Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
November-2017 Volume 40 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 40 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome

  • Authors:
    • Haoran Shen
    • Zhou Liang
    • Saihua Zheng
    • Xuelian Li
  • View Affiliations / Copyright

    Affiliations: Department of Gynecology, Obstetrics and Gynecology Hospital of Fudan University, Shanghai, P.R. China, Department of Assisted Reproduction, Shanghai Ninth People's Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, P.R. China
    Copyright: © Shen et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1385-1396
    |
    Published online on: September 20, 2017
       https://doi.org/10.3892/ijmm.2017.3146
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The purpose of this study was to identify promising candidate genes and pathways in polycystic ovary syndrome (PCOS). Microarray dataset GSE345269 obtained from the Gene Expression Omnibus database includes 7 granulosa cell samples from PCOS patients, and 3 normal granulosa cell samples. Differentially expressed genes (DEGs) were screened between PCOS and normal samples. Pathway enrichment analysis was conducted for DEGs using ClueGO and CluePedia plugin of Cytoscape. A Reactome functional interaction (FI) network of the DEGs was built using ReactomeFIViz, and then network modules were extracted, followed by pathway enrichment analysis for the modules. Expression of DEGs in granulosa cell samples was measured using quantitative RT-PCR. A total of 674 DEGs were retained, which were significantly enriched with inflammation and immune-related pathways. Eight modules were extracted from the Reactome FI network. Pathway enrichment analysis revealed significant pathways of each module: module 0, Regulation of RhoA activity and Signaling by Rho GTPases pathways shared ARHGAP4 and ARHGAP9; module 2, GlycoProtein VI-mediated activation cascade pathway was enriched with RHOG; module 3, Thromboxane A2 receptor signaling, Chemokine signaling pathway, CXCR4-mediated signaling events pathways were enriched with LYN, the hub gene of module 3. Results of RT-PCR confirmed the finding of the bioinformatic analysis that ARHGAP4, ARHGAP9, RHOG and LYN were significantly upregulated in PCOS. RhoA-related pathways, GlycoProtein VI-mediated activation cascade pathway, ARHGAP4, ARHGAP9, RHOG and LYN may be involved in the pathogenesis of PCOS.

Introduction

Polycystic ovary syndrome (PCOS) is a complex endocrine disorder caused by hormone imbalance and often presents reproductive, metabolic and psychological syndromes (1). The reproductive syndromes mainly include ovulatory dysfunction, hyperandrogenism and polycystic ovaries, and the metabolic syndromes primarily include insulin resistance, obesity and dyslipidemia (2,3). The prevalence of PCOS is ~18% in women of productive age based on Rotterdam diagnostic criteria (4). To date, there is no cure for PCOS, and treatment and interventions tailored to clinical features are recommended. The etiology of PCOS is complex and remains largely unknown. Genetic and environmental factors are two primary contributors to the disorder (5). Exploration of the molecular mechanisms of PCOS will promote the understanding of its pathogenesis and has important implications for designing novel therapy.

Molecular mechanisms of PCOS have been increasingly investigated. It was recently found that hypoxia-inducible factor (HIF)-1α-mediated endothelin (ET)-2 signaling was suppressed in a PCOS mouse model and closely associated with the development of PCOS (6). Moreover, microarray and bioinformatic analysis have been utilized to unravel the molecular mechanisms of PCOS and yielded considerable results. For example, dysregulated circulating miRNAs have been predicted to be associated with several signaling pathways, such as immune, angiogenesis and p53 signaling in PCOS (7). In addition, there is evidence that Notch signaling and mitogen activated protein kinase (MAPK) pathways may be involved in the progression of PCOS (8). Furthermore, it has been suggested that the dysregulated genes between PCOS patients with and without insulin resistance may play roles in PCOS-related metabolic abnormalities and follicular growth arrest (9). Liu et al applied a sub-pathway method to identify candidate agents for PCOS treatment (10), and studied the transcription factor-microRNA synergistic regulatory network in PCOS (11) based on the transcript profile GSE34526. Additionally, this dataset was used by Bohler et al to collaborate the WikiPathways and Reactome as a new analysis tool of different omics datasets (12). Despite of these achievements, the molecular mechanisms of PCOS remain unclear.

It has been demonstrated that network-based data could offer an integrated view of the genes or proteins in the network and facilitate a better understanding of the molecular mechanisms linked to phenotypes of interest (13). Thus, the present study not only identified differentially expressed genes (DEGs), and DEG-related pathways in PCOS, but also constructed a Reactome function interaction (FI) network based on the interactions between DEGs. Moreover, pathway enrichment analysis was performed for the network modules extracted from the FI network. Furthermore, quantitative RT-PCR was used to detect expression of DEGs which may be important candidate genes in PCOS. The study may shed new light on the molecular mechanisms of PCOS.

Materials and methods

Preprocessing of microarray data

It was a secondary study of the microarray dataset GSE34526 (9) which was obtained from the Gene Expression Omnibus (GEO) database (14) (http://www.ncbi.nlm.nih.gov/geo/), and based on the Affymetrix Human Genome U133 Plus 2.0 Array platform (15). The microarray dataset consisted of 7 granulosa cell samples from 7 women with PCOS undergoing in vitro fertilization and 3 control granulosa cell samples from 3 normal women undergoing in vitro fertilization. For data preprocessing, the probe-level data in CEL files were converted into expression measures by using the affy package in R language (16), and then was subjected to background correction and quartile data normalization by using robust multiarray average (RMA) algorithm. Each probe was mapped to its corresponding gene using Biconductor annotation function (17) of R language. The probes corresponding to no gene or more than one gene were deleted. When there were several probes for one gene, the averaged expression value of these probes was used as the expression value of the gene. The standardized expression value is shown in a box figure (Fig. 1). It was depicted that the median gene expression value of normal samples is as high as that of PCOS samples, suggesting a marked degree of standardization of the data after preprocessing.

Figure 1

A boxplot of the gene expression profile across samples after preprocessing. Horizontal axis represents sample names; vertical axis represents gene expression value. Blue box stands for normal sample; pink box stands for polycystic ovary syndrome (PCOS) sample. Black horizontal line residing in the box stands for the median of the sample expression value. It shows that the median expression value of normal samples is as high as that of PCOS samples.

