Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
October-2017 Volume 40 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2017 Volume 40 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Identification of differentially expressed microRNAs in knee anterior cruciate ligament tissues surgically removed from patients with osteoarthritis

  • Authors:
    • Bin Li
    • Lunhao Bai
    • Peng Shen
    • Yue Sun
    • Zhizuo Chen
    • Yu Wen
  • View Affiliations / Copyright

    Affiliations: Department of Orthopaedic Surgery, Shengjing Hospital of China Medical University, Shenyang, Liaoning 110004, P.R. China, Department of Histology and Embryology, College of Basic Medical Sciences, China Medical University, Shenyang, Liaoning 110122, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1105-1113
    |
    Published online on: July 31, 2017
       https://doi.org/10.3892/ijmm.2017.3086
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The degradation of cruciate ligaments is frequently observed in degenerative joint diseases, such as osteo­arthritis (OA). The present study aimed to identify the differentially expressed microRNAs (miRNAs or miRs) in knee anterior cruciate ligament (ACL) tissues derived from patients with OA and in health subjects (non-OA). By using Affymetrix miRNA 4.0 microarrays, a total of 22 miRNAs (including let-7f-5p, miR-26b-5p and miR-146a-5p) were found to be upregulated, while 17 (including miR-18a-3p, miR-138-5p and miR-485-3p) were downregulated in the osteoarthritic ACL tissues (fold change ≥2, P-value <0.05). The expression levels of 12 miRNAs were validated by quantitative PCR, and the corresponding results revealed an excellent correlation with the microarray data (R2=0.889). Genes (such as a disintegrin and metalloproteinase domain with thrombospondin type-1 motifs, bone morphogenetic protein-2, runt related transcription factor-2, collagen-1A1 and 2, interleukin-6 and transforming growth factor-β) involved in cartilage development and remodeling, collagen biosynthesis and degradation, inflammatory response and extracellular matrix homeostasis were predicted as potential targets of the dysregulated miRNAs. Moreover, a large set of putative genes were enriched in OA pathogenesis‑associated pathways (such as mitogen-activated protein kinase and vascular endothelial growth factor signaling pathway). Collectively, the data from our study provides novel insight into the ligament injury-related miRNA dysregulation in patients with OA.

Introduction

Osteoarthritis (OA) is a degenerative joint disease characterized by the destruction of articular cartilage, intraarticular inflammation and pathological alterations in peri-articular and subchondral bone (1,2). Various factors are involved in the pathogenesis of OA, including age (3), a history of diabetes, cancer or cardiovascular diseases (4), mechanical influences (5) and genetic factors (6). There is no disease-modifying treatment for the onset or progression of OA and associated structural damage, and the current treatments aim at relieving the symptoms (7). Therefore, the identification of novel molecules involved in the pathogenesis of OA is urgently required, and will provide basis for the development of therapies for OA.

MicroRNAs (miRNAs or miRs) are a category of non-coding RNAs 22–25 nt in length (8). As the key gene regulators, miRNAs directly bind to their target messenger RNAs (mRNAs) in a sequence-specific manner to facilitate degradation of the transcripts and to inhibit the protein translation (8). Differential expression profiles of certain miRNAs in cancers at different stages suggests that miRNAs are novel biomarkers for disease diagnostics (9). The application of microarray technology enables the detection of the expression levels of thousands of miRNAs simultaneously within tens of samples processed in a single experiment (10). The dysregulation of miRNAs has been found in tissue samples derived from patients with OA in a number of previous studies, including let-7 family miRNAs (11), miR-149 (12), miR-21 (13) and miR-24 (14). Most of the earlier studies compared miRNA expression in the injured cartilage and synovium between patients with OA and normal controls (15–17); however, changes in cruciate ligment have been less studied. The cruciate ligament is a collagenous tissue for structural support and provides proprioception to the body by mediating knee kinesthesia (18). Of note, the degradation of the cruciate ligaments frequently occurs in osteoarthritic knees (18,19). The present study was therefore conducted to analyze the miRNA expression profiles in anterior cruciate ligament (ACL) tissues surgically removed from patients with OA and control subjects by using miRNA microarray analysis. In addition, the biological functions and pathways affected by the differentially expressed miRNAs were analyzed.

Materials and methods

Sample recruitment and RNA extraction

Osteoarthritic ACL samples were surgically removed from 3 patients (64.67±3.06 years of age, Kellgren-Lawrence grade III–IV) during knee replacement surgery at Shengjing Hospital of China Medical University, Shenyang, China. Samples derived from 3 patients without OA who encountered ACL rupture were used as controls. The present research protocol was approved by the Institutional Review Board of China Medical University, and written informed consent was obtained from each participant prior to obtaining the samples. Total RNA was extracted from the ACL tissue samples using the total RNA purification kit (Norgen Biotek Corp., Thorold, ON, Canada), quantified on a NanoDrop ND-2100 spectrophotometer (Thermo Fisher Scientific, Inc., Pittsburgh, PA, USA), and assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA, USA).

miRNA microarray procedures

The RNA samples were tailed with Poly(A) and labeled with biotin using FlashTag™ biotin HSR ligation mix (Affymetrix, Inc., Santa Clara, CA, USA) according to the manufacturer's instructions. The labeled RNA samples were hybridized onto the Affymetrix miRNA 4.0 arrays on a hybridization oven 645, washed and stained on fluidics station 450, and then scanned with a Scanner 3000 (all from Affymetrix, Inc.).

