Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
May-2018 Volume 41 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2018 Volume 41 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

microRNA expression profiles of scar and normal tissue from patients with posterior urethral stricture caused by pelvic fracture urethral distraction defects

  • Authors:
    • Kaile Zhang
    • Jun Chen
    • Dongliang Zhang
    • Lin Wang
    • Weixin Zhao
    • David Yun-Te Lin
    • Rong Chen
    • Hong Xie
    • Xiaoyong Hu
    • Xiaolan Fang
    • Qiang Fu
  • View Affiliations / Copyright

    Affiliations: Department of Urology, Affiliated Sixth People's Hospital, Shanghai JiaoTong University, Shanghai 200233, P.R. China, Wake Forest Institute for Regenerative Medicine, Winston‑Salem, NC 27157, USA, New York Genome Center, New York, NY 10013, USA
    Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2733-2743
    |
    Published online on: February 12, 2018
       https://doi.org/10.3892/ijmm.2018.3487
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Pelvic fracture urethral distraction defect (PFUDD) seriously affects the quality of life of patients. At present, there are few effective drug treatments available for PFUDD‑induced urethral stricture, which is associated with fibrosis and scar formation in urethra lumen. Emerging evidence suggests that microRNAs (miRNAs/miRs) may be involved in the regulation of fibrosis, and analysis of miRNA expression profiles in urethral scar and normal urethra tissues may therefore benefit the discovery of novel treatments for urethral stricture with micro invasive procedures. In the present study, miRNA sequencing and quantitative polymerase chain reaction (qPCR) validation using paired scar and normal tissues from patients with PFUDD, and functional analysis of the miRNAs involved in the fibrosis associated signaling pathway was performed. A total of 94 differentially expressed miRNAs were identified in the scar tissue of patients with PFUDD. Among them, 26 miRNAs had significantly altered expression in the scar tissue compared with the normal tissue from the same patient. qPCR validation confirmed that miR‑129‑5p was overexpressed in scar tissue. The TGF‑β pathway‑associated functions of a total of 5 miRNAs (hsa‑miR‑129‑5p, hsa‑miR‑135a‑5p, hsa‑miR‑363‑3p, hsa‑miR‑6720‑3p and hsa‑miR‑9‑5p) were further analyzed, as well as their key molecular targets and functional mechanisms in signaling regulation. To conclude the miRNA sequencing indicated a significantly altered expression of hsa‑miR‑129‑5p, hsa‑miR‑135a‑5p, hsa‑miR‑363‑3p, hsa‑miR‑6720‑3p and hsa‑miR‑9‑5p in patients with PFUDD. These miRNAs and their potential target genes were associated with fibrosis in several diseases, and the data from the present study may help explore potential miRNA targets for future precision treatments for urethral stricture.

Introduction

Pelvic fracture urethral distraction defect (PFUDD) seriously affects voiding function and the quality of life of patients (1). Urethral defects are healed by fibroblasts, but overexpression of extracellular matrix (ECM) components in the resultant scar tissue may cause a reduction or complete blockage in the urethral caliber and impairment of the flow of urine (2). Open urethroplasty of urethral strictures is performed worldwide and has become the gold standard for the treatment of urethral strictures. However, this surgery is often performed in high-volume urethral referral centers, and only surgeons with multiple years of training are able to obtain high (~95%) success rates (3). Overall, the success rate of urethral reconstructive surgeries remains relatively low globally (short-term 79–88%, long term 42–86%) (4,5). Reconstructive surgery may also result in serious morbidity at the defect location and the donor site, including infection, nerve injury and difficulties in opening the mouth (2,6). To minimize side-effects and complications, micro invasive surgeries [for example, direct visual internal urethrotomy (DVIU)] has been used to treat posterior urethral stricture caused by PFUDD. DVIU is commonly performed in patients with urethral stricture and remains the first choice in secondary centers with limited equipment or those that lack experienced surgeons. However, high recurrence and poor long-term curative rates have been associated with this technique, and its effectiveness remains questionable among urologists (7,8). Thus, there is an urgent need for novel techniques and complementary strategies to prevent fibrosis and scar formation in patients following surgery. Although the local injection and dilution of steroids and other anti-fibrosis reagents were introduced as an adjuvant treatment for DVIU, a previous systematic review and meta-analysis by our group has demonstrated that these drugs are not efficient or effective enough to decrease the recurrence rate (7).

Gene therapy has emerged as a promising treatment option for a number of diseases. Accumulating evidence indicates that microRNAs (miRNAs/miRs) are involved in multiple disease processes, including the pathogenesis of fibrosis in the skin and liver (9). Our goal is to add to the information regarding miRNA dysregulation in urethral fibrosis to broaden our understanding of the underlying pathological mechanisms and discover novel treatment targets. By conducting miRNA sequencing, temporal miRNA expression profiles were generated in urethral scar and normal urethral tissues, and potential gene targets and pathways involved in fibrosis were identified in patients suffering from PFUDD. This established miRNA profile may provide further insight into the involvement of miRNAs and their functions in the development and progression of pathological conditions.

Materials and methods

Urethral scar samples

All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional research committee and in accordance with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. The present study was approved by the Ethics Committee of Shanghai Sixth People's Hospital (Shanghai, China). Informed consent was obtained from all patients. Scar and normal urethral tissues were collected from patients with urethral stricture undergoing urethroplasty (n=5). All subjects were male with an age range of 16–59 years. Baseline patient information is summarized in Table I.

Table I

Baseline patient characteristics.

Table I

Baseline patient characteristics.

Patient numberAgeSexHealth status
159MalePFUDD
250MalePFUDD
316MalePFUDD
443MalePFUDD
544MalePFUDD

[i] PFUDD, pelvic fracture urethral distraction defects.

A total of 3 pairs of samples were used for miRNA sequencing, and 3 pairs were used for quantitative polymerase chain reaction (qPCR) verification (one patient's tissue was used in both miRNA sequencing and qPCR). The etiology of patients with urethral stricture was PFUDD. All the participating patients underwent primary surgery. The mean length of the stricture was 1.5 cm and the locations were all at the membranous segment of the urethra. Samples were harvested following surgery, sectioned and stored at −80°C until the process of RNA extraction.