Determination and hierarchical clustering analysis of DEGs

Linear Models for Microarray Analysis package in R language (18) was employed to screen DEGs between PCOS samples and control normal samples. The strict thresholds were set at fold-change (|log2FC|) ≥1 and P-value <0.05. The screened DEGs underwent two-way hierarchical clustering analysis by using the pheatmap package (19) in R language (http://cran.fhcrc.org/web/packages/pheatmap/index.html).

Pathway enrichment analysis

In order to unveil the pathways that may be associated with the identified DEGs, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed using ClueGO plug-in and CluePedia plugin of Cytoscape software. ClueGO plug-in (http://www.ici.upmc.fr/cluego/cluegoDownload.shtml) can extrapolate the biological function of large gene lists by identifying significant gene ontology (GO) terms and KEGG pathways, and functionally categorize the GO terms and KEGG pathways (20). The CluePedia plugin (http://www.ici.upmc.fr/cluepedia/) is used to search for pathway-associated markers and can offer an extensive view of a pathway by studying experimental information and in silico data (21). In this study, a right-side hypergeometric test was used for calculation of the P-value, followed by the multiple test correction [Benjamini-Hochberg adjustment (22)]. A pathway with adjusted P-value <0.05 was considered significant.

Based on the Kappa score threshold (≥0.4), these significant pathways were functionally divided into several groups and exhibited in a network, in which a node represented a KEGG pathway, and an edge between two nodes indicated that the two pathways shared common genes. Significant KEGG pathways enriched with the DEGs in the present study were visualized using R/Bioconductor package path-view which is a useful tool to map user data onto relevant pathways and offers graphs of the pathways mapped by the user data (23).

Construction of a Reactome FI network and analysis of the network modules

It has been shown that complicated disease phenotypes are better related to changes in networks, instead of a single gene or gene product (24). Therefore, a Reactome FI network was constructed with the DEGs by using ReactomeFIViz. ReactomeFIViz (http://wiki.reactome.org.sci-hub.org/index.php/Reactome_FI_Cytoscape_Plugin) is a Cytoscape app which can construct a Reactome FI network for pathway and network-based analysis of high throughout experimental data, and extract pathway and network patterns associated with diseases (13). In the network, nodes represent genes. An edge between two nodes stands for the interaction between two genes in the network. The edge weight corresponds to the Pearson's correlation coefficient between the two genes.

Network clustering analysis was then performed for the Reactome FI network by using Markov clustering algorithm (25), and highly connected network modules (min module size ≥7; average correlation ≥0.25) were extracted from the network. The hub gene in a module referred to the gene that had the most interactions. In order to identify association of the network modules with sample phenotype, the Pearson' correlation coefficient of the genes in each module to the sample phenotype (normal and PCOS samples) was calculated. The mean Pearson's correlation coefficient of all genes included in each module was regarded as the module significance. Moreover, pathway enrichment analysis was also performed for genes in each module using the reactomeFIVZ (P<0.05) based on the following publicly available databases: Reactome (R) database (26), KEGG (K), National Cancer Institute Pathway Interaction Database (NCI-PID) (N) (27), BioCarta in NCI-PID (B), and PantherDB (P). (28)

Quantitative RT-PCR

Expression of identified DEGs in granulosa cell samples was tested using quantitative RT-PCR. A total of 12 follicular fluid samples were collected for the experiment, including 5 samples from 5 normal women and 7 samples from 7 patients with PCOS, who were undergoing in vitro fertilization. Demographic and clinical characteristics of each subject were collected from medical records, including age, follicle-stimulating hormone (FSH), luteinizing hormone (LH), prolactin (PRL), estradiol (E2), thyroid (T), fasting blood glucose (FBG), fasting plasma insulin (FINS), homeostasis model assessment of insulin resistance (HOMA-IR) levels, height, body weight, body mass index (BMI), and number of antral follicles (left and right).

The experiment was approved by the Ethics Committee of Obstetrics and Gynecology Hospital of Fudan University and informed consent was obtained before the use of the samples. Granulosa cells were extracted from the follicular fluid using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthetized as recommended by the manufacturer using a reverse transcription kit (Takara, Tokyo, Japan). Thermal cycle profiles used in this study were: denaturing for 10 min at 95°C, annealing for 15 sec at 95°C, and extension for 10 sec at 72°C. PCR was carried out for 30 cycles. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference. The set of primers used in the study is shown in Table I.

Table I

Primers used for the RT-PCR experiment in the study.

Table I

Primers used for the RT-PCR experiment in the study.

GenePrimer sequences
MYH9F: GCCAAGACCGTGAAGAAT
R: CCAGACAGGAGATAATAGAAGA
LYNF: TGAAGCCAGGAACTATGTC
R: TGTACTCGGTGATGATGTAA
ARHGAP4F: GGATGAGGTGGCTGAGAT
R: GCTGGTCTGGAAGGAATC
ARHGAP9F: GGACGCTGCTTCTACATAA
R: GACATCATTGTTCCTCTTCAG
ACTBF: TCATGAAGTGTGACGTGGACATC
R: CAGGAGGAGCAATGATCTTGATCT
RHOGF: CTGCTCATCTGCTACACAA
R: CCACAGGTTCAGGTTCAC
GAPDHF: TGACAACTTTGGTATCGTGGAAGG
R: AGGCAGGGATGATGTTCTGGAGAG

[i] F, forward; R, reverse.

Statistical analysis

SPSS version 19.0 (IBM Corp., Armonk, NY, USA) was used for data analysis. Continuous variables between two groups were compared using Student's t-test. ANOVA was used to analyze the differences between 3 groups, followed by pairwise comparison using least significant difference test. Differences with P-value <0.05 were considered significant.

Results

Identification and hierarchical clustering analysis of DEGs

Between PCOS and control samples, 674 DEGs were screened, including 506 upregulated genes and 168 downregulated genes. The result of the hierarchical clustering analysis of the DEGs is exhibited in a heatmap plot (Fig. 2). The majority of genes in the PCOS samples was upregulated as compared to those in the control samples.

Figure 2

A heatmap plot of the differentially expressed genes (DEGs) of all samples. Horizontal axis represents sample name; vertical axis represents the fold-change of DEG expression. The red denotes expression of upregulated DEGs; the green denotes expression of downregulated DEGs. Color bar above indicates sample type: pink bar for polycystic ovary syndrome (PCOS) samples and blue bar for normal samples.