Data analysis

Array images were analyzed with GeneChip Command Console software (version 4.0; Affymetrix, Inc.) to generate raw data. The obtained raw data were first normalized with robust multi-array average (RMA) using Expression Console software (version 1.3.1; Affymetrix, Inc.) and then analyzed with GeneSpring software (version 12.5; Agilent Technologies, Inc.). Principal component analysis (PCA) is a mathematical algorithm that is performed to reduce the data dimensionality while retaining most of the variation in the data set (20). Differentially expressed miRNAs were identified by evaluating the fold change (FC). miRNAs with an FC ≥2 and a P-value <0.05 (t-test) were considered as differentially expressed. Hierarchical clustering was performed to analyze the distinguishable miRNA expression patterns among the samples. Genes targeted by the identified differentially expressed miRNAs were shown as the intersection of Targetscan, PITA and microRNA.org databases (GeneSpring software, version 12.5). These putative target genes were subjected to Gene Ontology (GO) biological process annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis using FunNet algorithm. The P-value was calculated with a unilateral Fisher's exact test and corrected by false discovery rate (FDR). GOs and pathways with P-value <0.05 and FDR <0.05 were considered as significant. To display the combinatorial interactions between miRNA pairs and their shared targets, genes with P-value <0.05 (calculated by hypergeometric distribution) were presented using Cytoscape software.

Quantitative PCR

Quantitative PCR was performed on cDNA synthesized from the same RNA samples used in the prior microarray analysis. Primers used in this study were listed in Table I. The expression levels of 6 upregulated miRNAs (hsa-let-7f-5p, hsa-let-7g-5p, hsa-miR-146a-5p, hsa-miR-146b-3p, hsa-miR-26b-5p and hsa-miR-335-5p) and 6 downregulated miRNAs (hsa-miR-18a-3p, hsa-miR-485-3p, hsa-miR-665, hsa-miR-675-5p, hsa-miR-1207-5p and hsa-miR-138-5p) were determined on the Exicycler™ 96 (Bioneer, Daejeon, Korea) using SYBR-Green (Solarbio, Beijing, China). Triplicate reactions were performed. The data were analyzed by the comparative threshold cycle (Ct) method. U6 was used as the endogenous control.

Table I

Primers used in this work.

Table I

Primers used in this work.

MiRBase accession numberNameSequence information (5′→3′)
MIMAT0000067hsa-let-7f-5p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAACTAT
 Forward real-time PCR primer CGCGGCTGAGGTAGTAGATTGT
MIMAT0000414hsa-let-7g-5p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAACTGT
 Forward real-time PCR primer CGGTCGTGAGGTAGTAGTTTGT
MIMAT0000449 hsa-miR-146a-5p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAACCCA
 Forward real-time PCR primer GCGAGGTGAGAACTGAATTCCA
MIMAT0004766 hsa-miR-146b-3p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCCAGAA
 Forward real-time PCR primer GACTGCCCTGTGGACTCAGTTC
MIMAT0000083hsa-miR-26b-5p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACACCTAT
 Forward real-time PCR primer CGCGGCTTCAAGTAATTCAGG
MIMAT0000765hsa-miR-335-5p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACACATTT
 Forward real-time PCR primer CGCAGCTCAAGAGCAATAACGA
MIMAT0002891hsa-miR-18a-3p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCCAGAA
 Forward real-time PCR primer CGACTACTGCCCTAAGTGCTC
MIMAT0002176hsa-mir-485-3p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAGAGAG
 Forward real-time PCR primer CTGCTGTCATACACGGCTCTC
MIMAT0004952hsa-miR-665
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAGGGGC
 Forward real-time PCR primer CAGTTAACCAGGAGGCTGAGG
MIMAT0004284hsa-miR-675-5p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCACTGT
 Forward real-time PCR primer CTATAATGGTGCGGAGAGGGCC
MIMAT0005871 hsa-miR-1207-5p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCCCCTC
 Forward real-time PCR primer CTTATTGGCAGGGAGGCTG
MIMAT0000430hsa-miR-138-5p
 RT primer GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCGGCCT
 Forward real-time PCR primer CGGTGCAGCTGGTGTTGTGAAT
Universal reverse primer GTGCAGGGTCCGAGGTATTC

Results

PCA distinguishes patients with OA from control subjects

PCA was performed in the 6 knee ACL tissues based on the microarray data, and the corresponding results revealed that the ACL samples from the patients with OA could be distinguished from those of the control subjects (Fig. 1). The above results suggested that the specimens used in this study were properly prepared and could be classified into two distinct groups.

