Open Access

Shear stress promotes differentiation of stem cells from human exfoliated deciduous teeth into endothelial cells via the downstream pathway of VEGF-Notch signaling

  • Authors:
    • Penglai Wang
    • Shaoyue Zhu
    • Changyong Yuan
    • Lei Wang
    • Jianguang Xu
    • Zongxiang Liu
  • View Affiliations

  • Published online on: July 6, 2018     https://doi.org/10.3892/ijmm.2018.3761
  • Pages: 1827-1836
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Effects of shear stress on endotheliaxl differentiation of stem cells from human exfoliated deciduous teeth (SHEDs) were investigated. SHEDs were treated with shear stress, then reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to analyse the mRNA expression of arterial markers and western blot analysis was performed to analyse protein expression of angiogenic markers. Additionally, in vitro matrigel angiogenesis assay was performed to evaluate vascular-like structure formation. The secreted protein expression levels of the vascular endothelial growth factor (VEGF) of SHEDs after shear stress was also quantified using corresponding ELISA kits. Untreated SHEDs seeded on Matrigel cannot form vessel-like structures at any time points, whereas groups treated with shear stress formed a few vessel-like structures at 4, 8 and 12 h. When SHEDs were treated with EphrinB2-siRNA for 24, the capability of vessel-like structure formation was suppressed. After being treated with shear stress, the expression of VEGF, VEGFR2, DLL4, Notch1, EphrinB2, Hey1 and Hey2 (arterial markers) gene expression was significantly upregulated, moreover, the protein levels of VEGFR2, EphrinB2, CD31, Notch1, DLL4, Hey1, and Hey2 were also significantly up­regulated. Both the mRNA and protein expression levels of EphB4 (venous marker) were downregulated. The average VEGF protein concentration in supernatants secreted by shear stress treated SHEDs groups increased significantly. In conclusion, shear stress was able to induce arterial endothelial differentiation of stem cells from human exfoliated deciduous teeth, and VEGF-DLL4/Notch‑EphrinB2 signaling was involved in this process.

Introduction

Post-natal mesenchymal stem cells derived from dental tissues, such as dental pulp stem cells (DPSCs), stem cells from human exfoliated deciduous teeth (SHEDs) and stem cells from apical papilla (SCAP) exhibit great multi-plasticity to differentiate into mesodermal lineages (1-3). Capability of differentiation into osteo/odontogenic, adipogenic and neurogenic lineages are inclusively used to confirm the stemness of mesenchymal stem cells. Notably, DPSCs and SHEDs have been successfully induced into endothelial cells in vitro and in vivo (47), along with bone marrow mesenchymal stem cells (BMMSCs) and human adipose-derived stem cells (ASCs) (8,9).

It is well-known that vascular endothelial growth factor (VEGF), an endothelial cell mitogen is the best-defined regulator for inducing endothelial lineage differentiation from mesenchymal stem cells. Indeed, VEGF-A combined with its cognate VEGF receptor 2, effectively increases BMMSCs, ASCs, DPSCs and SHEDs differentiation into endothelial cells (4, 5, 8, and 9). The VEGF-Notch-EphrinB2 pathway was reported to regulate arterial-venous specification (10). During vessel sprouting, activation of VEGFR2 by VEGF induces tip cell migration and upregulates Notch ligand Delta-like 4 (DLL4) expression, which in turn interacts Notch receptors on neighboring endothelial cells (ECs), subsequently upregulates VEGFR1, metabolizing VEGF (11).

Substrate elasticity and biomechanical force are important factors of stem cell niche. Mechanical cues could modulate stem cell differentiation, division, survival, and motility (12). Studies have shown that shear stress can activate Notch signaling, triggering endothelial differentiation into the arterial phenotype (13). For example, shear stress induced arterial specification of embryonic stem (ES)-derived ECs and endothelial progenitor cells (14,15). Shear stress or combination with VEGF induced BMMSC differentiation into endothelial cells (16).

To the best of our knowledge, there are no reports on shear stress on the endothelial differentiation of SHEDs. In this study, we investigated: i) The cell sternness of SHEDs, ii) the impact of shear stress on the endothelial differentiation, and iii) the molecular mechanism by which shear stress induces endothelial differentiation.

Materials and methods

Culture and characterization of SHEDs

The 3rd passage SHEDs were a gift from Dr Jianguang Xu (The University of Hong Kong, Hong Kong, SAR, China). Cells were cultured in α-MEM supplemented with 10% (v/v) FBS and 1% (v/v) penicillin/streptomycin at 37°C in a 5% CO2 humidified incubator to 70% confluence, 4th to 6th passage cells were used in later experiments. Cell 'stemness' of SHEDs were evaluated before induction. The expression of cell surface markers, CD90, CD73, CD45, STRO-1, and CD105 was assessed by flow cytometry (BD Biosciences, Franklin Lakes, CA, USA). Additionally, osteo/odontogenic, adipogenic, and neurogenic differentiation assays were conducted in the respective induction media.

