Open Access

SUMO2 modification of Aurora B and its impact on follicular development and atresia in the mouse ovary

  • Authors:
    • Jing Cao
    • Xiao‑Ming Liu
    • Li‑Lin Huang
    • Li Wang
    • Xiao‑Fei Jiao
    • Li‑Jun Huo
  • View Affiliations

  • Published online on: March 7, 2018     https://doi.org/10.3892/ijmm.2018.3541
  • Pages: 3115-3126
  • Copyright: © Cao et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

In the mammalian ovary, >99% follicles fail to ovulate due to apoptosis in granulosa cells. Aurora B, a core subunit enzyme of the chromosomal passenger complex, exerts a crucial role in microtubule‑kinetochore attachment, and has been reported to be modified by small ubiquitin‑related modifier (SUMO) proteins. However, the details of how Aurora B and its SUMOylation impact on follicular development have yet to be fully elucidated. The aim of the present study was to explore the roles, and possible molecular mechanism, of Aurora B and its SUMOylation in the granulosa cells of the mouse follicle. It was revealed that the protein level of Aurora B increased with follicular development and the growth of the granulosa cells. Aurora B impacted follicular development and atresia through mediating the p38 mitogen‑activated protein kinase and FasL/Fas pathways, and caused the downregulation of cyclin‑dependent kinase 4, proliferating cell nuclear antigen, Bcl‑2, and upregulation of caspases‑3 and ‑8 to modulate the viability of the granulosa cells. In addition, Aurora B undergoes modification by SUMO2, but not by SUMO1, in vivo and in vitro, and Lys‑207 is a major modification site. SUMOylation modulates follicular development through an increase in Aurora B localization in the nucleus, and by stabilizing the protein level of Aurora B and keeping the viability of the granulosa cells. Taken together, Aurora B and its SUMOylation are important for follicular development and atresia in the ovaries of mice.

Introduction

A mammalian ovary consists of a large number of follicles at the fetal stage. However, > 99% of follicles fail to ovulate due to follicular atresia, which is the spontaneous degeneration of a follicle (1). Although follicular atresia may occur at any stage of growth and development (2), it usually occurs during the early antral stages of follicular development. As a result, apoptosis is originally induced in the region of the granulosa cells, as opposed to the cumulus cells, oocytes, or inner or extra theca cells, and subsequently the majority of the granulosa cells, theca cells and cumulus cells undergo apoptosis. This firmly suggests that follicular development and atresia predominantly depend on apoptosis of the granulosa cells. In addition, previous studies have demonstrated that numerous factors, including cell death ligands and receptors, growth factors, pro- and anti-apoptotic factors, apoptotic genes and cytokines, may modulate apoptosis of the granulosa cells (2).

Aurora B (also termed serine/threonine-protein kinase 12) is a key regulator in mitosis. It forms the enzymatic core of the chromosomal passenger complex (CPC) (3), which also contains three non-enzymatic components: Survivin, inner centromere protein (INCENP) and borealin (4). CPC is a crucial upstream regulator of centromere-kinetochore function. Aurora B exerts an important role in chromosomal cohesion and arrangement, chromosomal separation, the spindle assembly checkpoint, and cytokinesis (5). During mitosis, the localization of Aurora B changes during cell cycle division: For example, Aurora B is localized on the inner centromeres during metaphase to regulate chromosomal cohesion and spindle-kinetochore attachment (6); subsequently, it is localized on the spindle midzone and equatorial cortex, and then it accumulates in the midbody to accomplish cell division (6,7). Aurora B may be activated by autophosphorylation of the T-loop (activation loop) after it binds to the IN-box region of INCENP (8,9). Post-translational modifications, including ubiquitination and SUMOylation, are necessary for the proper activity and control of the dynamic behavior of the CPC.

SUMOylation is a post-translational modification by the covalent conjugation of small ubiquitin-related modifiers (SUMOs), which are found in all eukaryotes (10-12). There are at least three forms of SUMOs that have been identified in humans: SUMO1, 2 and 3. SUMO2 and 3 have a high degree of similarity (97%), whereas SUMO1 shares 43% of its identity with SUMO2/3 (13). Similarly to ubiquitination, SUMOylation features a conserved sequence that covalently conjugates to lysine residues within the target protein using the sequential action of SUMO-specific E1 (activation), E2 (conjugation) and E3 (ligation) enzymes (14). This process may result in a modulation of the subcellular localization of its targets (15), alter protein stability (16), and antagonize other types of post-translational modifications (17,18) in at least two ways: An allosteric effect that induces substrate conformational change, or an effect that involves the creation/inhibition of a binding interface (6). SUMOylation is also a reversible process that is catalyzed by the SUMO-specific proteases of the sentrin-specific protease (SENP) family (19).

The majority of studies have focused on the role of Aurora B in cancer therapy; however, the role of Aurora B and its SUMOylation in follicular development and atresia has yet to be elucidated. A recent study has verified that, in humans, Aurora B is modified by PIAS3 [protein inhibitor of activated signal transducer and activator of transcription (STAT)]-mediated SUMO2 conjugation at Lys-202, and that SUMO2 conjugation facilitates the autophosphorylation of Aurora B, but does not directly affect its kinase activity during mitosis (6). Furthermore, Lys-207 of Aurora B may be conjugated to SUMOs in 293 cells, and this modification requires Aurora B to bind to its activator, INCENP. The defective SUMOylation of Aurora B has resulted in abnormal chromosome segregation, reduced cell viability, and altered cytokinesis and chromosomal dynamics of the CPC (20).

However, upon sequencing cDNA obtained from the granulosa cells of Kunming female white mice, the individual base (134 bp) of Mus musculus Aurora B has been identified and verified that is different, as reported by The National Center for Biotechnology Information (NCBI; cDNA clone MGC:5803 IMAGE:3501444). In addition, recent proteomics studies have shown that a considerable proportion of SUMOylated proteins do not contain the consensus sites (21-23), and that not all consensus sequences are SUMOylated, as this process often occurs outside of the consensus sequence (24). Therefore, the aim of the present study was to determine how Aurora B and its SUMOylation may influence follicular development and atresia in primary cultured granulosa cells in mice.