Figure 1

PCA of the miRNA profiles in knee ACL samples from patients with OA and control subjects. Each sample was assayed using an Affymetrix miRNA 4.0 microarray. The red dots represent samples from patients with OA, whereas the blue dots represent samples from the control subjects. PCA, principal component analysis; miRNA, microRNA; ACL, anterior cruciate ligament; OA, osteoarthritis.

Identification of differentially expressed miRNAs in knee ACL tissues

Our data indicated that 22 miRNAs were upregulated and 17 miRNAs were downregulated in the osteoarthritic ACL tissues (FC ≥2 and P-value <0.05). Twelve miRNAs were selected for further validation regarding their expression levels (such as hsa-miR-138-5p, hsa-miR-26b-5p, hsa-miR-665), their previous correlations with OA (such as hsa-miR-146a-5p, hsa-let-7g-5p, hsa-let-7f-5p), or data from the following analysis (such as hsa-miR-146b-3p, hsa-miR-1207-5p). Log2 results of the miRNA expression levels from the microarray analysis and the quantitative PCR analysis revealed an excellent correlation (R2=0.889; Fig. 2A). All analyzed human miRNAs were presented in a volcano plot (Fig. 2B), and the dysregulated ones were assessed via hierarchical clustering analysis (Fig. 2C). Results from hierarchical clustering analysis revealed that the ACL tissue samples were divided into two distinct clusters based on their pathological statuses. Collectively, these results implied that the microarray data reflected the reliable miRNA expression patterns in ACL tissues and that the samples from same situation clustered together.

Figure 2

Differentially expressed miRNAs in knee ACL tissues of patients with OA. (A) Log2 FC for microarray data (y-axis) is plotted against log2 FC for quantitative PCR data (x-axis) for each gene. (B) Volcano plots of miRNA microarray data (x-axis, log2 FC; y-axis, negative log10 P-value). The red plots depict differentially expressed miRNAs with an FC ≥2 and P<0.05 between the two groups. (C) Hierarchical cluster analysis of the miRNA microarray data. Each column depicts a single tissue sample and each row represented a miRNA. Red and green indicate high and low expression levels, respectively, whereas black indicates the mean expression levels. Distance metric, pearson centered; linkage rule, average. miRNA, microRNA; ACL, anterior cruciate ligament; FC, fold change; OA, osteoarthritis.

Microarray-based GO and KEGG pathway annotations

Three data bases predicted a total of 5,356 genes as putative targets for the differentially expressed miRNAs (Fig. 3A). Genes involved in cartilage remodeling (21), collagen biosynthesis (22), extracellular matrix (ECM) homeostasis (23) and inflammation (24) are summarized in Table II. Moreover, the GO annotation (at the biological process level) and KEGG pathway analysis of all putative genes revealed that these genes were enriched in 41 GO items and 23 KEGG pathways (data not shown). As indicated in Table III, several essential biological processes, including DNA-dependent regulation of transcription, signal transduction, multicellular organismal development, were affected by the differentially expressed miRNAs. Additionally, a large set of genes implicated in mitogen-activated protein kinase (MAPK), vascular endothelial growth factor (VEGF), protein kinase C (PKC)-mitogen-activated protein kinase (MEK), phosphatidylinositol 3-kinase (PI3K)-protein kinase B (AKT), as well as the WNT signaling pathway were mediated by the dysregulated miRNAs (Fig. 3B and C; pathway ID, 05200 for Fig. 3C). The above results provided useful information for us to understand how cruciate ligament injuries develop in OA patients.

Figure 3

KEGG pathway annotations of the putative target genes. (A) Genes targeted by the differentially expressed miRNAs are predicted with Targetscan, PITA and microRNA.org databases, and the corresponding numbers are shown in the venn diagram. (B) Putative targeted genes are annotated into several KEGG pathways. Pathways with P-value <0.05 and FDR <0.05 are selected and presented here (the top 10 pathways). (C) Pathways in cancer (ID, 05200). Genes mediated by the differentially expressed miRNAs are marked in red. miRNAs, microRNAs; FDR, false discovery rate; OA, osteoarthritis; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Table II

Prediction of target genes potentially related to osteoarthritis.