Shear stress experiments

Glass slides (Flexcell International, Hillsborough, NC, USA) were coated with Cultrex® Rat Collagen I (R&D Systems, Inc., Minneapolis, MN, USA) at a concentration of 5 μg/cm2 and incubated at 37°C for 1 h before usage. SHEDs grown to 70% confluence were trypsinized and counted. Before shear stress treatment, SHEDs (3×105 cells/ml) were seeded in glass slides (Flexcell International) for 4 h, followed by transfer to 4-well sterile dishes (Thermo Fisher Scientific, Inc., Waltham, MA, USA) with 4 ml α-MEM supplemented with 15% (v/v) FBS to achieve 80–90% confluence. Then, the glass slides were transferred to Streamer® Shear Stress Device (Flexcell International). After shear stress values of 4 and 16 dynes/cm2 for 2 h, supernatants were collected for later ELISA assay and cells were harvested for reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and protein analyses. Cells without treatment were used as control groups.

Combine shear stress with VEGF

SHEDs on glass slides after shear stress treatment were transferred to 4-well sterile dishes (Thermo Fisher Scientific, Inc.), 4 ml FBS-free α-MEM supplemented with VEGF (50 ng/ml) (R&D Systems, Inc.) was added to each well. Cells were cultured for 12 h before being harvested for RT-qPCR and western blot analysis. Cells without VEGF treatment were used as control groups.

In vitro Matrigel angiogenesis assay

To assess whether shear stress induced SHEDs could promote angiogenesis, the in vitro Matrigel angiogenesis assay was conducted as described previously (17). Briefly, different groups of cells (4 dynes/cm2 shear stress induced SHEDs, 16 dynes/cm2 shear stress induced SHEDs and primary SHEDs groups) were seeded at 70,000 cells per well of labeled and 120 μl liquid Matrigel (cat. no. 354230; BD Biosciences, Franklin Lakes, NJ, USA) pre-coated 48-well plates. After being incubated for 2, 4, 6 and 8 h at 37°C and 5% CO2. Images were captured using an inverted microscope (Olympus, Tokyo, Japan). In addition, to investigate whether VEGF-DLL4/Notch-EphrinB2 signaling pathway is involved, SHEDs were transfected with EphrinB2 small interfering RNA (EphrinB2-siRNA) (Thermo Fisher Scientific, Inc.). Briefly, SHEDs were seeded on 24-well plates to 80% confluence, RNA-lipid complexes was prepared by mixing 50 μl Opti-MEM Medium (Thermo Fisher Scientific, Inc.) and 3 ml Lipofectamine and RNAiMAX reagent (Invitrogen; Thermo Fisher Scientific, Inc.) together. siRNA 1 μl (10 pmol) was diluted in 50 μl Opti-MEM Medium before being mixed with diluted Lipofectamine and RNAiMAX reagent at a ratio of 1:1. Then the siRNA-lipid complex was incubated for 5 min at room temperature. SHEDs were incubated with the siRNA-lipid complex for 24 h before the shear stress experiments and in vitro Matrigel angiogenesis assay were performed. Quantification of vessel-like structures performed using the Nikon NIS-Elements AR 3.1 imaging software (Kawasaki, Kanagawa, Japan). The tubule length and branching points were measured on x4 magnification images (n=3).

RT-qPCR

Total RNA of different time points were extracted with the RNeasy Plus mini kit (Qiagen GmbH, Hilden, Germany) (18). Sample of total RNA (1.0 μg) was used to synthesize complementary DNA by cDNA Synthesis (SuperScript™ III Reverse Transcriptase, Invitrogen; Thermo Fisher Scientific, Inc.) RT-qPCR was performed with the ABI Prism 7000 Sequence Detection System using fast-SYBR Green (Applied Biosystems; Thermo Fisher Scientific, Inc.), Standards and samples were run in triplicates. Primer sequences were shown in Table I.

Table I

Primer sequences.

Table I

Primer sequences.