The findings of the present study have provided evidence that, in mice, Aurora B serves a crucial role in follicular development through mediating the viability of granulosa cells, with possibly other molecular mechanisms being in operation. Furthermore, this study has explored whether Aurora B may be SUMO-modified at Lys-207 in vivo and in vitro. How SUMOylation impacts on follicular development and atresia, as mediated by granulosa cells, was also examined.

Materials and methods

Experimental animals and ethics

Female Kunming mice were purchased from the Center of Laboratory Animals (Wuhan, China). All animal treatment procedures were approved by the Ethics Committee of the Hubei Research Center of Experimental Animals (ref. no. ETH-201509). The mice were provided with food and water, and housed under controlled conditions of temperature (20-24°C) and lighting (12-h light/12-h darkness).

Immunohistochemistry (IHC)

The ovaries from mice aged 7, 14 or 21 days, or from 21-day mice that had been injected with 10 IU pregnant mare serum gonadotropin (PMSG; Ningbo Sansheng Pharmaceutical Co., Ltd., Ningbo, China) for 48 h, or from 21-day mice that had been injected with 10 IU human chorionic gonadotropin (hCG; Ningbo Sansheng Pharmaceutical Co., Ltd.) for 7 h after treatment with PMSG for 48 h, were collected. The ovaries were fixed in 4% paraformaldehyde (PFA; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) overnight at 4°C, passed through an ethanol gradient series for dehydration, and embedded in paraffin wax. The ovaries were then cut into 4-5 μm sections, which were placed on slides. The slides were dewaxed in xylene and rehydrated in gradient ethanol. Heat-mediated antigen retrieval of tissue sections was performed before the sections were allowed to cool (25). Endogenous peroxidases were blocked using 3% hydrogen peroxide for 15 to 20 min, and non-specific antibody binding was blocked using 5% bovine serum albumin (BSA; Sigma-Aldrich, St. Louis, MO, USA) for 1 h. The tissue sections were incubated with polyclonal rabbit anti-Aurora B antibody (1:200 dilution; sc-25426; Santa Cruz Biotechnology, Inc.) overnight at 4°C, and then incubated with a secondary antibody and streptavidin-biotin complex (SA1022; Wuhan Boster Biological Technology, Ltd., Wuhan, China) for 20 min at 37°C. The signals were visualized using 3,3′-diaminobenzidine (DAB) for 1 min and hematoxylin for 2 min. Slides were subsequently dehydrated using graded ethanol, cleared in xylene, mounted, and images were captured.

Immunocytochemistry (ICC)

For immunofluorescence, granulosa cells from antral follicles were obtained from the ovaries of 21-day-old female Kunming mice injected with 10 IU PMSG for 48 h. To obtain purified granulosa cells, it is necessary that the ovaries are not minced too extensively; the tissues were then suspended in Dulbecco's modified Eagle's medium/Nutrient F12 (DMEM/F12; Hyclone, Logan, UT, USA) or phosphate-buffered saline (PBS) three times; the suspension time was reduced from 1 min to 30 sec. The supernatant containing the granulosa cells was centrifuged at 252 × g for 5 min at room temperature, and cultured in DMEM/ F12 medium supplemented with 10% fetal bovine serum (FBS; gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C in a humidified atmosphere containing 5% CO2. After 12 h, granulosa cells were washed with DMEM/F12 to remove impurities and tissues, and cultured in fresh medium continuously. Cells were fixed in 4% PFA and permeabilized with 0.5% Triton X-100 (Santa Cruz Biotechnology, Inc.). The cells were subsequently blocked with 5% BSA for 30 min at 37°C and incubated with primary antibodies overnight at 4°C, a polyclonal rabbit anti-Aurora B antibody (1:100 dilution; sc-25426; Santa Cruz Biotechnology, Inc.), a monoclonal mouse anti-HA antibody (1:500 dilution; M180-3; Medical and Biological Laboratories, Co., Ltd., Nagoya, Japan), and a polyclonal rabbit anti-Flag antibody (1:200 dilution; 20543-1-AP; Proteintech, Chicago, IL, USA). The next day, the cells were incubated with fluorescein isothiocyanate (FITC)/CY3 conjugated to a secondary antibody (1:100 dilution; Wuhan Boster Biological Technology, Ltd.) for 2 h at room temperature in the dark. The nuclei were stained with 10 μl/ml propidium iodide (PI; Santa Cruz Biotechnology, Inc.) for 5 min in the dark. Images were then captured using a microscope (TE2000-U; Nikon, Tokyo, Japan).

Plasmid construction

The Aurora B- and SUMO2-coding sequences of Mus musculus were obtained from the National Center for Biotechnology Information (Bethesda, MD, USA) (Aurora B, NM_011496.2; SUMO2, NM_133354), and were amplified using the polymerase chain reaction (PCR) and primer pair sequences (Table I). To generate the Aurora B lysine 207-to-arginine (K207R) mutant, two primer pairs were used for PCR: The Aurora B cDNA sequence was used as the template using primer pair 1 (forward 1 and reverse 1) and primer pair 2 (forward 2 and reverse 2), respectively, for generating two fragments including the mutant base, and then the two fragments (1:1) were taken as the template again, this time using the primer pair, forward 1 and reverse 2, for the second reaction. The genes were then subcloned into pCMV-N-HA or Flag vector to generate the plasmids, named as HA-Aurora B, HA-Aurora BK207R and HA-SUMO2, and Flag-Aurora B, Flag-Aurora BK207R and Flag-SUMO2. The results were confirmed by sequencing.

Table I

Sequences of primer pairs for PCR.

Table I

Sequences of primer pairs for PCR.

GenePrimer sequences (5′→3′)Length (bp)
Aurora BForward CAAGCTTTGTTTCCCTCTCTGTCCA1,099
Reverse GGAATTCAACCAAGGAGCAGGCTA
Aurora BK207RForward 1 CAAGCTTTGTTTCCCTCTCTGTCCA678
Reverse 1 AGGTTCTCCGGCTTTATGTCT
Forward 2 TAATTCACAGAGACATAAAGCCGG451
Reverse 2 GGAATTCAACCAAGGAGCAGGCTA
SUMO2Forward GCTCCTGGTGCTGCTTGTG360
Reverse CCCTTTTTA GTAGACACCTCCAGT

[i] PCR, polymerase chain reaction; SUMO2, small ubiquitin-related modifier.

