Clin Invest. 109:1041–1048. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Hamidi MS, Gajic-Veljanoski O and Cheung AM: Vitamin K and bone health. J Clin Densitom. 16:409–413. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Azuma K, Ouchi Y and Inoue S: Vitamin K: novel molecular mechanisms of action and its roles in osteoporosis. Geriatr Gerontol Int. 14:1–7. 2014. View Article : Google Scholar

13 

Yamaguchi M, Sugimoto E and Hachiya S: Stimulatory effect of menaquinone-7 (vitamin K2) on osteoblastic bone formation in vitro. Mol Cell Biochem. 223:131–137. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Shearer MJ and Newman P: Recent trends in the metabolism and cell biology of vitamin K with special reference to vitamin K cycling and MK-4 biosynthesis. J Lipid Res. 55:345–362. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Igarashi M, Yogiashi Y, Mihara M, Takada I, Kitagawa H and Kato S: Vitamin K induces osteoblast differentiation through pregnane X receptor-mediated transcriptional control of the Msx2 gene. Mol Cell Biol. 27:7947–7954. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Kim M, Na W and Sohn C: Vitamin K1 (phylloquinone) and K2 (menaquinone-4) supplementation improves bone formation in a high-fat diet-induced obese mice. J Clin Biochem Nutr. 53:108–113. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Koshihara Y, Hoshi K, Okawara R, Ishibashi H and Yamamoto S: Vitamin K stimulates osteoblastogenesis and inhibits osteoclastogenesis in human bone marrow cell culture. J Endocrinol. 176:339–348. 2003. View Article : Google Scholar : PubMed/NCBI

18 

Atkins GJ, Welldon KJ, Wijenayaka AR, Bonewald LF and Findlay DM: Vitamin K promotes mineralization, osteoblast-to-osteocyte transition, and an anticatabolic phenotype by {gamma}-carboxylation-dependent and -independent mechanisms. Am J Physiol Cell Physiol. 297:C1358–C1367. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Koshihara Y and Hoshi K: Vitamin K2 enhances osteocalcin accumulation in the extracellular matrix of human osteoblasts in vitro. J Bone Miner Res. 12:431–438. 1997. View Article : Google Scholar : PubMed/NCBI

20 

Akiyama Y, Hara K, Ohkawa I and Tajima T: Effects of menatetrenone on bone loss induced by ovariectomy in rats. Jpn J Pharmacol. 62:145–153. 1993. View Article : Google Scholar : PubMed/NCBI

21 

Iwamoto J, Matsumoto H, Takeda T, Sato Y and Yeh JK: Effects of vitamin K2 on cortical and cancellous bone mass, cortical osteocyte and lacunar system, and porosity in sciatic neurectomized rats. Calcif Tissue Int. 87:254–262. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Iwamoto J, Seki A, Sato Y, Matsumoto H, Tadeda T and Yeh JK: Vitamin K2 promotes bone healing in a rat femoral osteotomy model with or without glucocorticoid treatment. Calcif Tissue Int. 86:234–241. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Koitaya N, Sekiguchi M, Tousen Y, Nishide Y, Morita A, Yamauchi J, Gando Y, Miyachi M, Aoki M, Komatsu M, et al: Low-dose vitamin K2 (MK-4) supplementation for 12 months improves bone metabolism and prevents forearm bone loss in postmenopausal Japanese women. J Bone Miner Metab. 32:142–150. 2014. View Article : Google Scholar

24 

Koitaya N, Ezaki J, Nishimuta M, Yamauchi J, Hashizume E, Morishita K, Miyachi M, Sasaki S and Ishimi Y: Effect of low dose vitamin K2 (MK-4) supplementation on bio-indices in postmenopausal Japanese women. J Nutr Sci Vitaminol (Tokyo). 55:15–21. 2009. View Article : Google Scholar

25 

Hara K, Akiyama Y, Ohkawa I and Tajima T: Effects of menatetrenone on prednisolone-induced bone loss in rats. Bone. 14:813–818. 1993. View Article : Google Scholar : PubMed/NCBI

26 

Sasaki N, Kusano E, Takahashi H, Ando Y, Yano K, Tsuda E and Asano Y: Vitamin K2 inhibits glucocorticoid-induced bone loss partly by preventing the reduction of osteoprotegerin (OPG). J Bone Miner Metab. 23:41–47. 2005. View Article : Google Scholar

27 

van Staa TP, Leufkens HG and Cooper C: The epidemiology of corticosteroid-induced osteoporosis: a meta-analysis. Osteoporos Int. 13:777–787. 2002. View Article : Google Scholar : PubMed/NCBI

28 

Tanana I and Oshima H: Vitamin K2 as a potential therapeutic agent for glucocorticoid-induced osteoporosis. Clin Calcium. 16:1851–1857. 2006.In Japanese. PubMed/NCBI

29 

Iwamoto J, Matsumoto H, Takeda T, Sato Y, Liu X and Yeh JK: Effects of vitamin K(2) and risedronate on bone formation and resorption, osteocyte lacunar system, and porosity in the cortical bone of glucocorticoid-treated rats. Calcif Tissue Int. 83:121–128. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Inoue T, Sugiyama T, Matsubara T, Kawai S and Furukawa S: Inverse correlation between the changes of lumbar bone mineral density and serum undercarboxylated osteocalcin after vitamin K2 (menatetrenone) treatment in children treated with glucocorticoid and alfacalcidol. Endocr J. 48:11–18. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Sanderson M, Sadie-Van Gijsen H, Hough S and Ferris WF: The role of MKP-1 in the anti-proliferative effects of glucocorticoids in primary rat pre-osteoblasts. PLoS One. 10:e01353582015. View Article : Google Scholar : PubMed/NCBI