GenesPrimers
VEGFF: TTCATGGATGTCTATCAGCG
R: CATCTCTCCTATGTGCTGGC
VEGFR2F: TCAGAAGAACTGAAAACTTTGGAA
R: GAGCCTTCAGATGCCACACACT
DLL4F: TGCAACTGCCCTTATGGCTTTGTG
R: ACAAGTTGTTCATGGCTTCCCTGC
Notch1F: TCCACCAGTTTGAATGGTCA
R: AGCTCATCATCTGGGACAGG
EphrinB2F: TGGATCACCTGAAAATGCTG
R: CGAAATCCCAAACTCCGATA
Hey1F: TGGATCACCTGAAAATGCTG
R: CGAAATCCCAAACTCCGATA
Hey2F: GTGCGGCTTGTGTCTCATCTC
R: CTGCTGCTGCTGCGTTTG
EphB4F: AGAGGCCGTACTGGGACATGAG
R: TCCAGCATGAGCTGGTGGAG
CD31F: CCCAGCCCAGGATTTCTTAT
R: ACCGCAGGATCATTTGAGTT
GAPDHF: GGCATGGACTGTGGTCATGAG
R: TGCACCACCAACTGCTTAGC

[i] F, forward; R, reverse.

Western blot analysis

Cells grown in glass slides were treated with shear stress for 2 h. Then total protein was obtained by using M-PER protein extraction buffer, and quantified using a BCA kit (Thermo Fisher Scientific, Inc.) and separated on 7.5 or 12% polyacrylamide gel followed by transfer onto an ImmunBlot PVDF membrane (GE Healthcare Life Sciences, Little Chalfont, UK). The membranes were blocked for 1 h with 5% BSA in Tris-phosphate buffer containing 0.05% Tween-20 (TBS-T). It was further incubated overnight at 4°C with anti-Notch1 (1:2,000; ab52627), anti-DLL4 (1:1,000; ab7280), anti-Hey1 (2 μg/ml, ab22614), anti-Hey2 (2 μg/ml; ab25404) all from Abcam (MA, USA); anti-EphrinB2 (1:1,000; sc-398735) and anti-EphB4 (1:1,000; sc-130081) both from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA); anti-VEGFR2 (1:2,000; ab39256) and anti-CD31 (1:500; ab28364) both from Abcam, primary antibodies. After three washes (5 min) with TBS-T, membranes were further incubated with HRP-conjugated secondary antibodies: anti-rabbit (cat. no. 7074) or anti-mouse (cat. no. 7076) both from Cell Signaling Technology, Inc., (Danvers, MA, USA) for 1-2 h and followed by three washes with TBS-T. The target protein signal was detected and digitized using ECL (Thermo Fisher Scientific, Inc.).

ELISA

The above collected supernatants were used for VEGF secreted protein detection. The secreted levels of VEGF were quantified using corresponding Human VEGF ELISA kits (DY293B; R&D Systems, Inc.). Briefly, supernatants were centrifuged at 3,500 x g for 5 min, at 4°C to remove any impurity. Microplate strips were removed from the plate frame. Assay Diluent RD1W (50 μl) (R&D Systems, Inc.) was added to each well. Then, 200 μl of VEGF standards, controls, or samples were added to each well. Wells were covered with a plate sealer and incubated at room temperature for 2 h. After 3 washes, 200 μl VEGF conjugate was added and incubated at room temperature for 20 min in the dark followed by adding 50 μl of Stop Solution (R&D Systems, Inc.) to each well. Light absorption values were read within 30 min using a microplate reader (Molecular Devices, San Jose, USA) (450 nm).

Statistical analysis

All experiments were performed in triplicates and repeated at least 3 times. Data are expressed as mean ± standard deviation (SD). One way ANOVA analysis of variance with Tukey's post hoc test was utilized in multiple comparisons between the groups. P-value <0.05 was considered to be statistically significant.

Results

SHEDs show stem cell characteristics

SHEDs displayed a fibroblastic spindle or stellate shape in α-MEM. Flow cytometric analyses revealed high expression levels of CD90, CD73, and CD105, but low expression levels of CD45; 22.8% of the SHED population expressed STRO-1 (Fig. 1A). Mineralization (Fig. 1B), lipid droplets (Fig. 1C) and neurogenic marker βIll-tubulin expression (Fig. 1D) were verified after induction in osteogenic, adipogenic and neurogenic media, respectively.

EphrinB2-siRNA suppresses mRNA and protein expression of EphrinB2

To determine the EphrinB2 expression levels of SHEDs after being incubated with EphrinB2-siRNA, RT-qPCR and western blot analysis were performed. When SHEDs were incubated with EphrinB2-siRNA for 24 and 48 h, both mRNA and protein expression of EphrinB2 was significantly decreased (Fig. 2A–C).