RNA extraction and miRNA sequencing analysis

Total RNA from each sample (Table II) was used to prepare the miRNA sequencing library, which included the following steps: i) 3′-adaptor ligation; ii) 5′-adaptor ligation; iii) cDNA synthesis; iv) PCR amplification; v) size selection of ~135–155 bp PCR amplified fragments (corresponding to ~15–35 nt small RNAs).

Table II

RNA quality control characteristics for microRNA sequencing samples.

Table II

RNA quality control characteristics for microRNA sequencing samples.

Sample IDaOD260/280 ratioOD260/230 ratioConc. (ng/µl)Volume (µl)Quantity (ng)QC
Normal 11.872.40316.68309500.40Pass
Scar 11.852.38282.524011300.80Pass
Normal 21.862.41182.11203642.20Pass
Scar 21.882.39237.14409485.60Pass
Normal 31.812.40144.77101447.70Pass
Scar 31.882.30267.734010709.20Pass

a In Sample ID, 1, 2 and 3 indicate specific patients (for example, 1 for Patient 1). OD, optical density; QC, quality control.

The TruSeq SR Cluster kit (cat. no. GD-402-4001; Illumina, Inc., San Diego, CA, USA) was used for cluster generation in an Illumina cBOT instrument, following the manufacturer's protocol. Sequencing was performed on an Illumina HiSeq® 2000 instrument (Illumina, Inc.) using a TruSeq Rapid SBS kit (cat. no. FC-402-4002; Illumina, Inc.).

Following sequencing, the Solexa CHASTITY quality filtered reads were harvested as clean reads. Adaptor sequences were trimmed, and the retained reads (≥15 nt) were aligned to merged pre-miRNA databases (known pre-miRNAs from miRBase v21 (10–14) plus the newly predicted pre-miRNAs) using Novoalign software v2.07.11 [(Novocraft Technologies Sdn Bhd, Selangor, Malaysia) maximum mismatch was 1, and low reads (total reads <2) were discarded]. To characterize the isomiR variability, sequences matching each miRNA precursor(s) in the mature miRNA region ±4 nt (≤1 mismatch) were accepted as mature miRNA isomiRs and grouped according to the 5-prime (5p) or 3-prime (3p) arm of the precursor hairpin. The number of mapped tags was defined as the raw expression level of the specific miRNAs. Transcripts per million values were generated based on the total number of aligned tags for normalization. The most abundant isomiR, mature miRNA (annotated in miRBase) and all isoforms of miRNA (5p or 3p) were used for miRNA expression quantification. For comparison of miRNA expression profiles between two groups (scar tissue vs. normal tissue), fold change and P-value were calculated to identify miRNAs with differentiated expression.

Reverse transcription (RT)-qPCR for the validation of miRNAs

A total of 3 pairs of urethral samples were used for qPCR validation of miRNA expression. The primers used for PCR were designed with Primer Premier software (version 5.0; Premier Biosoft International, Palo Alto, CA, USA) (primer sequence details are summarized in Table III). cDNA synthesis was performed on a GeneAmp PCR System 9700 (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) using a RevertAid First Strand cDNA Synthesis kit, cat. no. K1622 (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. qPCR was performed on a ViiA 7 Real-time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) using a PowerUp SYBR Green Master Mix, (cat. no. A25778, Thermo Fisher Scientific, Inc.). qPCR was conducted at: i) 95°C for 10 min, ii) 95°C for 15 sec and iii) 60 sec at >60°C for 40 cycles. The fold change for each miRNA was calculated using the 2−∆∆Cq method (15).

Table III

MicroRNA primers for quantitative real-time PCR.

Table III

MicroRNA primers for quantitative real-time PCR.