Pathway enrichment analysis

KEGG pathway enrichment analysis was performed for the DEGs with a view to determining which pathways possibly involved the obtained DEGs. Collectively, 41 pathways were significantly enriched with the DEGs. As shown in Fig. 3, 30 pathways were functionally categorized into 5 groups based on the Kappa score (≥0.4). The other 11 pathways were not functionally related to other pathways. These significant pathways were primarily associated with immune and inflammation. Each significant pathway was visualized by the Pathview software. One example was the Cytokine-cytokine receptor interaction pathway (adjusted P=1.67E−05) (Fig. 4) which was enriched with 31 genes, such as chemokine (C-X-C motif) ligand (CXCL) subfamily members (CXCL3, CXCL6, CXCL10, CXCL16 and CXCL4) and chemokine (C-C motif) ligand (CCL) subfamily members (CCL2, CCL8, CCR5, CCR7 and CCR1).

Figure 3

Grouping of significant Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways of the differentially expressed genes (DEGs). A node represents a KEGG pathway, and the node size is negatively correlated with the adjusted P-value of the pathway. An edge between two nodes denotes that the two pathways share common genes. The edge width is positively correlated with the number of common genes. Significant KEGG pathways of DEGs are classified into several functional groups based on κ value. Nodes of a group are labeled in the same color. Grey nodes do not share genes with other pathways. The nodes of two colors are shared by two groups.

Figure 4

Pathview of the Cytokine-cytokine receptor interaction pathway. Node color change reflects log fold-change (FC) range.

Analysis of the Reactome FI network and the network modules

For the purpose of evaluating the associations between the identified DEGs, a Reactome FI network was constructed with the DEGs, and 8 highly connected network nodules were extracted from the network (Table II). Fig. 5 shows that among the 8 modules, module 0 had the largest size, including 13 genes with hub gene RAS-related C3 botulinum substrate 2 (RAC2). Both module 1 and 2 had 11 genes. The hub genes were actin-β (ACTB) and Fc fragment of IgG, low affinity IIc, receptor for (CD32) (FCGR2C), respectively. Additionally, 10 genes were included in module 3 with LYN proto-oncogene, Src family tyrosine kinase (LYN) as the hub genes.

Figure 5

Eight network modules extracted from the Reactome function interaction network. A node stands for a differentially expressed gene (DEG); the link between two nodes reflects the interaction of the two DEGs. Nodes of one module are shown in the same color. The node that has the most links in a module is defined as the hub gene of the module.

Table II

Components of 8 network modules.

Table II

Components of 8 network modules.

ModuleNo of genesAverage correlationGene list
Module 0130.8196ARAP1, ARHGAP26, ARHGAP4, ARHGAP9, CORO1A, HMHA1, NCKAP1L, PIP5K1B, PKN1, PREX1, RAC2, RHOG, STARD8
Module 1110.8695ACTB, ARPC1B, CFL2, COL8A2, EPB41L3, MYH9, MYO1G, P2RX7, PARVG, PSTPIP1, ZYX
Module 2110.8501BLNK, CD72, CLEC7A, FCGR2B, FCGR2C, LILRA2, LILRA5, LILRA6, OSCAR, SLA, SYK
Module 3100.8006CD24, CD53, DAB2, FCER1G, FGR, HCK, LPAR3, LYN, SHC4, TNFRSF11A
Module 480.8748COL15A1, FERMT3, FLNA, ICAM3, ITGB2, RASSF5, SELPLG, TGFBI
Module 580.7448CXCL16, CXCL3, CXCL6, GNAI2, NPY2R, NUCB1, P2RY13, SUCNR1
Module 680.6387AP1S2, HLA-DMA, HLA-DPA1, HLA-DQA1, HLA-DQB1, HLA-DRA, LGMN, RACGAP1
Module 770.6262CD14, CD180, LY86, LY96, TLR1, TLR4, TNFRSF1B

[i] Average correlation: average absolute edge weight of edges in a module.

The module significance to sample phenotype (normal and PCOS samples) was calculated to explore the degree of the association of each module with sample phenotype. As shown in Fig. 6, the module significance ranged from 0.702 to 0.81. This suggested that these modules were well associated with the sample phenotype. Module 3 had the highest module significance (0.81).

Figure 6

Module significance. Horizontal axis indicates module name; vertical axis indicates module significance. The mean Pearson's correlation coefficient of all genes in each module to sample phenotype is defined as module significance.

Pathway enrichment analysis was also performed for the genes in each module. Top 5 significant pathways for each network module were identified based on the P-value (Table III). Module 0 was significantly enriched with the Regulation of RhoA activity, Signaling by Rho GTPases, Regulation of RAC1 activity, GPVI-mediated activation cascade and RhoA signaling pathways. Rho GTPase activating protein (ARHGAP)4 and ARHGAP9 are involved in the Regulation of RhoA activity and Signaling by Rho GTPase pathways. In addition, Ras homolog family member G (RHOG) was related to Signaling by Rho GTPases and GlycoProtein (GP)VI-mediated activation cascade pathways. Module 1 was associated with the Regulation of actin cytoskeleton, Salmonella infection, Nicotinic acetyl-choline receptor signaling, and Tight junction pathways. ACTB and myosin, heavy chain 9, non-muscle (MYH9) were enriched in the 4 pathways. Module 2 was related to the Tuberculosis, Osteoclast differentiation, B cell receptor signaling, BCR signaling and Phagosome signaling pathways. Module 3 was related to Thromboxane A2 receptor signaling, Signaling events mediated by PTP1B, Chemokine signaling, CXCR4-mediated signaling events and ephrin B reverse signaling pathways. LYN, hub gene of module 3 was enriched in each of these pathways. Notably, module 6 was related to MHC class II antigen presentation pathway which was enriched with several human leukocyte antigen (HLA) genes, such as HLA-DQB1, HLA-DPA1, HLA-DMA, HLA-DQA1 and HLA-DRA. Module 7 was linked to Toll-like receptor-related pathways.

Table III

Top 5 significant KEGG pathways for each network module.

Table III

Top 5 significant KEGG pathways for each network module.