Cell culture, inhibitor treatment and transfection

Ovaries from 21-day mice were injected with PMSG for 48 h. The ovaries were subsequently minced using a scalpel, and suspended in DMEM/F12 or PBS three times; the time of the suspensions was reduced from 1 min to 30 sec. The supernatant containing the granulosa cells was cultured in DMEM/F12 supplemented with 10% FBS at 37°C in a humidified atmosphere containing 5% CO2. ZM447439 (Axon Medchem LLC, Reston, VA, USA), an inhibitor of Aurora B, was dissolved in DMSO at concentrations of 10, 50, and 100 mM, and stored at −20°C. Appropriate concentrations were added to the culture medium for 48 h after the cells were starved for 6 h; the final concentration of DMSO never exceeded 1 μl/ml. HA-Aurora B, HA-Aurora BK207R, Flag-SUMO2 and HA or Flag (as control) were transfected using Lipofectamine® LTX and Plus™ reagent (Invitrogen Life Technologies; Thermo Fischer Scientific, Inc.) according to the manufacturer's protocol. Lipofectamine® LTX and plasmids were diluted into Opti-MEM (Gibco; Thermo Fischer Scientific, Inc.) for 5 min, and then mixed in a ratio of 2:1 for 30 min. After 48 h, the granulosa cells were collected for protein extraction or subsequent assay.

Protein extraction, immunoprecipitation (IP) and western blotting

Granulosa cells with or without treatment were washed with ice-cold PBS and harvested in 80 μl RIPA buffer (Santa Cruz Biotechnology, Inc.) that was supplemented with 1% PMSF (Dingguo Biotechnology Co., Beijing, China), 1% cocktail (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), and 20 mM N-ethylmaleimide (NEM; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 20 min. The lysates were centrifuged at 11,600 × g for 10 min, and the supernatant was collected and stored at −80°C.

In order to examine the interaction of the proteins in vivo and in vitro, IP was performed. The granulosa cells were washed with ice-cold PBS and lysed on ice in lysis buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA and 1% Triton X-100] that was supplemented with 1% PMSF, 1% cocktail and 20 mM NEM for 20 min; the protein samples were incubated with 1 μg of the respective primary antibodies overnight at 4°C, a polyclonal rabbit anti-SUMO1 antibody (10329-1-AP) and a polyclonal rabbit anti-SUMO2 antibody (11251-1-AP) (both from Proteintech, as described above), a monoclonal mouse anti-HA antibody (M180-3; Medical and Biological Laboratories, Co., Ltd.), and a polyclonal rabbit anti-Flag antibody (20543-1-AP; Proteintech), and subsequently 40 μl protein A+G Agarose (Beyotime Biotechnology Co., Ltd., Shanghai, China) was added for 2 h at 4°C. Finally, the samples were boiled with 40 μl 2X SDS loading buffer for 5 min, and used immediately for the western blotting.

The proteins were separated on SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA), blocked with 5% skimmed milk diluted with TBST [10 mM Tris (pH 7.5), 150 mM NaCl and 0.1% Tween-20], and incubated with the corresponding primary antibodies diluted in blocking buffer overnight at 4°C. [The antibodies were rabbit anti-Aurora B immunoglobulin g (IGG) (1:1,000 dilution; 3094; Cell Signaling Technology, Inc., Danvers, MA, USA), mouse anti-β-actin IGG (1:1,000 dilution; sc-517582; Santa Cruz Biotechnology, Inc.), mouse anti-HA IGG (1:1,000 dilution; M180-3; Medical and Biological Laboratories, Co., Ltd.), rabbit anti-Flag IGG (1:500 dilution; 20543-1-AP; Proteintech), rabbit anti-phospho-p38 mitogen-activated protein kinase (MAPK) (Thr-180) IGG (1:1,000 dilution; AF4001; Affinity Biosciences, Cincinnati, OH, USA), rabbit anti-cyclin-dependent kinase 4 (CDK4) IGG (1:1,000 dilution; A0366; ABclonal Biotech Co., Ltd., Wobrun, MA, USA), mouse anti-proliferating cell nuclear antigen (PCNA) IGG (1:500 dilution; BM0104; Boster Biological Technology, Ltd.), Fas (1:1,000 dilution; A2639; ABclonal Biotech Co., Ltd.), mouse anti-caspase-8 IGG (1:1,000 dilution; 66093- 1-IG; Proteintech), and caspase-3 (1:200 dilution; sc-136219) and B-cell lymphoma 2 (Bcl-2; 1:200 dilution; sc-509) (both from Santa Cruz Biotechnology, Inc.)]. The following day, the proteins were incubated with matching horseradish peroxidase (HRP)-conjugated secondary anti bodies (1:3,000 dilution; Santa Cruz Biotechnology, Inc.), diluted in TBST for 1 h, and washed three times in TBST. Chemiluminescent detection was performed by enhanced chemiluminescence (ECL; Amersham Biosciences, Piscataway, NJ, USA). The images were captured with a gel-Pro analyzer 4.0 (Media Cybernetics, Silver Spring, MD, USA). The scanning intensities of the western blots was analyzed using ImageJ software to quantify the target bands in comparison with the corresponding β-actin bands.