Table II

Prediction of target genes potentially related to osteoarthritis.

miRNAsGene symbolsFunction
hsa-let-7f/7g-5pBMP2, COL1A1, COL1A2, COL3A1, COL4A1, COL4A6, COL5A2, COL14A1, COL15A1, COL24A1, TGFBR1, ADAMTS8, IL6, IL10, IL13, HMGA1, HMGA2Cartilage development and remodeling
hsa-miR-10a-5pCOL4A4, COL24A1, ADAMTS4
hsa-miR-26b-5pCILP, COL1A2, COL9A1, COL10A1, COL11A1, ADAMTS19, HMGA1, HMGA2, IL6, IL1RAPCollagen biosynthesis and degradation
hsa-miR-138-5pMMP16, ADAMTSL3, IL6R, IL1RAP
hsa-miR-146a-5pCCL5, CXCR7, ADAMTS3, ADAMTS18
hsa-miR-146b-3pCOL11A1, MMP24, VEGFA
hsa-miR-335-5pCOL5A1, COL6A3, COL19A1, ADAMTS19, CCL5ECM homeostasis
hsa-miR-542-5pADAMTS8
hsa-miR-485-3pCOL12A1, TGFB3, MMP20, ADAMTS3Inflammatory response
hsa-miR-572COL7A1
hsa-miR-665COL8A2, TGFBR1, TGFBR2, ADAMTS8, CXCL11, CXCL12
hsa-miR-1207-5pCOL9A2, TGFBR1, ADAMTS10, ADAMTS19
hsa-miR-1254RUNX2, TGFBR3, ADAMTSL5

[i] OA, osteoarthritis; miRNAs, microRNAs; BMP, bone morphogenetic protein; RUNX, runt related transcription factor; COL, collagen; CILP, cartilage intermediate layer protein; HMGA, high mobility group AT-hook; IL, interleukin; ADAMTS, a disintegrin and metalloproteinase domain with thrombospondin type-1 motifs; CCL, chemokine (C-C motif) ligand; CXCL, chemokine (C-X-C motif) ligand; CXCR, chemokine (C-X-C motif) receptor; TGFB, transforming growth factor β; TGFBR, TGFB receptor; MMP, matrix metalloproteinase.

Table III

Identified biological process GO terms for the differentially expressed miRNAs (top 10).

Table III

Identified biological process GO terms for the differentially expressed miRNAs (top 10).

GO IDGO termList hitsP-value
GO:0006355Regulation of transcription, DNA-dependent4915.38E-09
GO:0007165Signal transduction2898.11E-05
GO:0007275Multicellular organismal development2375.38E-05
GO:0006351Transcription, DNA-dependent1661.24E-08
GO:0006468Protein phosphorylation1531.25E-08
GO:0007155Cell adhesion1513.54E-05
GO:0045944Positive regulation of transcription from RNA polymerase II promoter1384.43E-06
GO:0007399Nervous system development1318.66E-10
GO:0007049Cell cycle1215.31E-06
GO:0007411Axon guidance1144.42E-12

[i] GO, Gene Ontology; miRNAs, microRNAs; list hits, the number of genes annotated by the GO biological process category or annotation cluster within the analyzed list of target genes; P-value, the significance P-value of the gene enrichment in the GO biological process category or annotation cluster, calculated with the unilateral Fisher's exact test and corrected with the false discovery rate (FDR).

Establishment of miRNA-gene regulatory network

A large set of genes were predicated as targets for the differentially expressed miRNAs through the Targetscan, PITA and microRNA.org data bases. In order to visualize and integrate the interactions between the dysregulated miRNAs and their targets, a miRNA-gene regulatory network was established by using Cytoscape software (Fig. 4). Our results revealed that the differentially expressed miRNAs may function in combination to exert effects on their target genes.

Figure 4

The microRNA (miRNA)-gene network. The association between miRNA pairs with their targeted genes is obtained on the basis of the cumulative hypergeometric statistic, and presented by the Cytoscape software.

Discussion

miRNAs play crucial roles in mediating chondrogenesis, and are considered to link to the pathogenesis of cartilage-related diseases, including OA (25). In this study, miRNA microarray was performed to compare the miRNA expression levels in knee ACL tissues from patients with OA to those of the controls. Appropriate grouping of the 6 ACL samples was confirmed by PCA and heatmap data. We found that 22 miRNAs were upregulated and 17 were downregulated in the osteoarthritic ACL tissues. Additional bioinformatics was performed to analyze the biological processes and pathways that were affected by the identified differentially expressed miRNAs. The obtained data enhanced our understanding of the roles of the dysregulated miRNAs in OA pathogenesis.