ModulePathwayNo. of genes.P-valueGene list
Module 0Regulation of RhoA activity30ARHGAP4, ARAP1, ARHGAP9
Module 0Signaling by Rho GTPases80ARHGAP26, ARHGAP4, HMHA1, RAC2, STARD8, ARAP1, RHOG, ARHGAP9
Module 0Regulation of RAC1 activity20.0012PREX1, ARHGAP9
Module 0GPVI-mediated activation cascade20.0015RAC2, RHOG
Module 0RhoA signaling pathway20.0016PIP5K1B, PKN1
Module 1Regulation of actin cytoskeleton40ACTB, ARPC1B, CFL2, MYH9
Module 1Salmonella infection30.0001ACTB, ARPC1B, MYH9
Module 1Nicotinic acetylcholine receptor signaling pathway20.0002ACTB, MYH9
Module 1Tight junction30.0003ACTB, EPB41L3, MYH9
Module 1Integrin signaling pathway30.0005ACTB, ARPC1B, COL8A2
Module 2Tuberculosis40FCGR2B, FCGR2C, CLEC7A, SYK
Module 2Osteoclast differentiation80FCGR2B, LILRA2, FCGR2C, OSCAR, LILRA5, LILRA6, BLNK, SYK
Module 2B cell receptor signaling pathway40FCGR2B, CD72, BLNK, SYK
Module 2BCR signaling pathway40FCGR2B, CD72, BLNK, SYK
Module 2Phagosome30.0006FCGR2B, FCGR2C, CLEC7A
Module 3Thromboxane A2 receptor signaling30FGR, LYN, HCK
Module 3Signaling events mediated by PTP1B30FGR, LYN, HCK
Module 3Chemokine signaling pathway40FGR, LYN, HCK, SHC4
Module 3CXCR4-mediated signaling events30FGR, LYN, HCK
Module 3Ephrin B reverse signaling30FGR, LYN, HCK
Module 4β2 integrin cell surface interactions30ICAM3, TGFBI, ITGB2
Module 4Cell adhesion molecules (CAMs)30.0002ICAM3, ITGB2, SELPLG
Module 4Integrin signaling pathway30.0002COL15A1, ITGB2, FLNA
Module 4amb2 integrin signaling20.0003ITGB2, SELPLG
Module 4Extracellular matrix organization30.0008ICAM3, COL15A1, ITGB2
Module 5GPCR ligand binding60P2RY13, CXCL16, CXCL3, NPY2R, SUCNR1, CXCL6
Module 5Chemokine signaling pathway40GNAI2, CXCL16, CXCL3, CXCL6
Module 5GPCR downstream signaling70P2RY13, GNAI2, CXCL16, CXCL3, NPY2R, SUCNR1, CXCL6
Module 5Cytokine-cytokine receptor interaction30.0006CXCL16, CXCL3, CXCL6
Module 5Pertussis20.0012GNAI2, CXCL6
Module 6Epstein-Barr virus infection40HLA-DQB1, HLA-DPA1, HLA-DQA1, HLA-DRA
Module 6MHC class II antigen presentation80HLA-DQB1, AP1S2, LGMN, HLA-DPA1, RACGAP1, HLA-DMA, HLA-DQA1, HLA-DRA
Module 6Viral myocarditis50HLA-DQB1, HLA-DPA1, HLA-DMA, HLA-DQA1, HLA-DRA
Module 6Staphylococcus aureus infection50HLA-DQB1, HLA-DPA1, HLA-DMA, HLA-DQA1, HLA-DRA
Module 6Autoimmune thyroid disease50HLA-DQB1, HLA-DPA1, HLA-DMA, HLA-DQA1, HLA-DRA
Module 7Pertussis30LY96, TLR4, CD14
Module 7NF-κB signaling pathway30LY96, TLR4, CD14
Module 7Toll-like receptors cascades60LY96, LY86, TLR1, TLR4, CD14, CD180
Module 7Pathogenic Escherichia coli infection30LY96, TLR4, CD14
Module 7Toll-like receptor signaling pathway40LY96, TLR1, TLR4, CD14

[i] KEGG, Kyoto Encyclopedia of Genes and Genomes.

RT-PCR analysis

Bioinformatic analysis showed that ARHGAP4, ARHGAP9, RHOG, ACTB, MYH9 and LYN were upregulated DEGs in PCOS samples relative to normal samples. In order to verify these results, quantitative RT-PCR was used to measure the mRNA expression of these genes in granulosa cell samples of PCOS patients and normal controls. With regard to demographic and clinical characteristics (Table IV), PCOS patients and normal controls were not significantly different in regards to age, FSH, LH, PRL, E2, T and height. Yet, PCOS patients had markedly increased FBG, FINS, HOMA-IR, body weight, BMI and number of antral follicles. As shown in Fig. 7, ARHGAP4, ARHGAP9, RHOG and LYN at the mRNA level were significantly increased in PCOS compared to levels in the normal controls (P<0.05). Although increased mRNA expression of ACTB and MYH9 was also observed in PCOS, the difference was not significant (P>0.05).

Figure 7

mRNA levels of ARHGAP4, ARHGAP9, RHOG, ACTB, MYH9 and LYN in granulosa cell samples of polycystic ovary syndrome (PCOS) patients and normal controls as detected using RT-PCR. *P<0.05 compared to control. PCOS, polycystic ovary syndrome; ARHGAP, Rho GTPase activating protein; RHOG, Ras homolog family member G; ACTB, actin-β; MYH9, myosin, heavy chain 9, non-muscle; LYN, LYN proto-oncogene, Src family tyrosine kinase.

Table IV

Demographic and clinical characteristics of controls and PCOS patients for PCR analysis.

Table IV

Demographic and clinical characteristics of controls and PCOS patients for PCR analysis.