Preparation of ovarian follicles

Different follicular development stages, the different granulosa cell layers and diameters were measured. Primary follicles obtained from ovaries of 7-day-old female mice were gently separated using the needle of a 1 ml syringe under a stereo microscope (CKX41SF; Olympus Optical Technology Philippines Inc., Lapu-Lapu City, Philippines), and observed again under an inverted microscope (TE2000-U; Nikon) to collect the follicles with single layer granulosa cells and a diameter <90 μm. Secondary follicles obtained from the ovaries of 14-day-old female mice were measured using same procedure as described above, and follicles between 90 and 120 μm in diameter with two or three layers of granulosa cells were collected. Antral follicles were obtained from ovaries of 21-day-old female mice following injection with 10 IU PMSG for 48 h, separating out the follicles with a cavity measuring 400-500 μm in diameter, and puncturing the cavity to remove follicular fluid. Preovlatory follicles were obtained from the ovaries of 21-day-old female mice following injection with 10 IU PMSG for 48 h, and then 10 IU hCG 7 h orderly, separating out the follicles with an obvious cavity and measuring >500 μm in diameter, and then similarly puncturing the cavity to remove the follicular fluid. Finally, the four-stage follicles were washed in PBS three times, and centrifuged at 112 × g for 5 min at room temperature prior to immediate extraction of the proteins.

Quantitative real-time PCR (RT-qPCR) analysis

Total RNA was extracted and reverse-transcribed using a Total RNA extraction kit and RevertAid Strand cDNA Synthesis kit, according to the manufacturer's protocol. Relative mRNA levels of cdk4, PCNA, caspase-3 and bcl-2 were quantified using special primer pairs (Table II) and QuantiFast® SyBR®-Green PCR kit (Qiagen, Hilden, Germany). All samples were performed in triplicate to calculate the statistical significance. The gene expression results were normalized to the basal level of β-actin. The Ct (2−ΔΔCq) method (26) was used to analyze the relative gene expression data.

Table II

Sequences of primer pairs for RT-qPCR.

Table II

Sequences of primer pairs for RT-qPCR.

GenesPrimer sequences
PCNAForward CAACTTGGAATCCCAGAAC
Reverse AGACAGTGGAGTGGCTTTT
cdk4Forward TCACGCCTGTGGTGGTTAC
Reverse GGTCGGCTTCTGAGTTTCC
bcl-2Forward GCTACCGTCGTGACTTCGC
Reverse ACCCAGCCTCCGTTATCC
caspase-3Forward GGCGTGAAGACATTTTGAA
Reverse CGGGAGTAGTCGCCTCTGAA
β-actinForward CCCATCTACGAGGGCTAT
Reverse TGTCACGCACGATTTCC

[i] PCNA, proliferating cell nuclear antigen; cdk4, cyclin-dependent kinase 4.

Cell cycle, proliferation and apoptosis assay

Granulosa cells were collected for cell cycle assay using the Cell Cycle Detection kit (Keygen Biotech Co., Ltd., Nanjing, China) according to the manufacturer's protocol. Cells were fixed with 70% ethanol overnight at 4°C, and incubated in 100 μl RNase A for 30 min at 37°C, and 400 μl PI solution was added in the dark for 30 min at 4°C. Flow cytometric analysis was conducted using a BD FACSCalibur [excitation wavelength (Ex), 488 nm; emission wavelength (Em), 530 nm; Becton-Dickinson, Mountain view, CA, USA].

Apoptosis was performed using the Annexin V-FITC Apopt osis Detection kit (Keygen Biotech Co., Ltd.) according to the manufacturer's protocol. Granulosa cells were digested by the pancreatin enzymes without EDTA; each sample was then added to 190 μl 1X binding buffer and incubated in 5 μl Annexin V-FITC for 3 min in the dark, and then added to 10 μl PI solution in the dark for 10 min. Flow cytometric analysis was then performed.

Cell proliferation was assessed using a WST-1 Cell Proliferation Assay kit (Beyotime Institute of Biotechnology) according to the manufacturer's protocol. Briefly, granulosa cells were seeded in 96-well plates (4×103 cells/well), and 10 μl freshly prepared WST-1 solution was added to each well, along with the culture medium. The absorbance of the samples was measured after 2 h using a microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA) at 450 nm.

Statistical analysis

All experiments were performed independently at least three times, and the data are presented as the mean ± standard deviation. The differences between the groups were analyzed by one-way analysis of variance (ANOVA) followed by LSD test using SPSS statistical software (version 17.0; SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Localization and expression of Aurora B in the mouse follicle

To investigate whether Aurora B affects follicular development and atresia, an IHC study was initially conducted to detect the localization of Aurora B in the mouse follicles at different stages, including primary, secondary, antral and preovulatory follicles (Fig. 1Ab–e). A high concentration of Aurora B was identified in the granulosa cells, whereas a lower concentration appeared in the oocyte (Fig. 1A).

To further explore the protein level of Aurora B in the follicles, western blotting was performed, which determined that Aurora B was expressed in each stage of follicular development (Fig. 1B). The protein level of Aurora B increased with the extent of follicular development, particularly in the antral and preovulatory follicles, where the levels were higher compared with the primary and secondary follicles (P<0.01) (Fig. 1C). It was surmised that the increased protein level of Aurora B was caused by the proliferation of granulose cells in the follicles. The localization of Aurora B in granulosa cells was determined using ICC. As shown in Fig. 1D, Aurora B was detected in the nucleus and, notably, on the midbody and in the cytoplasm around the nucleus during cytokinesis. In addition, the protein level of Aurora B in the granulosa cells was also determined using western blotting. The results demonstrated that Aurora B was expressed in all the stages (Fig. 1E). As expected, protein levels of Aurora B in the antral and preovulatory granulosa cells were significantly higher than in the primary and secondary granulosa cells (P<0.01) (Fig. 1F).

These results suggested that Aurora B was localized in all stages, and that the protein level increased with follicular development and expansion of the granulosa cells, particularly at the antral stage, where it attained the maximum level. Thus, it was inferred that Aurora B affected the development of the follicles by directly modulating the proliferation and apoptosis of the granulosa cells. However, the role of Aurora B in granulosa cells remains unclear, and continues to be a topic of intense research investigation.

Aurora B impacts the viability of granulosa cells

To determine the role of Aurora B in follicular development, granulosa cells were co-cultured with ZM447439, which inhibits the phosphorylation of Aurora B (data not shown). Serial concentrations (0, 10, 50, and 100 μM) were used, and following a period of 48 h, the ratio of the cell cycle, levels of proliferation, and apoptosis rates were assessed.