Shear stress enhances the formation of vessel-like structures of SHEDs

Untreated SHEDs seeded on Matrigel cannot form vessel-like structures at any time points (Fig. 3A). Groups treated with shear stress (4 and 16 dynes/cm2) formed a small number of vessel-like structures at 4 h (Fig. 3A). The average total tubule length was more than 5,000 μm (Fig. 3B), and the number of branching points was more than 200 (Fig. 3C). The average total tubule reached about 25,000 μm at 8 h in both treated groups and began to degrade afterwards. When SHEDs were treated with EphrinB2 siRNA (SHEDs-EphrinB2-RNAi), the vessel-like structure formation capacity was restrained (Fig. 3D), with an average total tubule length less than 3,500 μm in each group and the number of branching points less than 120 at 8 h (Fig. 3E and F).

Effect of shear stress on the mRNA expression levels of VEGF, VEGFR2, DLL4, Notchl, Heyl, Hey2, EphrinB2, EphB4 and CD31

Shear stress (4 and 16 dynes/cm2) upregulated the mRNA expression levels of endothelial cell markers (VEGF, VEGFR2, and DLL4) (Fig. 4A–C) and arterial endothelial cell specific markers (Notchl, EphrinB2, Heyl and Hey2) (Fig. 4D–G). However, the venous endothelial cell specific marker expression (EphB4) was downregulated (Fig. 4H). Of note, compared to control groups, mRNA expression levels of VEGF and Notch-1 increased significantly when SHEDs were exposed to 4 dynes/cm2 groups while there was no significant difference in 16 dynes/cm2 groups (Fig. 4A and D). After shear stress treatments, SHEDs were cultured in FBS-free α-MEM supplemented with VEGF (50 ng/ml) for 12 h. The mRNA expression levels of VEGF, VEGFR2, and CD31 were upregulated significantly (Fig. 5A, B and F) while there were no significant changes in mRNA expression levels of EphrinB2 and EphB4 (Fig. 5D and E). Noteworthy, mRNA expression levels of DLL4 decreased significantly when VEGF was added (Fig. 5C).

Effect of shear stress on the protein expression levels of EphrinB2, VEGFR2, EphB4, and CD31 in SHEDs

After shear stress (4 and 16 dynes/cm2) treatment for 2 h, we chose three different protein extraction time points (0, 12, and 24 h) to perform western blot assay. The protein expression level of EphrinB2 was upregulated significantly in shear stress groups (Fig. 6A and B). The protein level of VEGFR2 cannot be detected in non-induced groups but was significantly upregulated in shear stress treatment groups while the protein level of EphB4 was downregulated in shear stress groups (Fig. 6A, C, and D). The protein level of CD31 was significantly upregulated in shear stress treatment groups (Fig. 6A and E). The protein level of Hey2, Notchl, DLL4 and Heyl were upregulated significantly in shear stress groups (Fig. 7A–E).

The secreted levels of VEGF in supernatants

To investigate the mechanisms by which shear stress in promoting the endothelial differentiation of SHEDs, ELISA assay was performed using the Human VEGF Quantikine ELISA kit. The ELISA results showed that the average VEGF protein concentration in supernatants secreted by untreated SHEDs groups was no more than 60 pg/ml. When SHEDs were treated with 4 dynes/cm2 (16 dynes/cm2) shear stress, the secreted levels of VEGF increased to 136.08 pg/ml (118.55 pg/ml), 212.26 pg/ml (189.75 pg/ml), 412.89 pg/ml (245.23 pg/ml), 407.32 pg/ml (248.62 pg/ml), 398.77 pg/ml (217.23 pg/ml) at 0, 4, 8, 12 and 24 h time points (Fig. 8).

Discussion

Previous studies suggested that shear stress could induce arterial specification of endothelial cells derived from human induced pluripotent stem cells (hiPSC-ECs) and SHH-VEGF-Notch-DLL4-EphrinB2 signaling is involved in this process (10,13,14,19). However, some other studies also argued that shear stress failed to induce endothelial differentiation of human adipose tissue mesenchymal stem cells (hASC) (20). Besides, previous research demonstrated that two-dimension (2D) and three-dimension (3D) environments had a different effect on cell differentiation, drug metabolism and gene and protein expression levels. 3D chitos and conduit together with dynamic culture system promoted the cells aggregated into neurosphere-like cells while this effect was not found in 2D culture environment (21,22,23). Our previous studies revealed that TGF-β1 induced differentiation of SHEDs into vascular smooth muscle cells (vSMCs) (24). Also, the decellularized extracellular matrix of human umbilical vein endothelial cells (HUVECs) promoted endothelial differentiation of SHEDs (25). However, the effect of biomechanical force on the differentiation of SHEDs was yet to be demonstrated.

