Open Access

Molecular characterization of alterations in the intestinal microbiota of patients with grade 3 hypertension

  • Authors:
    • Nosheen Mushtaq
    • Safdar Hussain
    • Siruo Zhang
    • Lu Yuan
    • Huan Li
    • Shakir Ullah
    • Yan Wang
    • Jiru Xu
  • View Affiliations

  • Published online on: June 6, 2019     https://doi.org/10.3892/ijmm.2019.4235
  • Pages: 513-522
  • Copyright: © Mushtaq et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Hypertension has become a major risk factor for many diseases, including cardiovascular, cerebrovascular and kidney disorders. It has been reported that the composition of human gut microbiota is changed during the progression of cardiovascular and kidney diseases. The current study aimed to qualitatively and quantitatively compare the composition of gut microbiota between patients with hypertension and healthy controls. Fecal samples were collected from 50 patients diagnosed with grade 3 hypertension and 30 healthy controls. Touchdown PCR‑denaturing gradient gel electrophoresis with primers specifically targeting the V3 region of 16S ribosomal RNA, and quantitative PCR, were performed to characterize all the samples. High‑throughput sequencing of the V3‑V4 regions was performed on 30 randomly selected samples. By comparing diversity and richness indices, the gut microbiome of the hypertensive individuals was found to be more diverse than that of the healthy controls. Among the main bacterial phlya that reside in the gut, Bacteroidetes, Firmicutes and Proteobacteria were dominant in all the samples; however the Firmicutes to Bacteroidetes ratio was variable, with a significant increase in the patients with hypertension compared with the healthy control group. In addition, at the genus level, there was an increased abundance of Prevotella_9, Megasphaera, Parasutterella and Escherichia‑Shigella in patients with hypertension, while Bacteroides and Faecalibacterium were decreased. These results suggested that the human gut microbiota is altered in hypertension, and understanding the mechanism of these changes in microbial composition may open up new insights, and help to treat hypertension and other related diseases.

Introduction

Hypertension has become a major factor in the global burden of disease and mortality, contributing to millions of mortalities every year caused by coronary heart disease and stroke (1), peripheral vascular disease, heart failure, chronic kidney disease, cognitive dysfunction and dementia (2). Hypertension remains a critical public health problem despite many developments in the field, and advancements in the diagnosis, management and control of the disease. Despite changes in lifestyle and advancements in pharmacotherapy, the prevalence of hypertension remains high. A survey in 2010 revealed that ~31% of the world's population have hypertension, with more than one billion of these from developing countries (3). Maintaining homeostatic blood pressure (BP) is a complex process regulated by multiple factors, including genetic factors, environmental factors and endocrine regulation in the kidneys. Studies have suggested that human gut microbiota may have a role in the regulation of BP and the pathogenesis of hypertension (4-6) by secreting a variety of microbe-derived bioactive metabolites, such as short-chain fatty acids (7,8).

Metabolomics has identified new pathogenic pathways involved in BP regulation (9,10). However, identifying the causes of hypertension remains challenging due to the heterogenic and complex nature of the disease. The adult human gut microbiome is diverse, being made up of trillions of microorganisms. Generally it is dominated by four phyla: Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria (11). An imbalance in the composition of normal gut microbiota is commonly known as dysbiosis (12). Although all healthy gut microbiota have yet not been fully characterized, increasing evidence from various reports suggests that changes in the ratio of microbial communities, such as Firmicutes and Bacteroidetes (the F/B ratio), can potentially be used as biomarkers identify pathological conditions (13,14). A study using animals and human patients showed that decreased microbial richness, evenness and diversity, and an increased F/B ratio, resulting in gut microbiota dysbiosis, were associated with hypertension (1).

Several studies have reported the effects of probiotics on BP regulation (15-17). A meta-analysis of nine randomized trials showed that a daily dose of ≥109 colony-forming units probiotics significantly decreased both systolic BP (SBP) and diastolic BP (DBP) in human patients with hypertension (15). These data indirectly suggest that gut microbiota may have an important role in maintaining BP homeostasis, and that an imbalance or any change in microbiota composition may potentially be involved in the development of hypertension. Many other studies have suggested that an imbalance in the gut microbiota (or dysbiosis) can result in chronic inflammatory diseases, such as inflammatory bowel disease (encompassing ulcerative colitis and Crohn's disease), asthma, allergies and infectious diseases (18,19), systemic diseases such as diabetes (20), and other pathological conditions, including obesity (21) and malnutrition (22). High-throughput sequencing technologies and other parallel developments in nongenomic techniques have made it possible to elucidate the notable role of gut microbiota in human health and disease.