32 

Shi C, Huang P, Kang H, Hu B, Qi J, Jiang M, Zhou H, Guo L and Deng L: Glucocorticoid inhibits cell proliferation in differentiating osteoblasts by microRNA-199a targeting of WNT signaling. J Mol Endocrinol. 54:325–337. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Stenhoff J, Dahlbäck B and Hafizi S: Vitamin K-dependent Gas6 activates ERK kinase and stimulates growth of cardiac fibroblasts. Biochem Biophys Res Commun. 319:871–878. 2004. View Article : Google Scholar : PubMed/NCBI

34 

Kirane A, Ludwig KF, Sorrelle N, Haaland G, Sandal T, Ranaweera R, Toombs JE, Wang M, Dineen SP, Micklem D, et al: Warfarin blocks Gas6-mediated Axl activation required for pancreatic cancer epithelial plasticity and metastasis. Cancer Res. 75:3699–3705. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Calder JD, Buttery L, Revell PA, Pearse M and Polak JM: Apoptosis - a significant cause of bone cell death in osteonecrosis of the femoral head. J Bone Joint Surg Br. 86:1209–1213. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Sada E, Abe Y, Ohba R, Tachikawa Y, Nagasawa E, Shiratsuchi M and Takayanagi R: Vitamin K2 modulates differentiation and apoptosis of both myeloid and erythroid lineages. Eur J Haematol. 85:538–548. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Hegarty JM, Yang H and Chi NC: UBIAD1-mediated vitamin K2 synthesis is required for vascular endothelial cell survival and development. Development. 140:1713–1719. 2013. View Article : Google Scholar : PubMed/NCBI

38 

Sakaue M, Mori N, Okazaki M, Kadowaki E, Kaneko T, Hemmi N, Sekiguchi H, Maki T, Ozawa A, Hara S, et al: Vitamin K has the potential to protect neurons from methylmercury-induced cell death in vitro. J Neurosci Res. 89:1052–1058. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Vos M, Esposito G, Edirisinghe JN, Vilain S, Haddad DM, Slabbaert JR, Van Meensel S, Schaap O, De Strooper B, Meganathan R, et al: Vitamin K2 is a mitochondrial electron carrier that rescues pink1 deficiency. Science. 336:1306–1310. 2012. View Article : Google Scholar : PubMed/NCBI

40 

Banerjee C, McCabe LR, Choi JY, Hiebert SW, Stein JL, Stein GS and Lian JB: Runt homology domain proteins in osteoblast differentiation: AML3/CBFA1 is a major component of a bone-specific complex. J Cell Biochem. 66:1–8. 1997. View Article : Google Scholar : PubMed/NCBI

41 

Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, et al: Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell. 89:755–764. 1997. View Article : Google Scholar : PubMed/NCBI

42 

Shimizu T, Takahata M, Kameda Y, Hamano H, Ito T, Kimura-Suda H, Todoh M, Tadano S and Iwasaki N: Vitamin K-dependent carboxylation of osteocalcin affects the efficacy of teriparatide (PTH(1–34)) for skeletal repair. Bone. 64:95–101. 2014. View Article : Google Scholar : PubMed/NCBI

43 

Neve A, Corrado A and Cantatore FP: Osteocalcin: skeletal and extra-skeletal effects. J Cell Physiol. 228:1149–1153. 2013. View Article : Google Scholar

44 

Horie-Inoue K and Inoue S: Steroid and xenobiotic receptor mediates a novel vitamin K2 signaling pathway in osteoblastic cells. J Bone Miner Metab. 26:9–12. 2008. View Article : Google Scholar

45 

Ichikawa T, Horie-Inoue K, Ikeda K, Blumberg B and Inoue S: Steroid and xenobiotic receptor SXR mediates vitamin K2-activated transcription of extracellular matrix-related genes and collagen accumulation in osteoblastic cells. J Biol Chem. 281:16927–16934. 2006. View Article : Google Scholar : PubMed/NCBI

46 

Manolagas SC: Steroids and osteoporosis: the quest for mechanisms. J Clin Invest. 123:1919–1921. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Yoshiji H, Kuriyama S, Noguchi R, Yoshii J, Ikenaka Y, Yanase K, Namisaki T, Kitade M, Yamazaki M, Masaki T and Fukui H: Combination of vitamin K2 and the angiotensin-converting enzyme inhibitor, perindopril, attenuates the liver enzyme-altered preneoplastic lesions in rats via angiogenesis suppression. J Hepatol. 42:687–693. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

January-2017
Volume 39 Issue 1

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhang Y, Yin J, Ding H, Zhang W, Zhang C and Gao Y: Protective effect of VK2 on glucocorticoid-treated MC3T3-E1 cells. Int J Mol Med 39: 160-166, 2017.
APA
Zhang, Y., Yin, J., Ding, H., Zhang, W., Zhang, C., & Gao, Y. (2017). Protective effect of VK2 on glucocorticoid-treated MC3T3-E1 cells. International Journal of Molecular Medicine, 39, 160-166. https://doi.org/10.3892/ijmm.2016.2817
MLA
Zhang, Y., Yin, J., Ding, H., Zhang, W., Zhang, C., Gao, Y."Protective effect of VK2 on glucocorticoid-treated MC3T3-E1 cells". International Journal of Molecular Medicine 39.1 (2017): 160-166.
Chicago
Zhang, Y., Yin, J., Ding, H., Zhang, W., Zhang, C., Gao, Y."Protective effect of VK2 on glucocorticoid-treated MC3T3-E1 cells". International Journal of Molecular Medicine 39, no. 1 (2017): 160-166. https://doi.org/10.3892/ijmm.2016.2817