In the present study, we found SHEDs possess unique stem cell characteristics, as high as 22.8% of the SHED population expressed STRO-1, which is the widely-known mesenchymal stem cell (MSC) marker (26). Besides, mineralization, lipid droplets, and neurogenic marker βIII-tubulin expression were verified after induction in osteogenic, adipogenic and neurogenic media, respectively. These findings suggested SHEDs might be a favorable candidate for our study.

To investigate the impact of shear stress on the endothelial differentiation of SHEDs, in vitro matrigel angiogenesis assay was performed as previously described (17). Untreated groups, shear stress (2 h, 4 dynes/cm2) treated groups and shear stress (2 h, 16 dynes/cm2) treated groups were seeded on Matrigel, respectively, tubule length at 4, 8 and 12 h was quantified. Untreated SHEDs seeded on Matrigel cannot form vessel-like structures at any time points, whereas groups treated with shear stress (4 dynes/cm2) formed a small number of vessel-like structures at 4 h. When SHEDs were treated with EphrinB2 siRNA, the vessel-like structure formation capacity was restrained, which indicated that EphrinB2 signaling pathway is involved in the endothelial differentiation process of SHEDs. Of note, compared with 4 dynes/cm2 groups, groups treated with shear stress (16 dynes/cm2) formed less vessel-like structures, which implied that shear stress values of 4 dynes/cm2 performed more effectively in this process.

To further evaluate the endothelial differentiation of SHEDs, RT-qPCR and western blot analysis were performed. After shear stress induction for 2 h, the mRNA expression of VEGF, VEGFR2, EphrinB2, DLL4, Notch1, Hey1 and Hey2 (arterial markers) in SHEDs increased significantly, whereas the expression of EphB4 (venous mark) decreased. The protein expression of Hey1, Hey2, Notch1, DLL4, EphrinB2, VEGFR2 and CD31 was upregulated significantly after shear stress treatment while the protein expression of EphB4 was downregulated, these findings were consistent with previous studies (13,14). When the SHEDs were cultured in FBS-free aMEM combined with or without VEGF (50 ng/ml) for 12 h after shear stress, the mRNA expression of VEGF, VEGFR2, and CD31 was upregulated significantly, while the expression levels of EphrinB2 and EphB4 had no significant changes. We speculated that this might be related to the limited plasticity of post-natal mesenchymal stem cells (27). In addition, arterial marker EphrinB2 and venous marker EphB4 are known to act downstream of the SHH-VEGF-Notch-DLL4-EphrinB2 cascade in arterial-venous specification (10,13,14,19,28). Shear stress for 2 h could not maintain the persistent high expression of mRNA of EphrinB2 and EphB4, even though VEGF (50 ng/ml) was added to the medium. Contrary to Shear stress per treatment, the mRNA expression levels of DLL4 was down-regulated significantly when VEGF was added, suggesting that a negative-feedback loop between VEGF-DLL4/Notch signaling may exist as previously reported (29).

Based on these results, we assumed VEGF-DLL4/Notch1-EphrinB2 cascade took place in this process as previously reported (10,19). To prove our hypothesis, the secreted levels of VEGF at 0, 4, 8, 12, and 24 h in SHED culture supernatants after shear stress were quantified. Results showed that the concentration of VEGF in culture supernatants increased significantly after shear stress. VEGF is known as a strong stimulator of angiogenesis (30,31), it stimulates cellular responses by binding to tyrosine kinase receptors (the VEGFRs) on the cell surface. Among all the VEGFRs, VEGFR-2 (also known as KDR or Flk-1) mediate most of the known cellular responses when activated by VEGF (32). In this study, the protein level of VEGFR2 cannot be detected in non-induced groups but increased significantly in shear stress treatment groups, which implied the signaling pathway mediated by VEGF was activated (30,32,33).