In the current study, standard metagenomic techniques, such as high-throughput sequencing along with touchdown PCR-denaturing gradient gel electrophoresis (DGGE) and quantitative PCR (qPCR), were used to characterize gut microbial diversity in patients diagnosed with grade 3 hypertension, with healthy volunteers as controls.

Materials and methods

Study participants and design

The present study included 50 hypertensive patients (28 males and 22 females). All of the patients were between 40 and 75 years of age and had grade 3 hypertension [according to the World Health Organization BP classification (Table SI)]. Patients were examined and excluded if they had any other acute or chronic inflammatory or infectious disease. The control group included 30 healthy volunteers (16 males and 14 females, aged 40-70 years). All of the healthy volunteers were in good health with no history of hypertension, or any other cardiovascular or chronic metabolic disease. None of the patients or healthy individuals had a history of taking any antibiotics, probiotics or prebiotics within the preceding 30 days at the time of sampling. Informed written consent was obtained from all participants in the study. The present study was performed with the approval of the Ethical Committee of Xi'an Jiaotong University School of Medical Sciences, under the guidelines of the World Medical Association and the Declaration of Helsinki. Fecal samples were collected in sterile cups and were stored immediately at −80°C until the DNA extraction was carried out.

Biochemical measurements (Data S1)

Blood pressure and lipid profile analysis data for each patient were collected from the Cardiology Department of the 1st Affiliated Hospital of Xi'an Jiaotong University (Table SII). The mean values of each analysis are summarized in Table I.

Table I

Characteristics of study participants.

Table I

Characteristics of study participants.

CharacteristicHTN (n=50)CG (n=30)P-value
Sex (male/female)28/2216/14-
Age, years62.5±10.460.5±110.47
Weight, kg68.4±8.0165.3±5.90.07
SBP, mmHg180.34±15.44122.83±7.6<0.0001
DBP, mmHg106.88±10.179.63±6.8<0.0001
FBG, mmol/l5.05±0.874.22±0.64<0.0001
TC, mmol/l4.07±0.824.34±0.900.17
TG, mmol/l1.48±0.551.10±0.30<0.005
HDL, mmol/l1.04±0.241.10±0.210.21
LDL, mmol/l2.26±0.631.87±0.53<0.05

[i] Data for age, weight, SBP, DBP, FGB, TG, TC, HDL and LDL are presented as the mean ± SD. P-values for age, weight, SBP, DBP, FGB, HDL, LDL, TG and TC were calculated using Student's t-test. SBP, systolic blood pressure; DBP, diastolic blood pressure; FBG, fasting blood glucose; HDL, high density lipoprotein; LDL, low density lipoprotein; TG, total triglyceride; TC, total cholesterol.

DNA extraction

Bacterial DNA was extracted using the Qiagen QIAamp MiniStool kit (Qiagen GmbH), according to the manufacturer's instructions. The concentration of extracted DNA was estimated via the absorbance at 260 nm (A260), and the purity was determined by calculating the A260/A280 ratio with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc.).

PCR-DGGE analysis

Universal primers for the V3 region of the 16S ribosomal (r)RNA gene were used to amplify the bacterial DNA of the study samples, using the fecal DNA as a template for PCR-DGGE analysis. Each 50 µl PCR reaction mixture contained 1 µl of each primer, 1 µl dNTPs (10 mM), 5 µl MgCl2 (25 mM), 5 µl 1X buffer, 0.4 µl Taq DNA polymerase (Takara Bio, Inc.) and 2 µl fecal DNA. PCR amplification was performed in an automated thermocycler (ABI2720; Applied Biosystems; Thermo Fisher Scientific, Inc.) using a touchdown PCR program in order to increase the PCR reaction specificity. The PCR thermal profile conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 35 cycles of 1 min denaturation at 95°C, annealing at 65°C for 1 min and extension at 72°C for 1 min (23). The PCR products were electrophoresed in 1.5% agarose gel stained with ethidium bromide in 1X Tris-acetate EDTA (TAE) buffer for visualization under UV illumination. The primer sequences used for PCR amplification are presented in Table II.