Primer namePrimer sequence (5′-3′)
U6-S CTCGCTTCGGCAGCACA
U6-A AACGCTTCACGAATTTGCGT
general control primer-A TGGTGTCGTGGAGTCG
hsa-miR-129-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCAAGCCC
hsa-miR-129-5p-S ACACTCCAGCTGGGCTTTTTGCGGTCTGG
hsa-miR-9-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCATACAG
hsa-miR-9-5p-S ACACTCCAGCTGGGTCTTTGGTTATCTAGCT
hsa-miR-9-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTTTCGG
hsa-miR-9-3p-S ACACTCCAGCTGGGATAAAGCTAGATAACC
hsa-miR-183-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGTGAATT
hsa-miR-183-5p-S ACACTCCAGCTGGGTATGGCACTGGTAGAA
hsa-miR-6720-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCTACCAG
hsa-miR-6720-3p-S ACACTCCAGCTGGGCGCGCCTGCAGGAACT
hsa-miR-96-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCAAAAA
hsa-miR-96-5p-S ACACTCCAGCTGGGTTTGGCACTAGCACATT
hsa-miR-486-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTCGGGGC
hsa-miR-486-5p-S ACACTCCAGCTGGGTCCTGTACTGAGCTGC
hsa-miR-363-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTACAGATG
hsa-miR-363-3p-S ACACTCCAGCTGGGAATTGCACGGTATCCA
hsa-miR-135a-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCACATAG
hsa-miR-135a-5p-S ACACTCCAGCTGGGTATGGCTTTTTATTCCT
hsa-miR-374a-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAATTACAA
hsa-miR-374a-3p-S ACACTCCAGCTGGGCTTATCAGATTGTATT
hsa-miR-374b-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAATGATAA
hsa-miR-374b-3p-S ACACTCCAGCTGGGCTTAGCAGGTTGTATT
hsa-miR-941-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCACATGT
hsa-miR-941-S ACACTCCAGCTGGGCACCCGGCTGTGTGCAC
hsa-miR-3158-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTCCTGCA
hsa-miR-3158-3p-S ACACTCCAGCTGGGAAGGGCTTCCTCTCTG
hsa-miR-29c-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTAACCGAT
hsa-miR-29c-3p-S ACACTCCAGCTGGGTAGCACCATTTGAAAT
hsa-miR-10a-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTATTCCCC
hsa-miR-10a-3p-S ACACTCCAGCTGGGCAAATTCGTATCTAGG
hsa-miR-182-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGTGTGAG
hsa-miR-182-5p-S ACACTCCAGCTGGGTTTGGCAATGGTAGAACT
hsa-miR-106a-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC
hsa-miR-106a-5p-S ACACTCCAGCTGGGAAAAGTGCTTACAGTGC
hsa-miR-4284-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGATGGGGTG
hsa-miR-4284-S ACACTCCAGCTGGGGGGCTCACATCA
has-mir192-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGCTGTCA
has-mir192-5p-S ACACTCCAGCTGGGCTGACCTATGAATTG
hsa-miR-26a-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCCTATC
hsa-miR-26a-5p-S ACACTCCAGCTGGGTTCAAGTAATCCAGGA
hsa-miR-223-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGGGTAT
hsa-miR-223-3p-S ACACTCCAGCTGGGTGTCAGTTTGTCAAAT
hsa-miR-92a-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAGGCCG
hsa-miR-92a-3p-S ACACTCCAGCTGGGTATTGCACTTGTCCCG
hsa-miR-29b-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACACTGA
hsa-miR-29b-3p-S ACACTCCAGCTGGGTAGCACCATTTGAAATC
hsa-miR-125b-5p CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCACAAGT
hsa-miR-125b-5p ACACTCCAGCTGGGTCCCTGAGACCCTAAC
hsa-miR-194-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCACATG
hsa-miR-194-5p-S ACACTCCAGCTGGGTGTAACAGCAACTCCA
hsa-miR-20a-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC
hsa-miR-20a-5p-S ACACTCCAGCTGGGTAAAGTGCTTATAGTGC
hsa-miR-128-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAAGAGAC
hsa-miR-128-3p-S ACACTCCAGCTGGGTCACAGTGAACCGGT
hsa-miR-654-5p-S ACACTCCAGCTGGGTGGTGGGCCGCAGAAC
hsa-miR-654-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCACATGT
hsa-miR-31-3p-S ACACTCCAGCTGGGTGCTATGCCAACATAT
hsa-miR-31-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGATGGCAAT
hsa-miR-329-3p-S ACACTCCAGCTGGGAACACACCTGGTTAAC
hsa-miR-329-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAAGAGGT
hsa-let-7b-3p-S ACACTCCAGCTGGGCTATACAACCTACTGC
hsa-let-7b-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGGAAGGC
hsa-miR-433-3p-S ACACTCCAGCTGGGATCATGATGGGCTCCT
hsa-miR-433-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACACCGAG
hsa-miR-379-3p-S ACACTCCAGCTGGGTATGTAACATGGTCCA
hsa-miR-379-3p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGTTAGTG
hsa-miR-744-5p-S ACACTCCAGCTGGGTGCGGGGCTAGGGCTA
hsa-miR-744-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGCTGTTA
hsa-miR-29c-5p-S ACACTCCAGCTGGGTGACCGATTTCTCCTG
hsa-miR-29c-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAACACCA
Bioinformatics analysis

Hierarchical clustering was performed. miRNA target prediction was performed by TargetScan, miRanda, and microcosm with DAVID Bioinformatics Resources 6.7 (https://david-d.ncifcrf.gov/home) (16–22). Enrichment analysis for Gene Ontology (GO) and Kyoto Encylopedia of Genes and Genomes (KEGG) pathways was performed using the topGO package in R (https://www.bioconductor.org/packages/3.7/bioc/html/topGO.html) (20–22).

Statistical analysis

Comparisons between average fold changes of different miRNAs were performed using Student's t-tests (using the T.TEST function in Microsoft Excel; Microsoft Corporation, Redmond, WA, USA). For analysis based on miRNA sequencing only, the t-tests used a two-tailed distribution and the comparison was paired for expression in normal and scar tissues (n=3; Table IV). For analysis based on both miRNA sequencing and qPCR validation (Table V), the t-tests used a two-tailed distribution and the comparison was paired for expression evaluated by the two methods [miRNA sequencing and qPCR, n=7 (for upregulated miRNAs) and n=15 (for downregulated miRNAs)].

Table IV

miRs with significantly different expression, as identified by miR sequencing.

Table IV

miRs with significantly different expression, as identified by miR sequencing.

A, Upregulated genes
miRFold change (scar/normal)P-valuea
hsa-miR-129-5p3.750.026
hsa-miR-9-5p2.080.003
hsa-miR-374a-3p1.920.039
hsa-miR-374b-3p1.420.008
hsa-miR-128-3p1.190.014

B, Downregulated genes

miRFold change (scar/normal)P-valuea

hsa-miR-26a-5p0.910.004
hsa-miR-9410.900.019
hsa-miR-223-3p0.830.043
hsa-miR-3158-3p0.780.025
hsa-miR-20a-5p0.720.035
hsa-miR-92a-3p0.700.039
hsa-miR-29c-3p0.690.002
hsa-miR-194-5p0.670.000
hsa-miR-125b-5p0.670.005
hsa-miR-29b-3p0.640.008
hsa-miR-192-5p0.630.041
hsa-miR-10a-3p0.620.023
hsa-miR-182-5p0.510.016
hsa-miR-106a-5p0.460.038
hsa-miR-183-5p0.450.013
hsa-miR-6720-3p0.380.038
hsa-miR-96-5p0.330.037
hsa-miR-486-5p0.270.035
hsa-miR-363-3p0.260.014
hsa-miR-135a-5p0.190.004
hsa-miR-42840.170.038

a Scar vs. normal, t-test, paired. miR, microRNA.

Table V

Comparison between miR sequencing and qPCR sequencing.