VariableControl group (n=5)PCOS group (n=7)P-value
Age (years)27.000±2.12128.857±4.6700.379
FSH (mIU/ml)5.438±0.5145.267±0.4040.532
LH (mIU/ml)4.196±0.6414.174±1.9880.982
PRL(ng/ml)14.988±2.29619.986±4.6760.054
E2 (pg/ml)29.200±8.04432.857±13.0310.593
T (ng/ml)0.268±0.0400.294±0.1570.725
FBG (mmol/l)5.200±0.1585.443±0.2880.092
FINS (mIU/l)5.980±0.85810.829±2.7800.004
HOMA-IR1.380±0.1912.637±0.7590.005
Height (m)1.584±0.0541.607±0.0490.466
Body weight (kg)54.000±8.60270.286±9.6560.013
BMI21.467±2.70427.204±3.3720.011
Number of antral follicles (L)6.800±1.30421.714±5.851 <0.001
Number of antral follicles (R)7.800±1.30425.714±2.870 <0.001

[i] Differences between two groups were analyzed using Student's t-test. P-values marked in bold are <0.05. PCOS, polycystic ovary syndrome; FSH, follicle-stimulating hormone; LH, luteinizing hormone; PRL, prolactin; E2, estradiol; T, thyroid; FBG, fasting blood glucose; FINS, fasting plasma insulin; HOMA-IR, homeostasis model assessment of insulin resistance; BMI, body mass index.

Furthermore, the 7 PCOS samples were divided into two groups: PCOS non-IR (n=3) and PCOS IR (n=4) groups. The demographic and clinical characteristic analysis revealed that LH and E2 were significantly decreased, and FINS, HOMA-IR and BMI were significantly increased in PCOS IR patients relative to PCOS non-IR patients (Table V). Results of RT-PCR found that the PCOS IR group had markedly elevated expression of ARHGAP4, ARHGAP9, RHOG and LYN when compared to these parameters in the PCOS non-IR group (Fig. 8).

Figure 8

mRNA levels of ARHGAP4, ARHGAP9, RHOG, ACTB, MYH9 and LYN in granulosa cell samples of polycystic ovary syndrome (PCOS) non-IR patients, PCOS IR patients and normal controls as detected using RT-PCR. *P<0.05 compared to the control; #P<0.05 compared to PCOS non-IR patients. IR, insulin, resistance.

Table V

Demographic and clinical characteristics of controls, PCOS non-IR patients and PCOS IR patients for PCR analysis.

Table V

Demographic and clinical characteristics of controls, PCOS non-IR patients and PCOS IR patients for PCR analysis.

VariableControl group (n=5)PCOS non-IR group (n=3)PCOS IR group (n=4)F-valueP-value
Age (years)27.000±2.12130.000±5.65728.400±4.8790.4250.666
FSH (mIU/ml)5.438±0.5145.705±0.0925.092±0.3301.8660.210
LH (mIU/ml)4.196±0.6416.560±0.750a3.220±1.343b7.6150.012
PRL (ng/ml)14.988±2.29617.260±1.48521.076±5.2003.2060.089
E2 (pg/ml)29.200±8.044 50.000±4.243a 26.000±6.671b8.5280.008
T (ng/ml)0.268±0.0400.450±0.2120.232±0.0933.6510.069
FBG (mmol/l)5.200±0.1585.200±0.0005.540±0.2883.5120.075
FINS (mIU/l)5.980±0.8587.500±1.980 12.160±1.689a,b24.516 <0.001
HOMA-IR1.380±0.1911.733±0.4582.999±0.490a,b23.613 <0.001
Height (m)1.584±0.0541.635±0.0071.596±0.0550.7090.517
Body weight (kg)54.000±8.60261.000±7.071 74.000±8.185a7.4390.012
BMI21.467±2.70422.808±2.448 28.962±1.425a,b15.5810.001
Number of antral follicles (L)6.800±1.304 23.000±9.899a 21.200±5.070a14.1630.002
Number of antral follicles (R)7.800±1.30425.500±0.707 25.800±3.493a75.092 <0.001

{ label (or @symbol) needed for fn[@id='tfn5-ijmm-40-05-1385'] } ANOVA is applied to analyze the differences between 3 groups, followed by pairwise comparison using least significant difference test. P-values marked in bold are <0.05.

a P<0.05 compared to the control group;

b P<0.05 compared to the PCOS non-IR group. PCOS, polycystic ovary syndrome; FSH, follicle-stimulating hormone; LH, luteinizing hormone; PRL, prolactin; E2, estradiol; T, thyroid; FBG, fasting blood glucose; FINS, fasting plasma insulin; HOMA-IR, homeostasis model assessment of insulin resistance; BMI, body mass index.

Discussion

PCOS is a complex disease characterized by variable clinical features. It is largely ascribed to hormone imbalance and results in a heavy health and economic burden. The present study identified a list of genes and pathways that may be involved in the pathogenesis of PCOS by a series of microarray analyses. A total of 674 DEGs were screened between PCOS and control samples. Pathway enrichment analysis revealed significant enrichment of 41 pathways with the DEGs. These pathways were predominately related to immune and inflammation. In line with the finding, it has been reported that inflammation is enhanced, and production of interleukins and chemokines is increased in PCOS (29,30). Our result confirms the crucial role of inflammation and immune in the development of PCOS.

In the present study, 8 highly connected network modules were extracted from the Reactome FI network. Among these network modules, module 3 had the highest module signifi-cance. LYN was the hub gene of module 3. Notably, microarray analysis revealed that LYN was an upregulated DEG in PCOS, which was in accordance with the result of RT-PCR. LYN encodes tyrosine-protein Lyn which is a member of the src family tyrosine kinase. There is in vivo evidence that Src family kinases are essential for generation of the inflammatory environment (31). Furthermore, research has established that Lyn plays both a positive and a negative regulatory role in neutrophils and macrophages (32). Lyn plays a prominent role in the activation of innate immune response mediated by nuclear factor-κB in human mononuclear cells (33). These findings suggest that Lyn is closely related to inflammation and immune response. In the present study, pathway analysis for module 3 revealed that LYN was significantly enriched in the Inflammation and immune-related TXA2 receptor signaling, Chemokine signaling, and CXCR4-mediated signaling events pathways, which was in concordance with previous findings. Dysregulated LYN may participate in PCOS-related inflammation and immune response. Furthermore, inflammation is an important mechanism underlying insulin resistance (34), which is prevalent in PCOS patients (35). By using RT-PCR, the study found that LYN expression was significantly increased in PCOS IR patients compared with PCOS non-IR patients. This indicates that upregulated LYN may be associated with PCOS-related insulin resistance as well.