Table II

PCR primers used in the study.

Table II

PCR primers used in the study.

Author, yearAnalysis typeTarget genePrimer sequence (5′-3′)Product size, bp(Refs.)
Muyzer et al, 1993
PCR-DGGE
Bacterial 16s rRNA
gene V3 region
341 Fa CC
534 R
TACGGGAGGCAGCAG
ATTACCGCGGCTGCTGG
193
(23)
Huijsdens et al, 2002qPCR BacteroidesBac F
Bac R
AAGGGAGCGTAGATGGATGTTTA
CGAGCCTCAATGTCAGTTGC
193(68)
Matsuki et al, 2002 PrevotellaPre F
Pre R
ACAGTAAACGATGGATGCC
GGTCGGGTTGCAGACC
513(69)
Bartosch et al, 2004 ClostridiumClos F
Clos R
CGGTACCTGACTAAGAAGC
AGTTTGATTCTTGCGAACG
429(70)
Bartosch et al, 2004Escherichia coliE. coli F
E. coli R
CATTGACGTTACCGCAGAAGAAGC
CTCTACGAGACTCAAGCTTGC
190(70)

a A 5′ GC-clamp (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG) was added for DGGE analysis. F, forward; R, reverse; DGGE, denaturing gradient gel electrophoresis; qPCR, quantitative PCR.

DGGE was executed using the DCode™ Universal Mutation Detection System (Bio-Rad Laboratories, Inc.). Sequence-specific separation of the amplicons was performed using 10% (w/v) polyacrylamide (acrylamide-bis, 37.5:1) gels in 1X TAE buffer, containing 30-65% linear denaturing gradient. Electrophoresis was performed at a constant voltage of 90 V at 60°C for 13 h. The gels were stained with 5 µg/ml ethidium bromide solution for 30 min, washed with deionized water and then viewed under a Bio-Rad Gel Doc 2000 (Bio-Rad Laboratories, Inc.). Comparison of DGGE profiles in the different gels was performed using a standard reference DNA Marker (DL2000; Takara Bio, Inc.) The distinct, prominent and frequent bands were cut from the gels, washed with RNAse-free water, resuspended in 20 µl RNAse-free water and stored at 4°C overnight. PCR was performed again under the aforementioned conditions using V3 region primers 341F/534R, this time without a GC clamp. Re-amplified PCR products were sequenced using the ABI 3500xL system (Applied Biosystems; Thermo Fisher Scientific, Inc.). Sequences were scanned using the Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and Seqmatch (http://rdp.cme.msu.edu/seqmatch/seqmatch_intro.jsp) software to categorize the species or genera.

Statistical analysis of DGGE

Bacterial diversity was evaluated by band number and band intensities in the DGGE profiles using Quantity One software (version 4.6.2; Bio-Rad Laboratories, Inc.). The diversity of taxa in the fecal microbiota was determined by Shannon-Weaver index (H'). Similarity scoring and cluster analysis of DGGE profiles was performed using the UPGMA method based on the Dice similarity coefficient (24). SPSS software (version 20; SPSS, Inc.) was used for the nonparametric statistical analysis. Results are expressed as the mean ± standard deviation.

qPCR analysis

To calculate the absolute copy number of Bacteroides spp., Prevotella spp., Clostridium spp. and Escherichia coli within the test samples, qPCR was performed with a QuantiFast SYBR-Green PCR kit (Qiagen GmbH) using the StepOne v2.3 real-time PCR detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The reaction mixture (20 µl) was composed of 10 µl 2X SYBR-Green PCR mix (Takara Bio, Inc.), 0.8 µl of each specific primer (Table II), 2 µl sample DNA and 6.4 µl sterile deionized water. The total copy number within each sample was calculated by comparing with a standard curve prepared from serially diluted plasmid DNA (of known concentration) ranging from 102 to 108 copies/g of feces. The qPCR data were analyzed using the absolute quantification method (25). For each bacterial group, a partial 16S rRNA gene sequence was amplified with PCR primers (Table II), and was subsequently cloned into the pMD18-T vector using the pMD™18-T Vector Cloning kit (Takara Biotechnology Co., Ltd.), as described previously (26). Negative controls, containing all the elements of the reaction mixture except the template DNA, were run along with each reaction. The resultant bacterial populations were expressed as Log10 bacterial replica counts in 1 g of the fecal mass. Triplicate samples were used in each experiment and the mean values were obtained. Student's t-test was used to calculate the significance (P<0.05) between the two groups. Results are expressed as the mean ± standard deviation.