Reportedly, let-7 miRNAs can regulate skeletal development by orchestrating the proliferation and differentiation of chondrocytes (11). The enforced overexpression of Lin28a, a let-7 inhibitor, has been shown to accelerate cartilage regrowth in a model of tissue injury (26). It is likely that the abnormal upregulation of let-7 miRNAs contributes to the degeneration of articular cartilage. In this study, to the best of our knowledge, we demonstrate for the first time that the expression of let-7f-5p and let-7g-5p was increased by 2.04- and 1.68-fold (log2FC) in the osteoarthritic ACL tissues, respectively. Though all let-7 family members share the identical seed region (GAGGUAG) (27), only these two let-7 members were identified to be dysregulated in OA-affected ligaments. Bone morphogenetic protein (BMP)2 has been reported to promote osteogenesis (28). Apart from its role in bone formation, the pre-injection of recombinant human BMP2 in the semitendinosus tendon enables successful ACL reconstruction following injury (29), suggesting a beneficial role of BMP2 in ligament injury. miR-140-5p is a potent regulator of BMP2 (30), and its expression is markedly reduced in osteoarthritic articular cartilage tissues (31), but not in ACL tissues, as evidenced by our microarray data. Of note, we found that BMP2 is a possible target for let-7f/7g-5p (Table II), although the interaction between them has not been entirely clarified. Moreover, apart from BMP2, other factors related to collagen biosynthesis and degradation and inflammatory response, such as transforming growth factor β receptor 1 (TGFβR1), various types of collagens (COL1A1 and COL1A2) and interleukins (IL)-6 were also putative targets for let-7f/7g-5p. To address the roles of let-7f/7g in osteoarthritic ligament lesion, their targets should also be taken into consideration.

Formation and degradation of collagens and ECM proteins are mediated by miR-26 family members (32). miR-26b is suggested to contribute to rheumatoid arthritis regarding to its elevation in IL-17 producing T cells (33). Such findings indicate that miR-26b may participate in inflammatory diseases in the joints. A significant upregulation of miR-26b-5p (previously miR-26b) was found in osteoarthritic ACL tissues in the present study. Although several putative targets of miRNA-26b, such as high mobility group AT-hook 1 (HMGA1 and HMGA2), cartilage intermediate layer protein (CILP), as well as a variety of collagens (COLs) are implicated in the development and progression of OA (34–36), the direct correlation of miRNA-26b dysregulation with OA has not been fully elucidated, and requires for further exploration.

miR-146a controls knee joint homeostasis by balancing inflammatory responses in cartilage (37). Its expression is increased in articular cartilage and/or synovium derived from patients with OA (38,39). Our results were consistent with these earlier findings by showing a significant upregulation of miR-146a-5p (previously miR-146a) in osteoarthritic knee ACL tissues. Studies on the correlation between OA pathogenesis and miR-146b-3p are limited. Our data indicated that miR-146b-3p was also overexpressed in osteoarthritic ACL tissues. Several genes associated to ECM homeostasis and inflammation such as matrix metalloproteinase (MMP)24 and VEGFA in OA (40,41) were predicted as targets for miR-146b-3p.

A disintegrin and metalloproteinase domain with thrombospondin type-1 motifs (ADAMTS) are a new family of metalloproteases that play important roles in physiological and pathological conditions (42,43). Previous studies have demonstrated that ADAMTS7 overexpression leading to the increased expression of tumor necrosis factor (TNF)-α and MMPs contributes OA development (44), while the knockdown or knockout of ADAMTS4 and/or ADAMTS5 prevents OA progression (45,46). These studies suggest that ADAMTS may be the potential molecular targets for the prevention and treatment of OA. In this study, we found that ADAMTS3, 4, 8, 10, 18, 19, ADAMTS-like-3, -5 were the putative targets for several differentially expressed miRNAs, including let-7f/7g-5p, miR-146a-5p, miR-1207-5p (Table II). Investigations of the interaction between these dysregulated miRNAs and their target ADAMTS will help to understand the mechanisms through which OA develops and progresses.

Several essential biological processes, such as the DNA-depen dent regulation of transcription, signal transduction and multicellular organismal development, are affected by miRNAs with differential expression levels in OA as indicated in GO annotation. To provide an overall understanding of the association between the dysregulated miRNAs and OA pathogenesis, KEGG pathway analysis was further performed. We found that several pathways enriched by the putative target genes were essential for OA pathogenesis. For instance, a study from Prasadam et al demonstrated that p38 MAPK phosphorylation was decreased in OA-affected chondrocytes as compared to normal chondrocytes, and that the inactivation of p38 signaling leads to OA-like changes in rats (47). In addition, activation of VEGF signaling has been suggested to contribute to synovial inflammation during the progression of OA (48).

In conclusion, our study revealed that 39 miRNAs were differentially expressed in knee ACL tissues from patients with OA. The functional bioinformatic analyses suggest that the dysregulated miRNAs may regulate cartilage development and remodeling, collagen biosynthesis and degradation, ECM homeostasis and pathology by interacting with their targets. Collectively, our study provides novel insight into the ligament injury-related miRNA dysregulation in patients with OA.

Acknowledgments

The present study was supported by grants from the Natural Science Foundation of Liaoning Province (no. 2014021011) and the National Natural Science Foundation of China (no. 81171716).