Pathway enrichment analysis revealed that module 0 was significantly associated with Regulation of RhoA activity, Signaling by Rho GTPases and RhoA signaling pathways. RhoA is a member of Rho family of GTPases involved in regulating intracellular actin dynamics (36). It has been demonstrated that RhoA participates in regulating secretion of insulin (37), and is associated with insulin resistance via phosphorylation of insulin receptor substrate-1 (38). Moreover, it also mediates adrenocorticotropin-stimulated cortisol biosynthesis in human adrenocortical cells (39). These observations indicate that Regulation of RhoA activity, Signaling by Rho GTPases and RhoA signaling pathways may be associated with PCOS-related hormone imbalance, in particular insulin resistance. Furthermore, the present study also found that Regulation of RhoA activity and Signaling by Rho GTPases pathways shared 2 DEGs: ARHGAP4 and ARHGAP9. They are two members of the Rho-GAP family of GTPase activating proteins participating in the regulation of the function of Rho GTPases (40). Moreover, results of the microarray analysis and RT-PCR reached an agreement that ARHGAP4 and ARHGAP9 were significantly upregulated in PCOS. It has been speculated that dysregulated ARHGAP4 and ARHGAP9 may play a role in PCOS-related hormone imbalance, particular insulin resistance, by regulating Regulation of RhoA activity and Signaling by Rho GTPases pathways. Consistently, the study found that expression of ARHGAP4 and ARHGAP9 were markedly increased in PCOS IR patients relative to PCOS non-IR patients by using RT-PCR.

RhoG encoded by gene RHOG is a small G protein and belongs to the Rac subfamily of the Rho family. Recently, it has been reported that RhoG protein may be implicated in glycoprotein VI-Fc receptor γ-chain complex-mediated platelet activation (41). In agreement with the finding, the study found that RHOG in module 0 was significantly enriched in the GP VI-mediated activation cascade pathway. Furthermore, it has been established that impaired platelet function plays a part in the pathogenesis of PCOS (42). These observations indicate that RHOG and GP VI-mediated activation cascade pathway may be implicated in PCOS-related platelet dysfunction. Moreover, the study found an obviously increased expression of RHOG in PCOS IR patients relative to PCOS non-IR patients. Platelets are important players in inflammation (43), which is a critical mechanism of insulin resistance. Upregulated RHOG may play a role in insulin resistance by affecting platelet dysfunction.

The study found that ACTB and MYH9 in module 1 were upregulated DEGs in PCOS, and significantly related to the Regulation of actin cytoskeleton and Tight junction pathways. These pathways and genes are related to cytoskeleton formation. However, RT-PCR measurement of the two genes revealed that the differences in mRNA expression of ACTB and MYH9 did not reach significance between PCOS and normal samples. This suggests that results of the two genes may be false-positive results of the microarray data analysis. Nevertheless, the abnormal expression of cytoskeletal proteins has been reported in PCOS (44,45). Therefore, more studies are needed to clarify the role of ACTB and MYH9 in PCOS.

HLA genes encode antigen-presenting proteins located on the cell surface in the human body. There is evidence that possession of HLA-DQA1*0501, HLA-A11 and HLA-DRB1*0403 are risk factors of PCOS (46,47). This study also found that the HLA genes were closely associated with PCOS, as evidenced by the fact that a group of HLA genes (HLA-DQB1, HLA-DPA1, HLA-DMA, HLA-DQA1 and HLA-DRA) were included in module 6 and enriched in MHC class II antigen presentation pathway. Moreover, serum HLA-G in women with PCOS has been reported to be associated with oxidative stress, ovarian hyperandrogenism and insulin resistance (48). It is speculated that HLA-DQB1, HLA-DPA1, HLA-DMA, HLA-DQA1 and HLA-DRA may play a role in PCOS-related oxidative stress, ovarian hyperandrogenism and insulin resistance by affecting the MHC class II antigen presentation pathway. In the present study, genes in module 7 were linked to Toll-like receptor-related pathways. Toll-like receptors are important participants of the immune system. Toll-like receptor 3 affects β-cell insulin secretion and glucose homeostasis (49), and activation of Toll-like receptor signaling pathways aid in inducing insulin resistance (50). These findings lead to a speculation that Toll-like receptor signaling pathways are possibly implicated in PCOS-related insulin resistance and immune abnormality.

The study has some limitations. Firstly, its sample size is small. Follicular fluid samples are not easy to collect and many patients may not agree with the study. Secondly, the microarray dataset GSE34526 did not provide clear information on whether the PCOS samples in the dataset were resistant to insulin or not, thus differentially expressed genes between PCOS IR and the PCOS non-IR samples were not distinguished. Thirdly, it is necessary to validate the results of microarray data analysis using experimental methods. In this preliminary study, expression of 6 DEGs in granulosa cell samples of PCOS patients and normal controls were measured using RT-PCR. Further studies with more experiments, such as western blotting, and a large cohort of samples are in process to verify and extend the findings of the present study.

In conclusion, the present study confirmed the important role of inflammation and immune in PCOS. The Regulation of RhoA activity, Signaling by Rho GTPases, and GP VI-mediated activation cascade pathways may be associated with PCOS-related hormone imbalance and platelet dysfunction. LYN, ARHGAP4, ARHGAP9 and RHOG are promising candidate genes in PCOS, and may be recommended as possible therapeutic targets for PCOS. Further experimental studies are warranted to verify the results of the present study.

Acknowledgments

The present study was supported by the Shanghai Municipal Commission of Health and Family Planning (grant no. 201540214), and accomplished in Shanghai Key Laboratory of Female Reproductive Endocrine-Related Diseases.

References

1 

Teede H, Deeks A and Moran L: Polycystic ovary syndrome: A complex condition with psychological, reproductive and metabolic manifestations that impacts on health across the lifespan. BMC Med. 8:412010. View Article : Google Scholar : PubMed/NCBI

2 

Kar P and Cummings M: Polycystic ovary syndrome. Pract Diabetes Int. 22:256–260. 2005. View Article : Google Scholar

3 

Naderpoor N, Shorakae S, Joham A, Boyle J, De Courten B and Teede HJ: Obesity and polycystic ovary syndrome. Minerva Endocrinol. 40:37–51. 2015.