As shown in Fig. 2A, the ratio of the cell cycle increased from 69.99 to 76.91% in the G0/G1 phase, decreased from 15.45 to 11.12% in the S phase, and decreased from 14.55 to 11.98% in the G2/M phase. These data suggested that, following treatment with 100 μM ZM, the ratio was significantly increased (P<0.01) in the G0/G1 phase, significantly decreased (P<0.05) in the S phase (Fig. 2B), and cell cycle was arrested at the G1/S phase. A proliferation assay using WST-1 absorbance at 490 nm revealed that the levels of proliferation were moderately reduced in a dose-dependent manner, which was particularly notable at 50 μM (P<0.05) and 100 μM (P<0.01) compared with 0 μM ZM (Fig. 2C). The apoptotic rate was 8.17, 12.93, 23.41 and 28.90% at 0, 10, 50, and 100 μM ZM, respectively (Fig. 2E), and rapidly increased at 50 μM (P<0.01) and 100 μM (P<0.001) (Fig. 2D).

These data indicated that blocking Aurora B exerted an impact on the viability of the granulosa cells. The inhibition of Aurora B led to an arrest of the cell cycle at the G1/S phase, reduced the proliferation of the cells, and induced apoptosis.

Aurora B mediates p38 MAPK and the FasL/Fas pathway in the granulosa cells

To better understand the molecular mechanisms of Aurora B, western blotting and RT-qPCR were performed using viability-associated proteins and genes, i.e., p38 MAPK, CDK4 (cell-cycle-associated genes) and PCNA (proliferation-associated gene), Fas (apoptotic membrane surface molecule), caspase-8 and caspase-3 (apoptosis genes) and Bcl-2 (anti-apoptosis gene).

The western blotting results demonstrated that the protein levels of phosphorylated p38 MAPK (p-p38 MAPK) (P<0.01), CDK4 (P<0.05), PCNA (P<0.01) and Bcl-2 (P<0.01) were significantly decreased at 50 μM ZM (Fig. 3A and B). However, the protein level of Fas (P<0.01), caspase-8 (P<0.001) and caspase-3 (P<0.001) were moderately increased at 100 μM ZM (Fig. 3A and B). Similarly, the RT-qPCR results revealed that, at 100 μM ZM, the mRNA levels of cdk4 (P<0.01), PCNA (P<0.05) and bcl-2 (P<0.01) were reduced, whereas caspase-3 (P<0.01) was induced (Fig. 3C).

The present study further demonstrated that inactivated Aurora B exerted an effect on the p38 MAPK and FasL/Fas pathways, causing the downregulation of p-p38 MAPK, CDK4, PCNA and Bcl-2 and the upregulation of caspases-8 and -3, which led to an arrest of the cell cycle at G1/S phase, decreased cell proliferation and increased apoptosis of the granulosa cells.

Identification of SUMOylation of Aurora B in vivo and in vitro

To investigate whether Aurora B is modified by SUMOs in vivo, the lysates of granulosa cells were immunoprecipitated with IGG, anti-SUMO1 and anti-SUMO2 antibodies, and immunoblotted with Aurora B antibody (Fig. 4A). It was revealed that the band of the Aurora B-SUMO2 complex (52 kDa) was more intense compared with that of the Aurora B-SUMO1 complex, which was almost not discernible; this suggested that Aurora B could be modified by SUMO2 in vivo.

The SUMOylation site of Aurora B was also investigated in vitro. Using SUMOsp2.0 software, data from studies on Homo sapiens and Xenopus laevis were used to predict that the SUMOylation site of Aurora B was located in Lys-207 in Mus musculus (Fig. 4B). Wild HA-Aurora B or mutant HA-Aurora BK207R was co-transfected with Flag-SUMO2 plasmids, and subsequently the cell lysates were immunoprecipitated with the anti-Flag antibody, and immunoblotted with anti-HA antibody. Notably, the complex protein of Aurora B-SUMO2 was evident, whereas, although the mutant complex protein was also visible (Fig. 4C), the band was less dense compared with the wild-type (P<0.001) (Fig. 4D). To verify these results, the cell lysates were immunoprecipitated with the anti-HA antibody and immunoblotted with the anti-Flag antibody a second time, which produced similar results (P<0.001) (Fig. 4E and F).

IP analysis confirmed that Aurora B and SUMO2 interacted in vivo and in vitro, and that Lys-207 was the site of SUMOylation, although it may not be a unique one.

Impact of SUMOylation on the protein stability and localization of Aurora B

The protein stability and localization of Aurora B in the granulosa cells were examined to identify whether SUMOylation could modulate the function of Aurora B. Granulosa cells were co-transfected with Aurora B (2 μg) and increasing concentrations of SUMO2 (2, 3, 4 and 5 μg) for 48 h. Western blotting revealed that the protein level of Aurora B was increased upon increasing the concentration of SUMO2 (Fig. 5A), which reached the highest level of significance with 4 μg SUMO2 (P<0.01) (Fig. 5B). Furthermore, it was revealed that Aurora B was localized in the nuclei of granulosa cells (Fig. 5C, top). However, certain signals of Aurora BK207R were also observed in the cytoplasm and in the nuclei, but not in the midbody, during cytokinesis (Fig. 5C, bottom).

These results demonstrated that SUMOylation was able to stabilize the protein level of Aurora B, and that, in terms of localization, Aurora B accumulated in the nuclei of granulosa cells.

SUMOylation of Aurora B exerts an impact on the viability of granulosa cells

It is known that SUMOylation is able to affect the protein stability and localization of Aurora B. However, this raises the question about whether the SUMOylation of mutant Aurora B would have a significant impact on viability of granulosa cells. To investigate this, granulosa cells were transfected with HA, HA-Aurora B, or HA-Aurora BK207R for 48 h, and subsequently assayed using FACS and WST-1. As shown in Fig. 6A, the ratio of the cell cycle increased from 66.69 to 75.70% in the G0/G1 phase, decreased from 12.93 to 8.54% in the S phase, and decreased from 20.39 to 15.76% in the G2/M phase. These data indicated that the ratio was significantly increased (P<0.01) in the G0/G1 phase, and was decreased (P<0.05) in the S and G2/M phases by the overexpression of HA-Aurora BK207R (Fig. 6B). As expected, the proliferation of granulosa cells was accelerated by the overexpression of HA-Aurora B compared with HA (P<0.01), although it was significantly suppressed by the overexpression of HA-Aurora BK207R (P<0.001) (Fig. 6C). Similarly, apoptosis rates were significantly increased from 25.95 to 46.62% by the overexpression of HA-Aurora BK207R (P<0.01) (Fig. 6D and E).