High-throughput sequencing

A total of 30 fecal samples were randomly selected for high-throughput sequencing and meta-analysis (20 samples from the hypertensive group and 10 from the control group). The V3-V4 region of the 16S rRNA gene was amplified using specific primers: 515-F (5′-GTG CCA GCM GCC GCG GTA A-3′), 806-R (5′-GGA CTA CHV GGG TWT CTA AT-3′), to create the amplicon libraries (27). The libraries were sequenced on an Illumina HiSeq 2500 platform according to the manufacturer's instructions. The raw data obtained were screened and assembled using the QIIME (28) and FLASH (29) software packages. The bacterial sequencing data were grouped into operational taxonomic units (OTUs) at a 97% similarity level against the Greengenes database (30) using UCLUST (31) version 1.2.22q. All of the reads that failed to match the reference sequences were excluded; this is referred to as a 'closed reference' approach to clustering. A representative sequence for each OTU was screened for further annotation. For each representative sequence, the Greengenes database was used based on the RDP classifier (version 2.2) algorithm (32). The α-diversity analysis, including Shannon and Simpson diversity index, Chao1 algorithm, alternating conditional expectations (ACE) algorithm and Good's coverage, was performed with QIIME (version 1.7.0) and displayed using R software (version 2.15.3) (33). Student's t-test was used to calculate the significant differences in α-diversity between the two groups. P<0.05 was considered to indicate a statistically significant difference. Linear discriminant analysis along with effect size measurements was used to examine the differentially significant taxa at each level. The relative abundances of phyla, families, genera and species in each sample were calculated and compared between the two groups. All statistical analyses were carried out using SPSS software (version 20).

Results

Biochemical measurements

The biochemical variables analyzed are shown in Table I. Briefly, the lipid profile data were different between the groups (hypertensive patients vs. healthy controls). Triglycerides, fasting blood glucose and low-density lipoprotein levels were significantly higher in the patients with hypertension compared with healthy controls (P<0.05). There was no significant difference in total cholesterol and high-density lipoprotein between the two groups. However, the SBP and DBP were markedly higher in the patients with hypertension.

DGGE profile analysis of the gut microbial communities

The results from DGGE analysis are shown in Fig. 1A. The DGGE profile band number and the Shannon diversity index (H′) analysis, used to estimate the gut microbial diversity within the two groups, are presented in Table III. The similarity levels of DGGE profiles, measured by the Dice similarity coefficient and unweighted pair group method with arithmetic mean dendrogram, are shown in Fig. 1B. As shown in Table III, the intragroup similarity of the hypertensive group was significantly higher than the healthy control group (P<0.05). Comparing all the samples, the intergroup similarity index was lower than the intragroup similarity index. These results demonstrated that the gut microbiota of the hypertension group were different from the healthy control group. Dominant bands from different positions within the DGGE profiles were further analyzed by sequencing. Bacteroidetes and Firmicutes appeared to be the dominant bacterial phyla within both study groups (Table SIII).

Table III

Microbiota diversity and similarity of the study groups.

Table III

Microbiota diversity and similarity of the study groups.