4 

Tehrani FR, Simbar M, Tohidi M, Hosseinpanah F and Azizi F: The prevalence of polycystic ovary syndrome in a community sample of Iranian population: Iranian PCOS prevalence study. Reprod Biol Endocrinol. 9:392011. View Article : Google Scholar : PubMed/NCBI

5 

Palioura E and Diamanti-Kandarakis E: Industrial endocrine disruptors and polycystic ovary syndrome. J Endocrinol Invest. 36:1105–1111. 2013. View Article : Google Scholar

6 

Wang F, Zhang Z and Wang Z, Xiao K, Wang Q, Su J and Wang Z: Expression and clinical significance of the HIF-1α/ET-2 signaling pathway during the development and treatment of polycystic ovary syndrome. J Mol Histol. 46:173–181. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Ding CF, Chen WQ, Zhu YT, Bo YL, Hu HM and Zheng RH: Circulating microRNAs in patients with polycystic ovary syndrome. Hum Fertil (Camb). 18:22–29. 2015. View Article : Google Scholar

8 

Xu B, Zhang YW, Tong XH and Liu YS: Characterization of microRNA profile in human cumulus granulosa cells: Identification of microRNAs that regulate Notch signaling and are associated with PCOS. Mol Cell Endocrinol. 404:26–36. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Kaur S, Archer KJ, Devi MG, Kriplani A, Strauss JF III and Singh R: Differential gene expression in granulosa cells from polycystic ovary syndrome patients with and without insulin resistance: Identification of susceptibility gene sets through network analysis. J Clin Endocrinol Metab. 97:E2016–E2021. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Liu HY, Liu JQ, Mai ZX and Zeng YT: A subpathway-based method of drug reposition for polycystic ovary syndrome. Reprod Sci. 22:423–430. 2015. View Article : Google Scholar

11 

Liu HY, Huang YL, Liu JQ and Huang Q: Transcription factor microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome. Mol Med Rep. 13:3920–3928. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Bohler A, Wu G, Kutmon M, Pradhana LA, Coort SL, Hanspers K, Haw R, Pico AR and Evelo CT: Reactome from a WikiPathways perspective. PLoS Comput Biol. 12:e10049412016. View Article : Google Scholar : PubMed/NCBI

13 

Wu G, Dawson E, Duong A, Haw R and Stein L: ReactomeFIViz: A Cytoscape app for pathway and network-based data analysis. F1000Res. 3:1462014.PubMed/NCBI

14 

Edgar R, Domrachev M and Lash AE: Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 30:207–210. 2002. View Article : Google Scholar :

15 

Mitra PS, Ghosh S, Zang S, Sonneborn D, Hertz-Picciotto I, Trnovec T, Palkovicova L, Sovcikova E, Ghimbovschi S, Hoffman EP, et al: Analysis of the toxicogenomic effects of exposure to persistent organic pollutants (POPs) in Slovakian girls: Correlations between gene expression and disease risk. Environ Int. 39:188–199. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Gautier L, Cope L, Bolstad BM and Irizarry RA: affy - analysis of Affymetrix GeneChip data at the probe level. Bioinformatics. 20:307–315. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, et al: Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 5:R802004. View Article : Google Scholar : PubMed/NCBI

18 

Liu J, Yang XY and Shi WJ: Identifying differentially expressed genes and pathways in two types of non-small cell lung cancer: Adenocarcinoma and squamous cell carcinoma. Genet Mol Res. 13:95–102. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Szekely GJ and Rizzo ML: Hierarchical clustering via joint between-within distances: Extending Ward's minimum variance method. J Classif. 22:151–183. 2005. View Article : Google Scholar

20 

Bindea G, Mlecnik B, Hackl H, Charoentong P, Tosolini M, Kirilovsky A, Fridman WH, Pagès F, Trajanoski Z and Galon J: ClueGO: A Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics. 25:1091–1093. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Bindea G, Galon J and Mlecnik B: CluePedia Cytoscape plugin: Pathway insights using integrated experimental and in silico data. Bioinformatics. 29:661–663. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Thissen D and Kuang D: Quick and easy implementation of the Benjamini-Hochberg procedure for controlling the false positive rate in multiple comparisons. J Educ Behav Stat. 27:77–83. 2002. View Article : Google Scholar

23 

Luo W and Brouwer C: Pathview: An R/Bioconductor package for pathway-based data integration and visualization. Bioinformatics. 29:1830–1831. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Barabási AL, Gulbahce N and Loscalzo J: Network medicine: A network-based approach to human disease. Nat Rev Genet. 12:56–68. 2011. View Article : Google Scholar :

25 

Guzzi PH and Mina M: AlignMCL: Comparative analysis of protein interaction networks through Markov clustering. IEEE International Conference on Bioinformatics and Biomedicine Workshops. 174–181. 2012.

26 

Joshi-Tope G, Gillespie M, Vastrik I, D'Eustachio P, Schmidt E, de Bono B, Jassal B, Gopinath GR, Wu GR, Matthews L, et al: Reactome: A knowledgebase of biological pathways. Nucleic Acids Res. 33:D428–D432. 2005. View Article : Google Scholar :

27 

Schaefer CF, Anthony K, Krupa S, Buchoff J, Day M, Hannay T and Buetow KH: PID: The pathway interaction database. Nucleic Acids Res. 37:D674–D679. 2009. View Article : Google Scholar :

28 

Mi H and Thomas P: PANTHER pathway: An ontology-based pathway database coupled with data analysis tools. Methods Mol Biol. 563:123–140. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Glintborg D and Andersen M: An update on the pathogenesis, inflammation, and metabolism in hirsutism and polycystic ovary syndrome. Gynecol Endocrinol. 26:281–296. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Ojeda-Ojeda M, Murri M, Insenser M and Escobar-Morreale HF: Mediators of low-grade chronic inflammation in polycystic ovary syndrome (PCOS). Curr Pharm Des. 19:5775–5791. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Kovács M, Németh T, Jakus Z, Sitaru C, Simon E, Futosi K, Botz B, Helyes Z, Lowell CA and Mócsai A: The Src family kinases Hck, Fgr, and Lyn are critical for the generation of the in vivo inflammatory environment without a direct role in leukocyte recruitment. J Exp Med. 211:1993–2011. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Scapini P, Pereira S, Zhang H and Lowell CA: Multiple roles of Lyn kinase in myeloid cell signaling and function. Immunol Rev. 228:23–40. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Toubiana J, Rossi AL, Belaidouni N, Grimaldi D, Pene F, Chafey P, Comba B, Camoin L, Bismuth G, Claessens YE, et al: Src-family-tyrosine kinase Lyn is critical for TLR2-mediated NF-κB activation through the PI 3-kinase signaling pathway. Innate Immun. 21:685–697. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Wieser V, Moschen AR and Tilg H: Inflammation, cytokines and insulin resistance: A clinical perspective. Arch Immunol Ther Exp (Warsz). 61:119–125. 2013. View Article : Google Scholar