These results strongly confirm that the SUMOylation of mutant Aurora B affected the viability of granulosa cells by arresting the cell cycle in the G1/S phase, inhibiting proliferation, and inducing apoptosis. The results further proved that the SUMOylation of Aurora B exerts a significant role in follicular development through the granulosa cells.

Discussion

In the present study, following follicular development, the protein level of Aurora B was revealed to increase significantly until a maximum level was reached in the antral follicle; a similar pattern of protein levels were observed in the granulosa cells. It was inferred that Aurora B in the granulosa cells may contribute to the development of follicles. The present study also showed that follicular growth occurred slowly; the atresia rate increased when follicles were supplemented with an Aurora B inhibitor (data not shown), and the early follicular atresia was mainly caused by the apoptosis of granulosa cells in the follicular wall rather than of cumulus cells, oocytes or the inner and outer theca cells (2). These results further confirmed that Aurora B may modulate follicular growth and atresia by mediating the proliferation and apoptosis of granulosa cells.

Previous studies have shown that Aurora B exerts a critical role in chromosome-microtubule interactions (27), as it loca lizes in the kinetochore from prophase to metaphase, and relocalizes in the central spindle and midbody during cytokinesis (28). These studies agree with our results, which revealed that Aurora B was localized in the nucleus and trans-localized on the midbody during cytokinesis. During the shift from the G1 phase to the S phase, the cells must obtain all the necessary materials to maintain a normal growth level using the appropriate regulatory mechanism, particularly at the restriction point, which includes members of the tumor suppressor Rb gene family (pRb, p107 and p130), to prevent excessive proliferation (29). Furthermore, the CDK4/6 and cyclin D kinase activity of the complex serves to release the transcription factor E2F, which is associated with the S phase and maintains the cell at the checkpoint as it shifts from the G1 phase to the S phase through the phosphorylation of Rb (29). Recent studies have shown that the inhibition of CDK4/6 reduced the growth of neuroblastoma tumors in murine xenograft models (30,31). The p38 MAPK pathway is an important signal transduction pathway, involved in the regulation of cell inflammation, stress response, survival, differentiation, and apoptosis (32). In the present study, the phosphorylation level of p38 MAPK clearly decreased, whereas the mRNA and protein levels of CDK4 and PCNA significantly decreased, which caused the cell cycle to arrest at the G1/S phase. Inactivated Aurora B in the granulosa cells also reduced proliferation and induced apoptosis. These results confirmed that Aurora B exerts an impact on the viability of granulosa cells via the mediation of the p38 MAPK signal pathway.

However, CDK4/6 is able to stop cell division, and may even kill cancer cells by other hub proteins, including p53, a stress-inducible transcription factor that induces cell cycle arrest and apoptosis following DNA damage or cellular stress (33-37). Studies have implied that CDK4 may also be indirectly involved in the regulation of cell apoptosis (34); it could also induce the apoptosis of granulosa cells. On the other hand, the FasL/Fas system induces apoptotic signaling in both normal and tumor cells, whereas in normal mice, the injection of an agonistic anti-Fas antibody induces the number of atretic follicles (38). In vitro studies revealed that Fas mediated apoptosis in cultured granulosa cells, luteal cells and ovarian surface epithelial cells (39-41).

To explore the impact of SUMOylation of Aurora B in follicular development and atresia in mice, the present study, revealed Aurora B conjugation of SUMO2, rather than SUMO1, in vivo and in vitro, Lys-207 was discovered to be a major SUMO2 modification site in the primary granulosa cells, although it may not be a unique one. Recently, studies have indicated that a considerable proportion of SUMOylated proteins do not contain the consensus sites (21-23) and that not all the consensus sequences are SUMOylated, as this process often occurs outside of the consensus sequence (24); furthermore, using software SUMOsp2.0, Lys-292/296 sites of Aurora B were predicted with a high probability. This posed a limitation in our study, and further studies to verify the results identified in the primary granulosa cells are required in the future. It was noted that SUMO2 modification modulated the function of Aurora B, including maintenance of a higher protein level of Aurora B following an increase in SUMO2, and an increase in the localization of Aurora B in the nuclei of the granulosa cells.

The impact of SUMOylation of Aurora B was examined on the granulosa cells, and the results revealed that null SUMOylation of Aurora B (Aurora BK207R) arrested the cell cycle at the G1/S phase, suppressed proliferation, and promoted apoptosis. Notably, these results are consistent with the results observed with the inhibition of Aurora B. It was possible to deduce that D205, as a dead kinase domain of Aurora B, would be inactivated by mutant K207R, which triggers structural reorganization. Recently, a study revealed that the overexpression of the SUMO-null form induced polyploidy to the same extent as the Aurora BD205A mutant, and that it severely reduced the number of colonies of U2OS cells (20); the two mutants, K207A and D205A, of Aurora B promoted the level of ubiquitination (29). In addition, the facilitation of Aurora B autophosphorylation was decreased by the inhibition of SUMO2 conjugation by transfection with SENP2, which specifically deconjugated SUMO from the target (6). From that study, it was clear that Aurora BK207A decreased autophosphorylation, and increased ubiquitination caused by the structural reorganization that was triggered by the inactivation of the D205 kinase dead domain, resulting in an abnormal localization, cell cycle, proliferation and apoptosis.

Taken together, the results of the present study suggested that Aurora B modulates follicular growth and atresia by affecting the cell cycle of granulosa cells, cell proliferation and apoptosis through regulation of the p-p38 MAPK and FasL/Fas pathways, which causes the downregulation of CDK4, PCNA and Bcl-2, and upregulation of Fas, caspase-8 and caspase-3. Aurora B may be modified by SUMO2 rather than SUMO1 in the granulosa cells, and SUMO2 stabilizes the protein level of Aurora B, leading to an increase in its localization in the nucleus. Lys-207, a conserved sequence, is a major SUMOylation site of Aurora B. The cell cycle is arrested at the G1/S phase, proliferation is inhibited, and apoptosis is increased through the null SUMOylation of Aurora B.