Table V

Comparison between miR sequencing and qPCR sequencing.

miRAverage change by miR sequencing (scar/normal)Average change by qPCR (scar/normal)
has-miR-129-5p3.752.13
hsa-miR-654-5p2.061.57
hsa-miR-31-3p1.551.08
hsa-miR-433-3p1.422.36
hsa-miR-329-3p1.322.46
hsa-let-7b-3p1.172.71
hsa-miR-379-3p1.172.23
hsa-miR-26a-5p0.911.13
hsa-miR-744-5p0.842.52
hsa-miR-223-3p0.830.54
hsa-miR-20a-5p0.720.98
hsa-miR-92a-3p0.701.12
hsa-miR-29c-3p0.691.74
hsa-miR-125b-5p0.671.70
hsa-miR-29c-5p0.673.01
hsa-miR-192-5p0.632.35
hsa-miR-106a-5p0.461.19
hsa-miR-183-5p0.452.22
hsa-miR-96-5p0.331.77
hsa-miR-486-5p0.271.84
hsa-miR-42840.172.03

[i] miR, microRNA; qPCR, quantitative polymerase chain reaction.

Histological evaluation

Freshly harvested scar and normal tissue were fixed in 4% paraformaldehyde at 4°C for over 24 h, dehydrated and embedded in paraffin following standard protocols by Servicebio, Inc. (Wuhan Servicebio Technology Co., Ltd., Wuhan, Hubei, China). The samples were stored and sectioned at room temperature; 4 µm sections were incubated in a 65°C oven for 2 h and de-paraffinized by washing with xylene and a descending alcohol gradient (100, 100, 85 and 75% for immunohistochemistry staining; 100, 95, 90, 80 and 70% for Masson trichrome staining) prior to staining.

Immunohistochemistry and Masson trichrome staining were performed using mouse-anti-human monoclonal transforming growth factor (TGF)-β1 antibodies (1:200, cat. no. GB11179, Servicebio, Inc., Wuhan Servicebio Technology Co., Ltd.) and Masson trichrome (cat. no. PT003; Shanghai Bogoo Biotechnology. Co., Ltd., Shanghai, China) following the manufacturer's protocols. Secondary antibody staining involved the DAKO REAL EnVision Detection System, Peroxidase/DAB, Rabbit/Mouse (cat. no. K5007; Agilent Technologies, Inc., Santa Clara, CA, USA) and a Masson staining kit (cat. no. G1006; Servicebio, Inc., Wuhan Servicebio Technology Co., Ltd.) according to the manufacturer's protocols.

Results

miRNA expression results based on sequencing data

All sequencing samples were evaluated for RNA quality (Table II) and an miRNA expression profile was generated to identify differentially expressed miRNAs in scar tissues of patients with urethral stricture. Out of the 1,620 human miRNAs that were sequenced, 55 miRNAs were upregulated (fold change >2) and 39 were downregulated (fold change <0.5).

A total of 26 differentially expressed miRNAs were identified, with 5 upregulated and 21 downregulated (P<0.05; Fig. 1). The fold changes and P-values were summarized in Table IV.

Figure 1

Hierarchical clustering of 26 miRs with significant changes in expression (fold change >2 or <0.5; P<0.05) in the urethral scar and normal urethral tissue groups. Red indicates high expression, and green indicates low expression. miR, microRNA.

Valitation of miRNAs with qPCR

qPCR was performed for miRNAs with significant changes based on the miRNA sequencing data (Fig. 2). miRNA upregulation identified by miRNA sequencing was validated by qPCR (P=0.51; paired t-test comparisons; n=7), while miRNA downregulation identified by miRNA sequencing was quite different from the data generated by qPCR (P<0.01; paired t-test comparisons; n=15; Table V). Among these, hsa-miR-129-5p was overexpressed in scar tissue compared with normal tissue, although the difference was not significant. Hsa-miR-223-3p and hsa-miR-20a-5p expression was slightly decreased in scar tissues compared with normal tissues. Hsa-miR-26a-5p, hsa-miR-92a-3p, hsa-miR-29c-3p and hsa-miR-125b-5p demonstrated slight changes in expression, but showed opposite regulation patterns as validated by qPCR. Given the fact that sample size was small and the materials harvested were limited in the present study, it was not possible to generate certain conclusions or rule out the possibility of sample variety in this case. Further functional validation will be required to confirm the involvement of these candidate miRNAs in fibrosis, scar formation and PFUDD.

Figure 2

Validation of sequencing data by real time quantitative polymerase chain reaction. Triplicate assays were performed for each RNA sample. Red indicates high expression, and green indicates low expression. miR, microRNA.

GO and KEGG pathway analysis

The predicted biological processes, molecular function, cellular components and KEGG pathways associated with miR-129-5p, miR-9-5p, miR-6720-3p, miR-363-3p and miR-135a-5p were analyzed (Figs. 3Figure 4Figure 5Figure 6–7). As expected, these miRNAs were predicted to be most frequently involved in 'regulation of transcription' and 'RNA metabolic process'. miR-129-5p, miR-9-5p and miR-135a-5p were predicted to function in ion binding, while miR-6720-3p in both ion binding and DNA binding. miR-363-3p was the only miRNA predicted to molecularly regulate transcription and protein kinase activity. Cellular component analysis suggested that miR-129-5p, miR-9-5p and miR-135a-5p were associated with 'plasma membrane', miR-6720-3p in 'membrane-enclosed lumen', and miR-363-3p in 'non-membrane bounded organelles'. KEGG pathway analysis indicated that four miRNAs (miR-129-5p, miR-9-5p, miR-6720-3p and miR-135a-5p) may regulate pathways in cancer.

Figure 3

Biological process, molecular function, cellular component and Kyoto Encyclopedia of Genes and Genomes pathways of microRNA-129-5p. MAPK, mitogen-activated protein kinase.

Figure 4

Biological process, molecular function, cellular component and Kyoto Encyclopedia of Genes and Genomes pathways of microRNA-9-5p. MAPK, mitogen-activated protein kinase.

Figure 5

Biological process, molecular function, cellular component and Kyoto Encyclopedia of Genes and Genomes pathways of microRNA-6720-3p.