AnalysisGroup
P-value
HTN (n=29)CG (n=15)
Microbiota diversity
 DGGE bandsa (mean ± SD)21.8±5.8516.3±4.310.22
 Shannon indexb (mean H′/H′ max ± SD)3.01±0.292.72±0.270.72
Microbiota similarity
 Intra-groupc (mean ± SD)30.47±9.4225.86±11.930.001
 Inter-groupd (mean ± SD)24.13±10.01-<0.001

{ label (or @symbol) needed for fn[@id='tfn3-ijmm-44-02-0513'] } Data were analyzed using Student's t-test.

a Number of DGGE bands produced by each sample analyzed.

b Shannon Diversity Index, as calculated using the relative intensities of all DGGE bands in each sample and expressed as a ratio of H′ to H′max, where H′max is the maximum value of the Shannon index for a given sample.

c Dice similarity coefficients comparing DGGE band profiles within individuals of the same group.

d Dice similarity coefficients comparing DGGE band profiles between members of the two groups. HTN, hypertension; CG, control group; DGGE, denaturing gradient gel electrophoresis.

Species-specific qPCR analysis

qPCR analysis was performed to quantify the changes in Bacteroides spp., Prevotella spp., Clostridium spp. and Escherichia coli in fecal samples from the two groups. There was a significant increase in Clostridium spp. and Prevotella spp. in the hypertension group compared with the healthy controls (P<0.05; Table IV). E. coli was also increased in the hypertension group, but was not significantly different compared with the control group. Triplicate samples were used to calculate the mean within each experiment.

Table IV

Analysis of bacterial count by quantitative PCR.

Table IV

Analysis of bacterial count by quantitative PCR.

BacteriaHTN C (mean ± SD)G (mean ± SD)P-value
Bacteroides spp.6.97±1.456.96±1.060.89
Prevotella spp.a5.36±2.035.08±1.580.04
Clostridium spp.a6.78±0.796.59±0.380.02
Escherichia coli5.38±1.114.91±1.010.86

{ label (or @symbol) needed for fn[@id='tfn8-ijmm-44-02-0513'] } Data are reported as the average estimate of logarithms of fecal PCR target genetic amplicon copy numbers present in 1 g of feces.

a Results that are significantly different (Student's t-test; P<0.05). HTN, hypertension; CG, control group.

High-throughput sequencing analysis of gene sequences

The comparative statistics of the PCR sequences were estimated using 1,758,974 amplicons at the V3-V4 site of the 16S rRNA gene from 20 patients with hypertension and 10 healthy controls. Among these, the sum of the high-throughput sequencing reads [1,352,991 (860,339 hypertension and 492,652 healthy control, with an average of 46,654.86 per sample)] passed quality control and were processed for further analysis. The total unique tag counts detected in the hypertension and control groups were 197,167 and 99,191, respectively (with an average of 10,219.24 for all samples). The total number of OTUs assigned was 5,566 (3,653 hypertension and 1,913 healthy control, with an average of 192 per sample). The sum of the unique tags from the two groups was 296,358, which revealed the total phylotypes in the present study, and after deletion of linkage primers, the length of the average sequence was 421 bp.

Gut microbial diversity and composition

The richness and diversity of the microbial community were calculated at the 97% similarity level. Rarefaction curves indicated that the microbial communities were well represented for most of the samples, and there were no obvious differences in the rarefaction curves between the two groups (Fig. S1). The number (mean) of bacterial OTUs and the observed species were higher in the hypertension group compared with the healthy control group (Table V). Good's coverage was ~99% for all sequences, indicating that the 16S rRNA sequences identified in the two groups were the major bacterial sequences present in the study samples. The α-diversity, determined using the nonparametric ACE and Chao1 algorithms, was significantly higher in the hypertension group than in the healthy individuals (P=0.02 and P=0.03, respectively). The study samples were divided into two clusters, based on UniFrac metrics (Fig. 2).

Table V

Gut bacterial richness and diversity index at 97% similarity, analyzed by high-throughput sequencing.

Table V

Gut bacterial richness and diversity index at 97% similarity, analyzed by high-throughput sequencing.

IndexGroup
P-value
HTNCG
Observed species182.6169.70.3
OTUs209.3191.30.12
Shannon4.364.250.63
Simpson0.890.880.88
Chao1a225.7192.730.03
ACEa226.1194.980.02
Good's coverage0.99880.99881.000

{ label (or @symbol) needed for fn[@id='tfn10-ijmm-44-02-0513'] } Numbers represent the mean values.

a Results which are significantly different (Student's t-test; P<0.05). HTN, hypertension; CG, control group; OTUs, operational taxonomic units; ACE, alternating conditional expectations.