35 

DeUgarte CM, Bartolucci AA and Azziz R: Prevalence of insulin resistance in the polycystic ovary syndrome using the homeostasis model assessment. Fertil Steril. 83:1454–1460. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Stankiewicz TR and Linseman DA: Rho family GTPases: Key players in neuronal development, neuronal survival, and neurodegeneration. Front Cell Neurosci. 8:3142014. View Article : Google Scholar : PubMed/NCBI

37 

Liu X, Yan F, Yao H, Chang M, Qin J, Li Y, Wang Y and Pei X: Involvement of RhoA/ROCK in insulin secretion of pancreatic β-cells in 3D culture. Cell Tissue Res. 358:359–369. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Kanda T, Wakino S, Homma K, Yoshioka K, Tatematsu S, Hasegawa K, Takamatsu I, Sugano N, Hayashi K and Saruta T: Rho-kinase as a molecular target for insulin resistance and hypertension. FASEB J. 20:169–171. 2006.

39 

Sewer MB and Li D: Regulation of adrenocortical steroid hormone production by RhoA-diaphanous 1 signaling and the cytoskeleton. Mol Cell Endocrinol. 371:79–86. 2013. View Article : Google Scholar

40 

Vogt DL, Gray CD, Young WS III, Orellana SA and Malouf AT: ARHGAP4 is a novel RhoGAP that mediates inhibition of cell motility and axon outgrowth. Mol Cell Neurosci. 36:332–342. 2007. View Article : Google Scholar : PubMed/NCBI

41 

Kim S, Dangelmaier C, Bhavanasi D, Meng S, Wang H, Goldfinger LE and Kunapuli SP: RhoG protein regulates glycoprotein VI-Fc receptor γ-chain complex-mediated platelet activation and thrombus formation. J Biol Chem. 288:34230–34238. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Rajendran S, Willoughby SR, Chan WPA, Liberts EA, Heresztyn T, Saha M, Marber MS, Norman RJ and Horowitz JD: Polycystic ovary syndrome is associated with severe platelet and endothelial dysfunction in both obese and lean subjects. Atherosclerosis. 204:509–514. 2009. View Article : Google Scholar

43 

Stokes KY and Granger DN: Platelets: A critical link between inflammation and microvascular dysfunction. J Physiol. 590:1023–1034. 2012. View Article : Google Scholar :

44 

Salvetti NR, Gimeno EJ, Lorente JA and Ortega HH: Expression of cytoskeletal proteins in the follicular wall of induced ovarian cysts. Cells Tissues Organs. 178:117–125. 2004. View Article : Google Scholar : PubMed/NCBI

45 

Cortón M, Botella-Carretero JI, Benguría A, Villuendas G, Zaballos A, San Millán JL, Escobar-Morreale HF and Peral B: Differential gene expression profile in omental adipose tissue in women with polycystic ovary syndrome. J Clin Endocrinol Metab. 92:328–337. 2007. View Article : Google Scholar

46 

Ober C, Weil S, Steck T, Billstrand C, Levrant S and Barnes R: Increased risk for polycystic ovary syndrome associated with human leukocyte antigen DQA1*0501. Am J Obstet Gynecol. 167:1803–1806. 1992. View Article : Google Scholar : PubMed/NCBI

47 

Kaibe M, Takakuwa K, Murakawa H, Ishii K, Tamura M and Tanaka K: Studies on the human leukocyte antigens in patients with polycystic ovary syndrome in a Japanese population - possible susceptibility of HLA-A11 and -DRB1*0403 to patient population with polycystic ovary syndrome. Am J Reprod Immunol. 55:301–306. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Ozteki O, Fenkci SM, Fenkci V, Enli Y and Cabus U: Serum HLA-G levels in women with polycystic ovary syndrome. Gynecol Endocrinol. 31:243–246. 2015. View Article : Google Scholar

49 

Strodthoff D, Ma Z, Wirström T, Strawbridge RJ, Ketelhuth DF, Engel D, Clarke R, Falkmer S, Hamsten A, Hansson GK, et al: Toll-like receptor 3 influences glucose homeostasis and β-cell Insulin Secretion. Diabetes. 64:3425–3438. 2015. View Article : Google Scholar : PubMed/NCBI

50 

Hemmati F, Ghasemi R, Mohamed Ibrahim N, Dargahi L, Mohamed Z, Raymond AA and Ahmadiani A: Crosstalk between insulin and Toll-like receptor signaling pathways in the central nervous system. Mol Neurobiol. 50:797–810. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Shen H, Liang Z, Zheng S and Li X: Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome. Int J Mol Med 40: 1385-1396, 2017.
APA
Shen, H., Liang, Z., Zheng, S., & Li, X. (2017). Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome. International Journal of Molecular Medicine, 40, 1385-1396. https://doi.org/10.3892/ijmm.2017.3146
MLA
Shen, H., Liang, Z., Zheng, S., Li, X."Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome". International Journal of Molecular Medicine 40.5 (2017): 1385-1396.
Chicago
Shen, H., Liang, Z., Zheng, S., Li, X."Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome". International Journal of Molecular Medicine 40, no. 5 (2017): 1385-1396. https://doi.org/10.3892/ijmm.2017.3146
Copy and paste a formatted citation
x
Spandidos Publications style
Shen H, Liang Z, Zheng S and Li X: Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome. Int J Mol Med 40: 1385-1396, 2017.
APA
Shen, H., Liang, Z., Zheng, S., & Li, X. (2017). Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome. International Journal of Molecular Medicine, 40, 1385-1396. https://doi.org/10.3892/ijmm.2017.3146
MLA
Shen, H., Liang, Z., Zheng, S., Li, X."Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome". International Journal of Molecular Medicine 40.5 (2017): 1385-1396.
Chicago
Shen, H., Liang, Z., Zheng, S., Li, X."Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome". International Journal of Molecular Medicine 40, no. 5 (2017): 1385-1396. https://doi.org/10.3892/ijmm.2017.3146
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team