VEGF was reported as an upstream regulator of EphrinB2/EphB4 (34). Both EphrinB2 and EphB4 are expressed on endothelia and mural cells. EphrinB2 exists mainly on arterial endothelia and mural cells, while EphB4 prefers venous ECs. The EphrinB2/Eph4 receptor signaling pathway is known to play a key role in embryonic vascular development (35,36), some regulatory genes including notch-1, VEGF, and DLL4 were reported to act as the upstream regulators of EphrinB2/EphB4 pathway activation (34). VEGF was reported to promote the protein expression of EphrinB2 in two ways: i) VEGF promotes expression of EphrinB2 directly, but can not promote EphrinB2 phosphorylation (37,38); and ii) VEGF activate DLL4/Notch pathway and selectively promote the expression of EphrinB2 (14), thus suggesting that there may exist a cascade among VEGF-DLL4/Notch-EphrinB2 in angiogenesis (39,40). According to previous studies, VEGF was able to downregulate the expression levels of EphB4 in embryonic stem cells, HUVECs and adult ECs (14,33), and the process was reported to be MAPK/ERK-dependent (33). Also, Notch signaling was also reported to inhibit EphB4 expression by overexpressing HERPs (32,42). Besides, inhibition of EphB4 forward signaling was sufficient to inhibit VEGF-induced angiogenesis in vivo (43). Herein, the VEGF-DLL4/Notch-EphrinB2 cascade may inhibit VEGF-induced angiogenesis through EphB4 forward signaling (44), suggesting that EphB4 forward signaling may involve in this negative feedback loop, but more studies have to be done to clarify the mechanisms.

In summary, our data confirmed that shear stress could induce arterial endothelial differentiation of SHEDs. Additionally, VEGF-DLL4/Notch1-EphrinB2 cascade took place in this process as previously demonstrated (10). This finding not only benefits the dental pulp tissue regeneration but also promotes the development of other subjects, such as the treatment of ischemic heart diseases.

Acknowledgments

Not applicable.

Funding

This work was supported by National Natural Science Foundation Youth Science Foundation project, no. 81700954.

Availability of data and materials

The datasets generated or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

PW, SZ and ZL designed the study and conducted the experiments. LW contributed to the acquisition and collection of the data. CY and JX were responsible for analyzing and interpreting the data. PW, CY, JX and SZ drafted the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Gronthos S, Mankani M, Brahim J, Robey PG and Shi S: Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci USA. 97:13625–13630. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Miura M, Gronthos S, Zhao M, Lu B, Fisher LW, Robey PG and Shi S: SHED: Stem cells from human exfoliated deciduous teeth. Proc Natl Acad Sci USA. 100:5807–5812. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Huang GT-J, Sonoyama W, Liu Y, Liu H, Wang S and Shi S: The hidden treasure in apical papilla: The potential role in pulp/dentin regeneration and bioroot engineering. J Endod. 34:645–651. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Zhang Z, Nör F, Oh M, Cucco C, Shi S and Nör JE: Wnt/β-catenin signaling determines the vasculogenic fate of post-natal mesenchymal stem cells. Stem Cells. 34:1576–1587. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Bento LW, Zhang Z, Imai A, Nör F, Dong Z, Shi S, Araujo FB and Nör JE: Endothelial differentiation of SHED requires MEK1/ERK signaling. J Dent Res. 92:51–57. 2013. View Article : Google Scholar :

6 

Dissanayaka WL, Zhu L, Hargreaves KM, Jin L and Zhang C: Scaffold-free prevascularized microtissue spheroids for pulp regeneration. J Dent Res. 93:1296–1303. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Cordeiro MM, Dong Z, Kaneko T, Zhang Z, Miyazawa M, Shi S, Smith AJ and Nör JE: Dental pulp tissue engineering with stem cells from exfoliated deciduous teeth. J Endod. 34:962–969. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Zhang N, Chen B, Wang W, Chen C, Kang J, Deng SQ, Zhang B, Liu S and Han F: Isolation, characterization and multi-lineage differentiation of stem cells from human exfoliated deciduous teeth. Mol Med Rep. 14:95–102. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Qazi TH, Mooney DJ, Pumberger M, Geissler S and Duda GN: Biomaterials based strategies for skeletal muscle tissue engineering: Existing technologies and future trends. Biomaterials. 53:502–521. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Lawson ND, Scheer N, Pham VN, Kim CH, Chitnis AB, Campos-Ortega JA and Weinstein BM: Notch signaling is required for arterial-venous differentiation during embryonic vascular development. Development. 128:3675–3683. 2001.PubMed/NCBI

11 

Welti J, Loges S, Dimmeler S and Carmeliet P: Recent molecular discoveries in angiogenesis and antiangiogenic therapies in cancer. J Clin Invest. 123:3190–3200. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Lee HJ, Li N, Evans SM, Diaz MF and Wenzel PL: Biomechanical force in blood development: extrinsic physical cues drive prohematopoietic signaling. Differentiation. 86:92–103. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Sivarapatna A, Ghaedi M, Le AV, Mendez JJ, Qyang Y and Niklason LE: Arterial specification of endothelial cells derived from human induced pluripotent stem cells in a biomimetic flow bioreactor. Biomaterials. 53:621–633. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Masumura T, Yamamoto K, Shimizu N, Obi S and Ando J: Shear stress increases expression of the arterial endothelial marker ephrinB2 in murine ES cells via the VEGF-Notch signaling pathways. Arterioscler Thromb Vasc Biol. 29:2125–2131. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Obi S, Yamamoto K, Shimizu N, Kumagaya S, Masumura T, Sokabe T, Asahara T and Ando J: Fluid shear stress induces arterial differentiation of endothelial progenitor cells. J Appl Physiol 1985. 106:203–211. 2009. View Article : Google Scholar