Figure 6

Biological process, molecular function, cellular component and Kyoto Encyclopedia of Genes and Genomes pathways of microRNA-363-3p.

Figure 7

Biological process, molecular function, cellular component and Kyoto Encyclopedia of Genes and Genomes pathways of microRNA-135a-5p. MAPK, mitogen-activated protein kinase; Jak-STAT, Janus kinase-signal transducer and activator of transcription.

TGF-β and collagen are upregulated in urethral scar tissue, but not normal tissue

TGF-β signaling has been confirmed to be involved in fibrosis. To investigate whether TGF-β signaling was affected in scar tissues, immunostaining for TGF-β1 protein was performed. As expected, TGF-β1 expression was increased in urethral scar tissues compared with normal tissues from the same patient (Fig. 8A and B). Similarly, dense collagen distribution and irregular fiber alignment was observed in urethral scar tissues, but not in normal tissue (Fig. 8C and D).

Figure 8

TGF-β1 and collagen are overexpressed in urethral scar tissues compared with normal tissues. Anti-TGF-β1 (brown) immunostating in (A) urethral scar tissue or (B) normal urethral tissue. Masson trichrome staining in (C) urethral scar tissue or in (D) normal urethral tissue. Collagen (blue), muscle fiber (red), cytoplasm (light red/pink) were labeled with their corresponding colors. Scale bar, 100 µm. TGF-β1, transforming growth factor-β1.

Discussion

miR-129-5p potentially regulates 17 genes that are directly associated with TGF-β pathway members (Fig. 9), indicating that it may serve an important function in fibrosis through the regulation of TGF-β signalling. miR-129-5p has previously been reported to be significantly downregulated following TGF-β1 treatment in kidney proximal tubular cells (23). In addition, miR-129-5p is downregulated in fibroblasts in systemic sclerosis (or scleroderma, an acquired disorder that typically results in fibrosis of the skin and internal organs), and upregulated miR-129-5p (induced by interleukin-17A) suppresses α1 collagen protein expression levels in normal fibroblasts (24). The present study suggested that miR-129-5p is upregulated in scar tissues from patients with PFUDD compared with normal tissues, and further analysis is required to assess whether the downstream targets in TGF-β pathway are functionally affected, and whether miR-129-5p regulation is driving the fibrosis or results from fibrosis as a feedback effect.

Figure 9

Crosstalk between miRNAs and target genes associated with TGF-β1 regulated fibrosis. MiRNAs and genes that are 'hotspots' (interacting with multiple targets or predicted interacting partners) are in bold. miRNAs/miRs, microRNAs; TGF-β1, transforming growth factor-β1.

Besides its fibrosis-associated functions, miR-129-5p has also been reported as a regulator of epithelial-to-mesenchymal transition (EMT) in epithelial cells (23). miR-129-5p is significantly downregulated in various types of cancer, including lung cancer, breast cancer, gastric cancer and glioblastoma, and over-expression of miR-129-5R suppresses cell viability, proliferation, migration and invasion, while promoting cell apoptosis (25–28). miR-129-5p has also been demonstrated to negatively regulate a specific circular RNA (hsa-circ-0005986) and Notch1, and downregulated hsa-circ-0005986 may promote the proliferation of hepatocellular carcinoma cells (29). Investigation of miR-129-5p and its potential targets through TGF-β-independent regulations in PFUDD may prove interesting.

miR-9-5p expression is increased in lung tissues from patients with idiopathic pulmonary fibrosis and in the lungs of mice with bleomycin-induced lung fibrosis (30). Overexpression of miR-9-5p inhibits TGF-β1-induced lung fibrosis, and inhibition of miR-9-5p amplifies the transformation of human lung fibroblasts into myofibroblasts (30). Overexpression of hsa-miR-9-5p may prevent fibrogenesis in skin fibrosis, mediated by suppressing TGF-β signaling, and inhibition of miR-9-5p results in increased expression of fibrosis markers (31). Hsa-miR-9-5p is upregulated in TGF-β1-treated human dermal fibroblasts (31). Overexpression of miR-9-5p significantly delays TGF-β-dependent transformation of dermal fibroblasts, decreases the expression of the ECM proteins collagen, type I, α1 and fibronectin, the amount of secreted collagen proteins and the expression of the archetypal myofibroblast marker α-smooth muscle actin (31). In contrast to this, specific inhibition of miR-9-5p resulted in enhanced presence of fibrosis markers (31). The upregulation of hsa-miR-9-5p observed in the present study may have been an induced auto-suppression effect of fibrosis, and an analysis with larger cohort and further validation may be helpful to understand its function during the process.

Little is known about the involvement of miR-363-3p, miR-135a-5p or miR-6720-3p in fibrosis regulation. The majority of the research concerning these three miRNAs focuses on their function in carcinogenesis. For example, miR-363-3p is downregulated in tissues from patients with non-small cell lung cancer and gallbladder cancer, and in cluster of differentiation 133-positive cancer stem-like cells isolated from patients with larynx cancer (32–34). miR-363-3p significantly inhibits cell growth in vitro and in vivo in lung cancer cells, and induces cell cycle arrest and promote cell apoptosis, potentially through proliferating cell nuclear antigen and its ability to inhibit the activation of the mechanistic target of rapamycin and extracellular signal-regulated kinase (ERK) signaling pathways (33,35). In patients with prostate cancer, miR-363-3p expression was decreased in serum and its level was negatively correlated with risk of recurrence and progression, suggesting that it may serve as a potential diagnostic and prognostic biomarker for prostate cancer (36). Similarly, in colorectal cancer, miR-363-3p was downregulated in the tissues of patients, and its expression was negatively associated with metastatic status (37). miR-363-3p inhibits colorectal cancer cell migration and invasion and inhibits EMT, potentially through targeting SRY-box 4 (37). Inhibition of miR-363-3p induces cell cycle arrest and suppresses apoptosis in gallbladder cancer cells, potentially by targeting and competing with the long non-coding RNA metastasis associated lung adenocarcinoma transcript 1 in the regulation of the MCL1, BCL2 family apoptosis regulator gene (34).

miR-135a-5p is upregulated in liver biopsy samples from patients with chronic hepatitis C or hepatitis C virus (HCV), but is not induced by anti-viral response to HCV infection (38). By targeting and inducing silencing of protein tyrosine phosphatase receptor δ, a tumor suppressor, miR-135a-5p may potentially drive HCV-associated hepatocarcinogenesis (38).

miR-6720 has been reported to be upregulated in hepatocellular carcinoma cells following treatment with alternariol, a mycotoxin (39). However, not much evidence is available concerning its functions in TGF-β regulated signaling transduction.