References

1 

Goldring MB and Goldring SR: Osteoarthritis. J Cell Physiol. 213:626–634. 2007. View Article : Google Scholar : PubMed/NCBI

2 

Johnson K, Zhu S, Tremblay MS, Payette JN, Wang J, Bouchez LC, Meeusen S, Althage A, Cho CY, Wu X, et al: A stem cell-based approach to cartilage repair. Science. 336:717–721. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Buckwalter JA and Martin JA: Osteoarthritis. Adv Drug Deliv Rev. 58:150–167. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Nüesch E, Dieppe P, Reichenbach S, Williams S, Iff S and Jüni P: All cause and disease specific mortality in patients with knee or hip osteoarthritis: population based cohort study. BMJ. 342:d11652011. View Article : Google Scholar : PubMed/NCBI

5 

Riordan EA, Little C and Hunter D: Pathogenesis of post-traumatic OA with a view to intervention. Best Pract Res Clin Rheumatol. 28:17–30. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Chapman K and Valdes AM: Genetic factors in OA pathogenesis. Bone. 51:258–264. 2012. View Article : Google Scholar

7 

Matthews GL and Hunter DJ: Emerging drugs for osteoarthritis. Expert Opin Emerg Drugs. 16:479–491. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Zhang B and Farwell MA: MicroRNAs: a new emerging class of players for disease diagnostics and gene therapy. J Cell Mol Med. 12:3–21. 2008. View Article : Google Scholar

9 

Ryan BM, Robles AI and Harris CC: Genetic variation in microRNA networks: the implications for cancer research. Nat Rev Cancer. 10:389–402. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Love C and Dave S: MicroRNA expression profiling using microarrays. Methods Mol Biol. 999:285–296. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Papaioannou G, Inloes JB, Nakamura Y, Paltrinieri E and Kobayashi T: let-7 and miR-140 microRNAs coordinately regulate skeletal development. Proc Natl Acad Sci USA. 110:E3291–E3300. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Santini P, Politi L, Vedova PD, Scandurra R and Scotto d'Abusco A: The inflammatory circuitry of miR-149 as a pathological mechanism in osteoarthritis. Rheumatol Int. 34:711–716. 2014. View Article : Google Scholar

13 

Zhang Y, Jia J, Yang S, Liu X, Ye S and Tian H: MicroRNA-21 controls the development of osteoarthritis by targeting GDF-5 in chondrocytes. Exp Mol Med. 46:e792014. View Article : Google Scholar : PubMed/NCBI

14 

Philipot D, Guérit D, Platano D, Chuchana P, Olivotto E, Espinoza F, Dorandeu A, Pers YM, Piette J, Borzi RM, et al: p16INK4a and its regulator miR-24 link senescence and chondrocyte terminal differentiation-associated matrix remodeling in osteoarthritis. Arthritis Res Ther. 16:R582014. View Article : Google Scholar

15 

Iliopoulos D, Malizos KN, Oikonomou P and Tsezou A: Integrative microRNA and proteomic approaches identify novel osteoarthritis genes and their collaborative metabolic and inflammatory networks. PLoS One. 3:e37402008. View Article : Google Scholar : PubMed/NCBI

16 

Mirzamohammadi F, Papaioannou G and Kobayashi T: MicroRNAs in cartilage development, homeostasis, and disease. Curr Osteoporos Rep. 12:410–419. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Qi Y, Ma N, Yan F, Yu Z, Wu G, Qiao Y, Han D, Xiang Y, Li F, Wang W, et al: The expression of intronic miRNAs, miR-483 and miR-483*, and their host gene, Igf2, in murine osteoarthritis cartilage. Int J Biol Macromol. 61:43–49. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Rajgopal A, Vasdev N, Pathak A, Gautam D and Vasdev A: Histological changes and neural elements in the posterior cruciate ligament in osteoarthritic knees. J Orthop Surg (Hong Kong). 22:142–145. 2014. View Article : Google Scholar

19 

Svoboda SJ: ACL injury and posttraumatic osteoarthritis. Clin Sports Med. 33:633–640. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Ringnér M: What is principal component analysis? Nat Biotechnol. 26:303–304. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Li Y and Xu L: Advances in understanding cartilage remodeling. F1000Res 4 (F1000 Faculty Rev). 642:2015.

22 

Henrotin Y, Addison S, Kraus V and Deberg M: Type II collagen markers in osteoarthritis: what do they indicate? Curr Opin Rheumatol. 19:444–450. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Fuhrmann IK, Steinhagen J, Rüther W and Schumacher U: Comparative immunohistochemical evaluation of the zonal distribution of extracellular matrix and inflammation markers in human meniscus in osteoarthritis and rheumatoid arthritis. Acta Histochem. 117:243–254. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Berenbaum F, Eymard F and Houard X: Osteoarthritis, inflammation and obesity. Curr Opin Rheumatol. 25:114–118. 2013. View Article : Google Scholar

25 

Shang J, Liu H and Zhou Y: Roles of microRNAs in prenatal chondrogenesis, postnatal chondrogenesis and cartilage-related diseases. J Cell Mol Med. 17:1515–1524. 2013. View Article : Google Scholar