16 

Bai K, Huang Y, Jia X, Fan Y and Wang W: Endothelium oriented differentiation of bone marrow mesenchymal stem cells under chemical and mechanical stimulations. J Biomech. 43:1176–1181. 2010. View Article : Google Scholar

17 

Yuan C, Wang P, Zhu L, Dissanayaka WL, Green DW, Tong EH, Jin L and Zhang C: Coculture of stem cells from apical papilla and human umbilical vein endothelial cell under hypoxia increases the formation of three-dimensional vessel-like structures in vitro. Tissue Eng Part A. 21:1163–1172. 2015. View Article : Google Scholar :

18 

Dissanayaka WL, Zhan X, Zhang C, Hargreaves KM, Jin L and Tong EH: Coculture of dental pulp stem cells with endothelial cells enhances osteo-/odontogenic and angiogenic potential in vitro. J Endod. 38:454–463. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Lawson ND, Vogel AM and Weinstein BM: sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation. Dev Cell. 3:127–136. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Bassaneze V, Barauna VG, Lavini-Ramos C, Kalil J, Schettert IT, Miyakawa AA and Krieger JE: Shear stress induces nitric oxide-mediated vascular endothelial growth factor production in human adipose tissue mesenchymal stem cells. Stem Cells Dev. 19:371–378. 2010. View Article : Google Scholar

21 

Su W-T, Shih Y-A and Ko C-S: Effect of chitosan conduit under a dynamic culture on the proliferation and neural differentiation of human exfoliated deciduous teeth stem cells. J Tissue Eng Regen Med. 10:507–517. 2016. View Article : Google Scholar

22 

Su WT, Liao YF, Lin CY and Li LT: Micropillar substrate influences the cellular attachment and laminin expression. J Biomed Mater Res A. 93:1463–1469. 2010.

23 

Su WT: Ex vivo expansion of a hematopoietic stem cell on a murine stromal cell by 3D micro-pillar device. Biomed Microdevices. 13:11–17. 2011. View Article : Google Scholar

24 

Xu JG, Zhu SY, Heng BC, Dissanayaka WL and Zhang CF: TGF-β1-induced differentiation of SHED into functional smooth muscle cells. Stem Cell Res Ther. 8:102017. View Article : Google Scholar

25 

Gong T, Heng BC, Xu J, Zhu S, Yuan C, Lo EC and Zhang C: Decellularized extracellular matrix of human umbilical vein endothelial cells promotes endothelial differentiation of stem cells from exfoliated deciduous teeth. J Biomed Mater Res A. 105:1083–1093. 2017. View Article : Google Scholar : PubMed/NCBI

26 

Ning H, Lin G, Lue TF and Lin CS: Mesenchymal stem cell marker Stro-1 is a 75 kd endothelial antigen. Biochem Biophys Res Commun. 413:353–357. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Alison MR, Poulsom R, Otto WR, Vig P, Brittan M, Direkze NC, Preston SL and Wright NA: Plastic adult stem cells: Will they graduate from the school of hard knocks? J Cell Sci. 116:599–603. 2003. View Article : Google Scholar : PubMed/NCBI

28 

dela Paz NG, Walshe TE, Leach LL, Saint-Geniez M and D'Amore PA: Role of shear-stress-induced VEGF expression in endothelial cell survival. J Cell Sci. 125:831–843. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Noguera-Troise I, Daly C, Papadopoulos NJ, Coetzee S, Boland P, Gale NW, Lin HC, Yancopoulos GD and Thurston G: Blockade of Dll4 inhibits tumour growth by promoting non-productive angiogenesis. Novartis Found Symp. 283:106–125. 2007. View Article : Google Scholar

30 

Liang D, Chang JR, Chin AJ, Smith A, Kelly C, Weinberg ES and Ge R: The role of vascular endothelial growth factor (VEGF) in vasculogenesis, angiogenesis, and hematopoiesis in zebrafish development. Mech Dev. 108:29–43. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Barleon B, Sozzani S, Zhou D, Weich HA, Mantovani A and Marmé D: Migration of human monocytes in response to vascular endothelial growth factor (VEGF) is mediated via the VEGF receptor flt-1. Blood. 87:3336–3343. 1996.PubMed/NCBI