In conclusion, the present study explored the protein level pattern of Aurora B in follicular development, the impact of Aurora B and its SUMOylation on follicular development and atresia as mediated by granulosa cells, and the variety of pathways that are involved in its regulation. Our study may provide the theoretical basis for control measures for follicular development and atresia, and further therapy for ovarian disease and infertility, in humans in the future.

Acknowledgments

This work was supported by the National Key Research and Development Program (2017yFD0501701). We are indebted to Dr Zia Ur Rehman and Dr Rahim Dad Brohi for their important help in revising the manuscript.

Notes

[1] Competing interests

The authors declare that they have no competing interests.

References

1 

Liu XM, Yang FF, Yuan YF, Zhai R and Huo LJ: SUMOylation of mouse p53b by SUMO-1 promotes its pro-apoptotic function in ovarian granulosa cells. PLoS One. 8:e636802013. View Article : Google Scholar : PubMed/NCBI

2 

Inoue N, Matsuda F, Goto Y and Manabe N: Role of cell-death ligand-receptor system of granulosa cells in selective follicular atresia in porcine ovary. J Reprod Dev. 57:169–175. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Porcelli L, Guida G, Quatrale AE, Cocco T, Sidella L, Maida I, Iacobazzi RM, Ferretta A, Stolfa DA, Strippoli S, et al: Aurora kinase B inhibition reduces the proliferation of metastatic melanoma cells and enhances the response to chemotherapy. J Transl Med. 13:262015. View Article : Google Scholar : PubMed/NCBI

4 

Gohard FH, St-Cyr DJ, Tyers M and Earnshaw WC: Targeting the INCENP IN-box-Aurora B interaction to inhibit CPC activity in vivo. Open Biol. 4:1401632014. View Article : Google Scholar : PubMed/NCBI

5 

Giet R and Glover DM: Drosophila Aurora B kinase is required for histone H3 phosphorylation and condensin recruitment during chromosome condensation and to organize the central spindle during cytokinesis. J Cell Biol. 152:669–682. 2001. View Article : Google Scholar : PubMed/NCBI

6 

Ban R, Nishida T and Urano T: Mitotic kinase Aurora-B is regulated by SUMO-2/3 conjugation/deconjugation during mitosis. Genes Cells. 16:652–669. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Andrews PD, Knatko E, Moore WJ and Swedlow JR: Mitotic mechanics: the auroras come into view. Curr Opin Cell Biol. 15:672–683. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Bishop JD and Schumacher JM: Phosphorylation of the carboxyl terminus of inner centromere protein (INCENP) by the Aurora B kinase stimulates Aurora B kinase activity. J Biol Chem. 277:27577–27580. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Honda R, Körner R and Nigg EA: Exploring the functional interactions between Aurora B, INCENP, and survivin in mitosis. Mol Biol Cell. 14:3325–3341. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Hay RT: SUMO: a history of modification. Mol Cell. 18:1–12. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Geiss-Friedlander R and Melchior F: Concepts in sumoylation: a decade on. Nat Rev Mol Cell Biol. 8:947–956. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Ulrich HD: The fast-growing business of SUMO chains. Mol Cell. 32:301–305. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Klein UR, Haindl M, Nigg EA and Muller S: RanBP2 and SENP3 function in a mitotic SUMO2/3 conjugation-deconjugation cycle on Borealin. Mol Biol Cell. 20:410–418. 2009. View Article : Google Scholar :

14 

Makhnevych T, Sydorskyy Y, Xin X, Srikumar T, Vizeacoumar FJ, Jeram SM, Li Z, Bahr S, Andrews BJ, Boone C, et al: Global map of SUMO function revealed by protein-protein interaction and genetic networks. Mol Cell. 33:124–135. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Kamitani T, Nguyen HP and Yeh ET: Preferential modification of nuclear proteins by a novel ubiquitin-like molecule. J Biol Chem. 272:14001–14004. 1997. View Article : Google Scholar : PubMed/NCBI

16 

Sacher M, Pfander B, Hoege C and Jentsch S: Control of Rad52 recombination activity by double-strand break-induced SUMO modification. Nat Cell Biol. 8:1284–1290. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Desterro JM, Rodriguez MS and Hay RT: SUMO-1 modification of IkappaBalpha inhibits NF-kappaB activation. Mol Cell. 2:233–239. 1998. View Article : Google Scholar : PubMed/NCBI

18 

Hoege C, Pfander B, Moldovan GL, Pyrowolakis G and Jentsch S: RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature. 419:135–141. 2002. View Article : Google Scholar : PubMed/NCBI

19 

Hay RT: SUMO-specific proteases: a twist in the tail. Trends Cell Biol. 17:370–376. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Fernández-Miranda G, Pérez de Castro I, Carmena M, Aguirre-Portolés C, Ruchaud S, Fant X, Montoya G, Earnshaw WC and Malumbres M: SUMOylation modulates the function of Aurora-B kinase. J Cell Sci. 123:2823–2833. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Blomster HA, Hietakangas V, Wu J, Kouvonen P, Hautaniemi S and Sistonen L: Novel proteomics strategy brings insight into the prevalence of SUMO-2 target sites. Mol Cell Proteomics. 8:1382–1390. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Golebiowski F, Matic I, Tatham MH, Cole C, Yin Y, Nakamura A, Cox J, Barton GJ, Mann M and Hay RT: System-wide changes to SUMO modifications in response to heat shock. Sci Signal. 2:ra242009. View Article : Google Scholar : PubMed/NCBI