As a shared potential target of hsa-miR-129-5p, hsa-miR-135a-5p and hsa-miR-363-3p, the G protein-coupled receptor kinase 5 (GRK5) gene encodes a member of the guanine nucleotide-binding protein-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. GRK5 mRNA and protein expression is increased in the lungs of patients with cystic fibrosis compared with normal donors (40). GRK5 has been identified as a regulator of aldosterone-mineralocorticoid receptor/angiotensin II type 1 receptor-mediated cardiomyocyte hypertrophy (41). Molecular analysis has revealed that overexpression of N-terminal GRK5 inhibits apoptosis and fibrosis, which are major pathogenic phenotypes that accompany cardiac hypertrophy, through nuclear factor-κB signaling (42). Knockout of GRK5 inhibits cardiac fibrosis induced by metoprolol, a β1-adrenergic receptor-selective blocker, and this regulation is dependent on β-arrestins but independent of G-protein signaling (43).

TGF-β1 and collagen were overexpressed in scar tissues in the present study (Fig. 8), indicating that the TGF-β pathway was upregulated. TGF-β1 is a key regulatory molecule in the pathogenesis of fibrosis, and is frequently upregulated during this process (44,45). Inhibition of TGF-β1 or its receptors, including TGF-β receptor 1, may reverse the unilateral ureteral occlusion-induced increase of fibrotic biomarkers, including TGF-β1, collagens and fibronectin, at the mRNA level (44). The increase of TGF-β1 and collagen may result in excessive fibrosis in scar tissue, and it is unclear how the regulatory miRNAs and genes that regulate TGF-β signaling are involved in this process. Potential crosstalk between miRNAs and their target genes are listed, together with the associated signaling molecules involved in TGF-β1 regulated fibrosis (Fig. 9).

It is worth noting that mitogen-activated protein kinase 1, proliferation and apoptosis adaptor protein 15, transducer of ERBB2, 1 and valosin containing protein gene products are predicted to interact with one or more TGF-β pathway proteins, as presented in Fig. 9. Among the associated TGF-β pathway genes, SMAD family member 3, mitogen-activated protein kinase 7 and ERK1/2 are the most frequently targeted candidates for potential interactions. Given the fact that crosstalk between SMADs and the ERK signaling pathway is essential in fibrosis (46), further functional analysis focusing on those 'hotspots' in larger cohorts may prove interesting.

In conclusion, the present study sequenced the urethral scar and normal tissue from patients with urethral stricture. miRNA sequencing indicated significantly altered expression of hsa-miR-129-5p, hsa-miR-135a-5p, hsa-miR-363-3p, hsa-miR-6720-3p and hsa-miR-9-5p. Bioinformatics analysis revealed that these miRNAs and their potential target genes are associated with fibrosis in other diseases. These data may provide miRNA targets for future precision treatments for urethral stricture.

Acknowledgments

Financial support was obtained from the National Natural Science Fund of China (grant nos. 81470917 and 81700590), the Science and Technology Commission of Shanghai (grant no. 17410742800), and the Shanghai JiaoTong University Biomedical Engineering Cross Research Foundation (grant no. YG2017QN15).

Notes

[1] Competing interests

The authors declare that they have no competing interests.

References

1 

Tritschler S, Roosen A, Füllhase C, Stief CG and Rübben H: Urethral stricture: Etiology, investigation and treatments. Dtsch Arztebl Int. 110:220–226. 2013.PubMed/NCBI

2 

Osman NI, Hillary C, Bullock AJ, MacNeil S and Chapple CR: Tissue engineered buccal mucosa for urethroplasty: Progress and future directions. Adv Drug Deliv Rev. 82–83:69–76. 2015. View Article : Google Scholar

3 

Hampson LA, McAninch JW and Breyer BN: Male urethral strictures and their management. Nat Rev Urol. 11:43–50. 2014. View Article : Google Scholar :

4 

Andrich DE, Dunglison N, Greenwell TJ and Mundy AR: The long-term results of urethroplasty. J Urol. 170:90–92. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Lumen N, Hoebeke P and Oosterlinck W: Urethroplasty for urethral strictures: Quality assessment of an in-home algorithm. Int J Urol. 17:167–174. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Nerli RB, Neelagund SE, Guntaka A, Patil S, Hiremath SC, Jali SM, Vernekar R and Hiremath MB: Staged buccal mucosa urethroplasty in reoperative hypospadias. Indian J Urol. 27:196–199. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Zhang K, Qi E, Zhang Y, Sa Y and Fu Q: Efficacy and safety of local steroids for urethra strictures: A systematic review and meta-analysis. J Endourol. 28:962–968. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Dubey D: The current role of direct vision internal urethrotomy and self-catheterization for anterior urethral strictures. Indian J Urol. 27:392–396. 2011. View Article : Google Scholar : PubMed/NCBI

9 

O'Reilly S: MicroRNAs in fibrosis: Opportunities and challenges. Arthritis Res Ther. 18:112016. View Article : Google Scholar : PubMed/NCBI

10 

Griffiths-Jones S: The microRNA registry. Nucleic Acids Res. 32:D109–D111. 2004. View Article : Google Scholar :

11 

Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ: miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 34:D140–D144. 2006. View Article : Google Scholar :