26 

Shyh-Chang N, Zhu H, Yvanka de Soysa T, Shinoda G, Seligson MT, Tsanov KM, Nguyen L, Asara JM, Cantley LC and Daley GQ: Lin28 enhances tissue repair by reprogramming cellular metabolism. Cell. 155:778–792. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Yang X, Rutnam ZJ, Jiao C, Wei D, Xie Y, Du J, Zhong L and Yang BB: An anti-let-7 sponge decoys and decays endogenous let-7 functions. Cell Cycle. 11:3097–3108. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Gugala Z, Davis AR, Fouletier-Dilling CM, Gannon FH, Lindsey RW and Olmsted-Davis EA: Adenovirus BMP2-induced osteogenesis in combination with collagen carriers. Biomaterials. 28:4469–4479. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Hashimoto Y, Yoshida G, Toyoda H and Takaoka K: Generation of tendon-to-bone interface 'enthesis' with use of recombinant BMP-2 in a rabbit model. J Orthop Res. 25:1415–1424. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Hwang S, Park SK, Lee HY, Kim SW, Lee JS, Choi EK, You D, Kim CS and Suh N: miR-140-5p suppresses BMP2-mediated osteogenesis in undifferentiated human mesenchymal stem cells. FEBS Lett. 588:2957–2963. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Miyaki S, Sato T, Inoue A, Otsuki S, Ito Y, Yokoyama S, Kato Y, Takemoto F, Nakasa T, Yamashita S, et al: MicroRNA-140 plays dual roles in both cartilage development and homeostasis. Genes Dev. 24:1173–1185. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Li Z, Hassan MQ, Jafferji M, Aqeilan RI, Garzon R, Croce CM, van Wijnen AJ, Stein JL, Stein GS and Lian JB: Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation. J Biol Chem. 284:15676–15684. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Niimoto T, Nakasa T, Ishikawa M, Okuhara A, Izumi B, Deie M, Suzuki O, Adachi N and Ochi M: MicroRNA-146a expresses in interleukin-17 producing T cells in rheumatoid arthritis patients. BMC Musculoskelet Disord. 11:2092010. View Article : Google Scholar : PubMed/NCBI

34 

Valdes AM, Van Oene M, Hart DJ, Surdulescu GL, Loughlin J, Doherty M and Spector TD: Reproducible genetic associations between candidate genes and clinical knee osteoarthritis in men and women. Arthritis Rheum. 54:533–539. 2006. View Article : Google Scholar : PubMed/NCBI

35 

Amin AR and Islam AB: Genomic analysis and differential expression of HMG and S100A family in human arthritis: upregulated expression of chemokines, IL-8 and nitric oxide by HMGB1. DNA Cell Biol. 33:550–565. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Gasparini G, De Gori M, Paonessa F, Chiefari E, Brunetti A and Galasso O: Functional relationship between high mobility group A1 (HMGA1) protein and insulin-like growth factor-binding protein 3 (IGFBP-3) in human chondrocytes. Arthritis Res Ther. 14:R2072012. View Article : Google Scholar : PubMed/NCBI

37 

Li X, Gibson G, Kim JS, Kroin J, Xu S, van Wijnen AJ and Im HJ: MicroRNA-146a is linked to pain-related pathophysiology of osteoarthritis. Gene. 480:34–41. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Jin L, Zhao J, Jing W, Yan S, Wang X, Xiao C and Ma B: Role of miR-146a in human chondrocyte apoptosis in response to mechanical pressure injury in vitro. Int J Mol Med. 34:451–463. 2014. View Article : Google Scholar : PubMed/NCBI

39 

Yamasaki K, Nakasa T, Miyaki S, Ishikawa M, Deie M, Adachi N, Yasunaga Y, Asahara H and Ochi M: Expression of microRNA-146a in osteoarthritis cartilage. Arthritis Rheum. 60:1035–1041. 2009. View Article : Google Scholar : PubMed/NCBI

40 

Leijten JC, Bos SD, Landman EB, Georgi N, Jahr H, Meulenbelt I, Post JN, van Blitterswijk CA and Karperien M: GREM1, FRZB and DKK1 mRNA levels correlate with osteoarthritis and are regulated by osteoarthritis-associated factors. Arthritis Res Ther. 15:R1262013. View Article : Google Scholar : PubMed/NCBI

41 

Borgonio Cuadra VM, González-Huerta NC, Romero-Córdoba S, Hidalgo-Miranda A and Miranda-Duarte A: Altered expression of circulating microRNA in plasma of patients with primary osteoarthritis and in silico analysis of their pathways. PLoS One. 9:e976902014. View Article : Google Scholar : PubMed/NCBI