23 

Hsiao HH, Meulmeester E, Frank BT, Melchior F and Urlaub H: 'ChopNSpice', a mass spectrometric approach that allows identification of endogenous small ubiquitin-like modifier-conjugated peptides. Mol Cell Proteomics. 8:2664–2675. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Blomster HA, Imanishi SY, Siimes J, Kastu J, Morrice NA, Eriksson JE and Sistonen L: In vivo identification of sumoylation sites by a signature tag and cysteine-targeted affinity purification. J Biol Chem. 285:19324–19329. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Davies EJ, Dong M, Gutekunst M, Närhi K, Van Zoggel HJ, Blom S, Nagaraj A, Metsalu T, Oswald E, Erkens-Schulze S, et al: Capturing complex tumour biology in vitro: histological and molecular characterisation of precision cut slices. Sci Rep. 5:171872015. View Article : Google Scholar : PubMed/NCBI

26 

KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25:402–408. 2001. View Article : Google Scholar

27 

Hauf S, Cole RW, LaTerra S, Zimmer C, Schnapp G, Walter R, Heckel A, Van Meel J, Rieder CL and Peters JM: The small molecule Hesperadin reveals a role for Aurora B in correcting kinetochore-microtubule attachment and in maintaining the spindle assembly checkpoint. J Cell Biol. 161:281–294. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Carmena M and Earnshaw WC: The cellular geography of aurora kinases. Nat Rev Mol Cell Biol. 4:842–854. 2003. View Article : Google Scholar : PubMed/NCBI

29 

Kouraklis G, Theocharis S, Vamvakas P, Vagianos C, Glinavou A, Giaginis C and Sioka C: Cyclin D1 and Rb protein expression and their correlation with prognosis in patients with colon cancer. World J Surg Oncol. 4:52006. View Article : Google Scholar : PubMed/NCBI

30 

Rader J, Russell MR, Hart LS, Nakazawa MS, Belcastro LT, Martinez D, Li Y, Carpenter EL, Attiyeh EF, Diskin SJ, et al: Dual CDK4/CDK6 inhibition induces cell-cycle arrest and senescence in neuroblastoma. Clin Cancer Res. 19:6173–6182. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Rihani A, Vandesompele J, Speleman F and Van Maerken T: Inhibition of CDK4/6 as a novel therapeutic option for neuroblastoma. Cancer Cell Int. 15:762015. View Article : Google Scholar : PubMed/NCBI

32 

Wang YN, Xiao KQ, Liu JL, Dallner G and Guan ZZ: Effect of long term fluoride exposure on lipid composition in rat liver. Toxicology. 146:161–169. 2000. View Article : Google Scholar : PubMed/NCBI

33 

Bukholm IK and Nesland JM: Protein expression of p53, p21 (WAF1/CIP1), bcl-2, Bax, cyclin D1 and pRb in human colon carcinomas. Virchows Arch. 436:224–228. 2000. View Article : Google Scholar : PubMed/NCBI

34 

Elkady AI, Hussein RA and El-Assouli SM: Mechanism of action of Nigella sativa on human colon cancer cells: the suppression of AP-1 and NF-kappaB transcription factors and the induction of cytoprotective genes. Asian Pac J Cancer Prev. 16:7943–7957. 2015. View Article : Google Scholar

35 

Kollareddy M, Dimitrova E, Vallabhaneni KC, Chan A, Le T, Chauhan KM, Carrero ZI, Ramakrishnan G, Watabe K, Haupt Y, et al: Regulation of nucleotide metabolism by mutant p53 contributes to its gain-of-function activities. Nat Commun. 6:73892015. View Article : Google Scholar : PubMed/NCBI

36 

Zhu J, Sammons MA, Donahue G, Dou Z, Vedadi M, Getlik M, Barsyte-Lovejoy D, Al-awar R, Katona BW, Shilatifard A, et al: Gain-of-function p53 mutants co-opt chromatin pathways to drive cancer growth. Nature. 525:206–211. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Tsou SH, Hou MH, Hsu LC, Chen TM and Chen YH: Gain-of-function p53 mutant with 21-bp deletion confers susceptibility to multidrug resistance in MCF-7 cells. Int J Mol Med. 37:233–242. 2016. View Article : Google Scholar

38 

Quirk SM, Cowan RG, Joshi SG and Henrikson KP: Fas anti- gen-mediated apoptosis in human granulosa/luteal cells. Biol Reprod. 52:279–287. 1995. View Article : Google Scholar : PubMed/NCBI

39 

Quirk SM, Cowan RG and Huber SH: Fas antigen-mediated apoptosis of ovarian surface epithelial cells. Endocrinology. 138:4558–4566. 1997. View Article : Google Scholar : PubMed/NCBI

40 

Quirk SM, Porter DA, Huber SC and Cowan RG: Potentiation of Fas-mediated apoptosis of murine granulosa cells by interferon-gamma, tumor necrosis factor-alpha, and cycloheximide. Endocrinology. 139:4860–4869. 1998. View Article : Google Scholar : PubMed/NCBI

41 

Vickers SL, Cowan RG, Harman RM, Porter DA and Quirk SM: Expression and activity of the Fas antigen in bovine ovarian follicle cells. Biol Reprod. 62:54–61. 2000. View Article : Google Scholar

Related Articles

Journal Cover

June-2018
Volume 41 Issue 6

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Cao J, Liu XM, Huang LL, Wang L, Jiao XF and Huo LJ: SUMO2 modification of Aurora B and its impact on follicular development and atresia in the mouse ovary. Int J Mol Med 41: 3115-3126, 2018.
APA
Cao, J., Liu, X., Huang, L., Wang, L., Jiao, X., & Huo, L. (2018). SUMO2 modification of Aurora B and its impact on follicular development and atresia in the mouse ovary. International Journal of Molecular Medicine, 41, 3115-3126. https://doi.org/10.3892/ijmm.2018.3541
MLA
Cao, J., Liu, X., Huang, L., Wang, L., Jiao, X., Huo, L."SUMO2 modification of Aurora B and its impact on follicular development and atresia in the mouse ovary". International Journal of Molecular Medicine 41.6 (2018): 3115-3126.
Chicago
Cao, J., Liu, X., Huang, L., Wang, L., Jiao, X., Huo, L."SUMO2 modification of Aurora B and its impact on follicular development and atresia in the mouse ovary". International Journal of Molecular Medicine 41, no. 6 (2018): 3115-3126. https://doi.org/10.3892/ijmm.2018.3541