32 

Holmes K, Roberts OL, Thomas AM and Cross MJ: Vascular endothelial growth factor receptor-2: Structure, function, intracellular signalling and therapeutic inhibition. Cell Signal. 19:2003–2012. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Yang C, Guo Y, Jadlowiec CC, Li X, Lv W, Model LS, Collins MJ, Kondo Y, Muto A, Shu C, et al: Vascular endothelial growth factor-A inhibits EphB4 and stimulates delta-like ligand 4 expression in adult endothelial cells. J Surg Res. 183:478–486. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Carmeliet P and Jain RK: Molecular mechanisms and clinical applications of angiogenesis. Nature. 473:298–307. 2011. View Article : Google Scholar : PubMed/NCBI

35 

Bai J, Wang YJ, Liu L and Zhao YL: Ephrin B2 and EphB4 selectively mark arterial and venous vessels in cerebral arteriovenous malformation. J Int Med Res. 42:405–415. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Swift MR and Weinstein BM: Arterial-venous specification during development. Circ Res. 104:576–588. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Pasquale EB: Eph-ephrin bidirectional signaling in physiology and disease. Cell. 133:38–52. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Yang D, Jin C, Ma H, Huang M, Shi GP, Wang J and Xiang M: EphrinB2/EphB4 pathway in postnatal angiogenesis: A potential therapeutic target for ischemic cardiovascular disease. Angiogenesis. 19:297–309. 2016. View Article : Google Scholar : PubMed/NCBI

39 

Hayashi S, Asahara T, Masuda H, Isner JM and Losordo DW: Functional ephrin-B2 expression for promotive interaction between arterial and venous vessels in postnatal neovascularization. Circulation. 111:2210–2218. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Hainaud P, Contrerès JO, Villemain A, Liu LX, Plouet J, Tobelem G and Dupuy E: The role of the vascular endothelial growth factor-Delta-like 4 ligand/Notch4-ephrin B2 cascade in tumor vessel remodeling and endothelial cell functions. Cancer Res. 66:8501–8510. 2006. View Article : Google Scholar : PubMed/NCBI

41 

Salvucci O and Tosato G: Essential roles of EphB receptors and EphrinB ligands in endothelial cell function and angiogenesis. Adv Cancer Res. 114:21–57. 2012. View Article : Google Scholar : PubMed/NCBI

42 

Pitulescu ME and Adams RH: Eph/ephrin molecules - a hub for signaling and endocytosis. Genes Dev. 24:2480–2492. 2010. View Article : Google Scholar : PubMed/NCBI

43 

Xue C, Chen Y, Huang Z, Ge Y, Wang H and Wang J: EphB4 expression in pterygium is associated with microvessel density. Int J Clin Exp Med. 7:4008–4015. 2014.

44 

Kim I, Ryu YS, Kwak HJ, Ahn SY, Oh JL, Yancopoulos GD, Gale NW and Koh GY: EphB ligand, ephrinB2, suppresses the VEGF- and angiopoietin 1-induced Ras/mitogen-activated protein kinase pathway in venous endothelial cells. FASEB J. 16:1126–1128. 2002. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October-2018
Volume 42 Issue 4

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Wang P, Zhu S, Yuan C, Wang L, Xu J and Liu Z: Shear stress promotes differentiation of stem cells from human exfoliated deciduous teeth into endothelial cells via the downstream pathway of VEGF-Notch signaling. Int J Mol Med 42: 1827-1836, 2018.
APA
Wang, P., Zhu, S., Yuan, C., Wang, L., Xu, J., & Liu, Z. (2018). Shear stress promotes differentiation of stem cells from human exfoliated deciduous teeth into endothelial cells via the downstream pathway of VEGF-Notch signaling. International Journal of Molecular Medicine, 42, 1827-1836. https://doi.org/10.3892/ijmm.2018.3761
MLA
Wang, P., Zhu, S., Yuan, C., Wang, L., Xu, J., Liu, Z."Shear stress promotes differentiation of stem cells from human exfoliated deciduous teeth into endothelial cells via the downstream pathway of VEGF-Notch signaling". International Journal of Molecular Medicine 42.4 (2018): 1827-1836.
Chicago
Wang, P., Zhu, S., Yuan, C., Wang, L., Xu, J., Liu, Z."Shear stress promotes differentiation of stem cells from human exfoliated deciduous teeth into endothelial cells via the downstream pathway of VEGF-Notch signaling". International Journal of Molecular Medicine 42, no. 4 (2018): 1827-1836. https://doi.org/10.3892/ijmm.2018.3761