12 

Griffiths-Jones S, Saini HK, van Dongen S and Enright AJ: miRBase: Tools for microRNA genomics. Nucleic Acids Res. 36:D154–D158. 2008. View Article : Google Scholar :

13 

Kozomara A and Griffiths-Jones S: miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 42:D68–D73. 2014. View Article : Google Scholar :

14 

Kozomara A and Griffiths-Jones S: miRBase: Integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 39:D152–D157. 2011. View Article : Google Scholar :

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402–408. 2001. View Article : Google Scholar

16 

Lewis BP, Burge CB and Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 120:15–20. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Enright AJ, John B, Gaul U, Tuschl T, Sander C and Marks DS: MicroRNA targets in Drosophila. Genome Biol. 5:R12003. View Article : Google Scholar

18 

Huang da W, Sherman BT and Lempicki RA: Systematic and integrative analysis of large gene lists using DAVID bioinfor-matics resources. Nat Protoc. 4:44–57. 2009. View Article : Google Scholar

19 

Huang da W, Sherman BT and Lempicki RA: Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 37:1–13. 2009. View Article : Google Scholar

20 

Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al: Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 25:25–29. 2000. View Article : Google Scholar : PubMed/NCBI

21 

The Gene Ontology Consortium: Expansion of the Gene Ontology knowledgebase and resources. Nucleic Acids Res. 45:D331–D338. 2017. View Article : Google Scholar :

22 

Kanehisa M and Goto S: KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28:27–30. 2000. View Article : Google Scholar

23 

Li Y, An H, Pang J, Huang L, Li J and Liu L: MicroRNA profiling identifies miR-129-5p as a regulator of EMT in tubular epithelial cells. Int J Clin Exp Med. 8:20610–20616. 2015.

24 

Nakashima T, Jinnin M, Yamane K, Honda N, Kajihara I, Makino T, Masuguchi S, Fukushima S, Okamoto Y, Hasegawa M, et al: Impaired IL-17 signaling pathway contributes to the increased collagen expression in scleroderma fibroblasts. J Immunol. 188:3573–3583. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Zhang Y, An J, Lv W, Lou T, Liu Y and Kang W: miRNA-129-5p suppresses cell proliferation and invasion in lung cancer by targeting microspherule protein 1, E-cadherin and vimentin. Oncol Lett. 12:5163–5169. 2016. View Article : Google Scholar

26 

Xu H, Hu Y and Qiu W: Potential mechanisms of microRNA-129-5p in inhibiting cell processes including viability, proliferation, migration and invasiveness of glioblastoma cells U87 through targeting FNDC3B. Biomed Pharmacother. 87:405–411. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Luan QX, Zhang BG, Li XJ and Guo MY: MiR-129-5p is down-regulated in breast cancer cells partly due to promoter H3K27m3 modification and regulates epithelial-mesenchymal transition and multi-drug resistance. Eur Rev Med Pharmacol Sci. 20:4257–4265. 2016.PubMed/NCBI

28 

Jiang Z, Wang H, Li Y, Hou Z, Ma N, Chen W, Zong Z and Chen S: MiR-129-5p is down-regulated and involved in migration and invasion of gastric cancer cells by targeting interleukin-8. Neoplasma. 63:673–680. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Fu L, Chen Q, Yao T, Li T, Ying S, Hu Y and Guo J: Hsa_circ_0005986 inhibits carcinogenesis by acting as a miR-129-5p sponge and is used as a novel biomarker for hepatocellular carcinoma. Oncotarget. 8:43878–43888. 2017.PubMed/NCBI

30 

Fierro-Fernández M, Busnadiego Ó, Sandoval P, Espinosa-Díez C, Blanco-Ruiz E, Rodríguez M, Pian H, Ramos R, López-Cabrera M, García-Bermejo ML and Lamas S: miR-9-5p suppresses pro-fibrogenic transformation of fibroblasts and prevents organ fibrosis by targeting NOX4 and TGFBR2. EMBO Rep. 16:1358–1377. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Miguel V, Busnadiego O, Fierro-Fernández M and Lamas S: Protective role for miR-9-5p in the fibrogenic transformation of human dermal fibroblasts. Fibrogenesis Tissue Repair. 9:72016. View Article : Google Scholar : PubMed/NCBI

32 

Karatas OF, Suer I, Yuceturk B, Yilmaz M, Oz B, Guven G, Cansiz H, Creighton CJ, Ittmann M and Ozen M: Identification of microRNA profile specific to cancer stem-like cells directly isolated from human larynx cancer specimens. BMC Cancer. 16:8532016. View Article : Google Scholar : PubMed/NCBI

33 

Wang Y, Chen J, Lin Z, Cao J, Huang H, Jiang Y, He H, Yang L, Ren N and Liu G: Role of deregulated microRNAs in non-small cell lung cancer progression using fresh-frozen and formalin-fixed, paraffin-embedded samples. Oncol Lett. 11:801–808. 2016. View Article : Google Scholar : PubMed/NCBI

34 

Wang SH, Zhang WJ, Wu XC, Weng MZ, Zhang MD, Cai Q, Zhou D, Wang JD and Quan ZW: The lncRNA MALAT1 functions as a competing endogenous RNA to regulate MCL-1 expression by sponging miR-363-3p in gallbladder cancer. J Cell Mol Med. 20:2299–2308. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Wang Y, Chen T, Huang H, Jiang Y, Yang L, Lin Z, He H, Liu T, Wu B, Chen J, et al: miR-363-3p inhibits tumor growth by targeting PCNA in lung adenocarcinoma. Oncotarget. 8:20133–20144. 2017.PubMed/NCBI

36 

Cochetti G, Poli G, Guelfi G, Boni A, Egidi MG and Mearini E: Different levels of serum microRNAs in prostate cancer and benign prostatic hyperplasia: Evaluation of potential diagnostic and prognostic role. OncoTargets Ther. 9:7545–7553. 2016. View Article : Google Scholar

37 

Hu F, Min J, Cao X, Liu L, Ge Z, Hu J and Li X: MiR-363-3p inhibits the epithelial-to-mesenchymal transition and suppresses metastasis in colorectal cancer by targeting Sox4. Biochem Biophys Res Commun. 474:35–42. 2016. View Article : Google Scholar : PubMed/NCBI

38 

Van Renne N, Roca Suarez AA, Duong FH, Gondeau C, Calabrese D, Fontaine N, Ababsa A, Bandiera S, Croonenborghs T, Pochet N, et al: miR-135a-5p-mediated downregulation of protein tyrosine phosphatase receptor delta is a candidate driver of HCV-associated hepatocarcinogenesis. Gut: gutjnl. 2016:3122702017.