42 

Cal S, Obaya AJ, Llamazares M, Garabaya C, Quesada V and López-Otín C: Cloning, expression analysis, and structural characterization of seven novel human ADAMTSs, a family of metalloproteinases with disintegrin and thrombospondin-1 domains. Gene. 283:49–62. 2002. View Article : Google Scholar : PubMed/NCBI

43 

Durham TB, Klimkowski VJ, Rito CJ, Marimuthu J, Toth JL, Liu C, Durbin JD, Stout SL, Adams L, Swearingen C, et al: Identification of potent and selective hydantoin inhibitors of aggrecanase-1 and aggrecanase-2 that are efficacious in both chemical and surgical models of osteoarthritis. J Med Chem. 57:10476–10485. 2014. View Article : Google Scholar : PubMed/NCBI

44 

Lai Y, Bai X, Zhao Y, Tian Q, Liu B, Lin EA, Chen Y, Lee B, Appleton CT, Beier F, et al: ADAMTS-7 forms a positive feedback loop with TNF-α in the pathogenesis of osteoarthritis. Ann Rheum Dis. 73:1575–1584. 2014. View Article : Google Scholar

45 

Majumdar MK, Askew R, Schelling S, Stedman N, Blanchet T, Hopkins B, Morris EA and Glasson SS: Double-knockout of ADAMTS-4 and ADAMTS-5 in mice results in physiologically normal animals and prevents the progression of osteoarthritis. Arthritis Rheum. 56:3670–3674. 2007. View Article : Google Scholar : PubMed/NCBI

46 

Chu X, You H, Yuan X, Zhao W, Li W and Guo X: Protective effect of lentivirus-mediated siRNA targeting ADAMTS-5 on cartilage degradation in a rat model of osteoarthritis. Int J Mol Med. 31:1222–1228. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Prasadam I, Mao X, Wang Y, Shi W, Crawford R and Xiao Y: Inhibition of p38 pathway leads to OA-like changes in a rat animal model. Rheumatology (Oxford). 51:813–823. 2012. View Article : Google Scholar

48 

Almasry SM, Soliman HM, El-Tarhouny SA, Algaidi SA and Ragab EM: Platelet rich plasma enhances the immuno-histochemical expression of platelet derived growth factor and vascular endothelial growth factor in the synovium of the meniscectomized rat models of osteoarthritis. Ann Anat. 197:38–49. 2015. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li B, Bai L, Shen P, Sun Y, Chen Z and Wen Y: Identification of differentially expressed microRNAs in knee anterior cruciate ligament tissues surgically removed from patients with osteoarthritis. Int J Mol Med 40: 1105-1113, 2017.
APA
Li, B., Bai, L., Shen, P., Sun, Y., Chen, Z., & Wen, Y. (2017). Identification of differentially expressed microRNAs in knee anterior cruciate ligament tissues surgically removed from patients with osteoarthritis. International Journal of Molecular Medicine, 40, 1105-1113. https://doi.org/10.3892/ijmm.2017.3086
MLA
Li, B., Bai, L., Shen, P., Sun, Y., Chen, Z., Wen, Y."Identification of differentially expressed microRNAs in knee anterior cruciate ligament tissues surgically removed from patients with osteoarthritis". International Journal of Molecular Medicine 40.4 (2017): 1105-1113.
Chicago
Li, B., Bai, L., Shen, P., Sun, Y., Chen, Z., Wen, Y."Identification of differentially expressed microRNAs in knee anterior cruciate ligament tissues surgically removed from patients with osteoarthritis". International Journal of Molecular Medicine 40, no. 4 (2017): 1105-1113. https://doi.org/10.3892/ijmm.2017.3086
Copy and paste a formatted citation
x
Spandidos Publications style
Li B, Bai L, Shen P, Sun Y, Chen Z and Wen Y: Identification of differentially expressed microRNAs in knee anterior cruciate ligament tissues surgically removed from patients with osteoarthritis. Int J Mol Med 40: 1105-1113, 2017.
APA
Li, B., Bai, L., Shen, P., Sun, Y., Chen, Z., & Wen, Y. (2017). Identification of differentially expressed microRNAs in knee anterior cruciate ligament tissues surgically removed from patients with osteoarthritis. International Journal of Molecular Medicine, 40, 1105-1113. https://doi.org/10.3892/ijmm.2017.3086
MLA
Li, B., Bai, L., Shen, P., Sun, Y., Chen, Z., Wen, Y."Identification of differentially expressed microRNAs in knee anterior cruciate ligament tissues surgically removed from patients with osteoarthritis". International Journal of Molecular Medicine 40.4 (2017): 1105-1113.
Chicago
Li, B., Bai, L., Shen, P., Sun, Y., Chen, Z., Wen, Y."Identification of differentially expressed microRNAs in knee anterior cruciate ligament tissues surgically removed from patients with osteoarthritis". International Journal of Molecular Medicine 40, no. 4 (2017): 1105-1113. https://doi.org/10.3892/ijmm.2017.3086
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team