39 

Vejdovszky K, Sack M, Jarolim K, Aichinger G, Somoza MM and Marko D: In vitro combinatory effects of the Alternaria mycotoxins alternariol and altertoxin II and potentially involved miRNAs. Toxicol Lett. 267:45–52. 2017. View Article : Google Scholar

40 

Mak JC, Chuang TT, Harris CA and Barnes PJ: Increased expression of G protein-coupled receptor kinases in cystic fibrosis lung. Eur J Pharmacol. 436:165–172. 2002. View Article : Google Scholar : PubMed/NCBI

41 

Cannavo A, Liccardo D, Eguchi A, Elliott KJ, Traynham CJ, Ibetti J, Eguchi S, Leosco D, Ferrara N, Rengo G and Koch WJ: Myocardial pathology induced by aldosterone is dependent on non-canonical activities of G protein-coupled receptor kinases. Nat Commun. 7:108772016. View Article : Google Scholar : PubMed/NCBI

42 

Sorriento D, Santulli G, Fusco A, Anastasio A, Trimarco B and Iaccarino G: Intracardiac injection of AdGRK5-NT reduces left ventricular hypertrophy by inhibiting NF-κB-dependent hyper-trophic gene expression. Hypertension. 56:696–704. 2010. View Article : Google Scholar : PubMed/NCBI

43 

Nakaya M, Chikura S, Watari K, Mizuno N, Mochinaga K, Mangmool S, Koyanagi S, Ohdo S, Sato Y, Ide T, et al: Induction of cardiac fibrosis by β-blocker in G protein-independent and G protein-coupled receptor kinase 5/β-Arrestin2-dependent signaling pathways. J Biol Chem. 287:35669–35677. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Richards TL, Minor K and Plato CF: Effects of transforming growth factor-beta (TGF-β) receptor I inhibition on renal biomarkers and fibrosis in unilateral ureteral occluded (UUO) Mice. FASEB J. 31(1030): 10332017.

45 

Penn JW, Grobbelaar AO and Rolfe KJ: The role of the TGF-β family in wound healing, burns and scarring: A review. Int J Burns Trauma. 2:18–28. 2012.

46 

Zhan M and Kanwar YS: Hierarchy of molecules in TGF-β signaling relevant to myofibroblast activation and renal fibrosis. Am J Physiol Renal Physiol. 307:F385–F387. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang K, Chen J, Zhang D, Wang L, Zhao W, Lin D, Chen R, Xie H, Hu X, Fang X, Fang X, et al: microRNA expression profiles of scar and normal tissue from patients with posterior urethral stricture caused by pelvic fracture urethral distraction defects. Int J Mol Med 41: 2733-2743, 2018.
APA
Zhang, K., Chen, J., Zhang, D., Wang, L., Zhao, W., Lin, D. ... Fu, Q. (2018). microRNA expression profiles of scar and normal tissue from patients with posterior urethral stricture caused by pelvic fracture urethral distraction defects. International Journal of Molecular Medicine, 41, 2733-2743. https://doi.org/10.3892/ijmm.2018.3487
MLA
Zhang, K., Chen, J., Zhang, D., Wang, L., Zhao, W., Lin, D., Chen, R., Xie, H., Hu, X., Fang, X., Fu, Q."microRNA expression profiles of scar and normal tissue from patients with posterior urethral stricture caused by pelvic fracture urethral distraction defects". International Journal of Molecular Medicine 41.5 (2018): 2733-2743.
Chicago
Zhang, K., Chen, J., Zhang, D., Wang, L., Zhao, W., Lin, D., Chen, R., Xie, H., Hu, X., Fang, X., Fu, Q."microRNA expression profiles of scar and normal tissue from patients with posterior urethral stricture caused by pelvic fracture urethral distraction defects". International Journal of Molecular Medicine 41, no. 5 (2018): 2733-2743. https://doi.org/10.3892/ijmm.2018.3487
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang K, Chen J, Zhang D, Wang L, Zhao W, Lin D, Chen R, Xie H, Hu X, Fang X, Fang X, et al: microRNA expression profiles of scar and normal tissue from patients with posterior urethral stricture caused by pelvic fracture urethral distraction defects. Int J Mol Med 41: 2733-2743, 2018.
APA
Zhang, K., Chen, J., Zhang, D., Wang, L., Zhao, W., Lin, D. ... Fu, Q. (2018). microRNA expression profiles of scar and normal tissue from patients with posterior urethral stricture caused by pelvic fracture urethral distraction defects. International Journal of Molecular Medicine, 41, 2733-2743. https://doi.org/10.3892/ijmm.2018.3487
MLA
Zhang, K., Chen, J., Zhang, D., Wang, L., Zhao, W., Lin, D., Chen, R., Xie, H., Hu, X., Fang, X., Fu, Q."microRNA expression profiles of scar and normal tissue from patients with posterior urethral stricture caused by pelvic fracture urethral distraction defects". International Journal of Molecular Medicine 41.5 (2018): 2733-2743.
Chicago
Zhang, K., Chen, J., Zhang, D., Wang, L., Zhao, W., Lin, D., Chen, R., Xie, H., Hu, X., Fang, X., Fu, Q."microRNA expression profiles of scar and normal tissue from patients with posterior urethral stricture caused by pelvic fracture urethral distraction defects". International Journal of Molecular Medicine 41, no. 5 (2018): 2733-2743. https://doi.org/10.3892/ijmm.2018.3487
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team