Gut microbiota distribution at the phylum level

The bacterial composition was assessed on a taxonomic basis at the phylum, family, genus and species levels, and the taxa that accounted for >1-0.5% were considered. With respect to the 15 phyla sequenced, the composition of the gut microbiota was different in the two study groups (Fig. 3A). The dominant phyla in all samples were Bacteroidetes (56.58%), Firmicutes (33.89%), Proteobacteria (6.74%) and Actinobacteria (1.99%), but the only statistically significant quantitative difference between the two groups was in the F/B ratio, which was significantly increased in the hypertension group (P=0.02) compared with the control group (Fig. 3B). Statistical data of the top 10 phyla are presented in Table SIV. Linear discriminant analysis and effect size measurement was performed, and it was demonstrated that the most differentially abundant bacterial taxa in patients with hypertension were from the phylum Firmicutes (Fig. 4).

Gut microbial distribution at the family level

At the family level, 76 families were sequenced. Among the 10 most prevalent families, Prevotellaceae, Veillonellaceae and Lachnospiraceae were increased in the hypertension group compared with the control group (Fig. 5). In these families, the relative abundance of Bacteroidaceae was lower in patients with hypertension compared with healthy controls. Quantitative differences at the family level are presented in Table SIV.

Gut microbial distribution at the genus level

The high-throughput sequencing identified 175 different genera in the samples. Among the 10 top most prevalent genera, the abundance of Prevotella_9, Megasphaera, Parasutterella and Escherichia-Shigella was significantly increased in the patients with hypertension compared with the healthy control group (Fig. 6). Quantitative differences at the genus level are presented in Table SIV.

Gut microbial distribution at the species level

Faecalibacterium prausnitzii, which accounts for up to 14% of the total fecal microbiota and has been reported to be the major source of butyrate-producing bacteria (34), was significantly reduced in the hypertension group. Other important butyrate-producing bacterial species in the human colon, such as Roseburia inulinivorans and Anaerostipes hadrus, were reduced in the hypertension group, although not to a significant level. In addition, Bacteroides uniformis was also reduced in the hypertension group compared with the healthy controls, while Phascolarctobacterium faecium was increased in patients with hypertension. No significant differences among Klebsiella spp., Streptococcus spp. and Parabacteroides merdae were observed in our study groups (data not shown). These results suggested that there was considerable dissimilarity between the hypertension and healthy control groups at the species level. The bacterial composition as evaluated by high-throughput sequencing at the species level is presented in Table SV.

Comparative evaluation of analytical techniques used

In the current study, the gut microbiota analysis was performed using three molecular techniques. DGGE and high-throughput sequencing detected the same dominant bacteria, mainly Bacteriodetes and Firmicutes; however, high-throughput sequencing revealed more diversity among bacterial communities and a greater number of phylotypes than PCR-DGGE. The results of qPCR and high-throughput sequencing illustrated the same variations in the composition of the total bacterial community. Overall, the results from the three analytical techniques were in general concordance.

Discussion

Balance in the gut microbiota is key for maintaining intestinal immunity and homeostasis. A fluctuation in this balance may lead to destructive pathophysiological outcomes (35). Hypertension is the most important, modifiable and potentially reversible risk factor for stroke in all age groups, and is closely associated with SBP and DBP, particularly in patients who experience intracerebral hemorrhage (36,37). The current study focused on molecular characterization of the gut microbiota from patients with hypertension, compared with healthy controls. The compositional characteristics of the gut microbiota in the two groups were determined by PCR-DGGE analysis targeting the V3 region of the bacterial 16S rRNA gene with imaging and sequencing, qPCR followed by statistical analysis, and high-throughput sequencing of randomly selected samples from the two groups. The α-diversity, measured by the nonparametric ACE and Chao1 algorithms, was significantly higher in the hypertension group, while the Shannon and Simpson index did not indicate significant differences between the two groups. The gut microbiota distribution was analyzed at the phylum, genus and species levels, and variations between the hypertension and control groups were observed.

Firmicutes, Bacteroidetes and Proteobacteria were the dominant phyla in all the samples, with variable proportions between the two groups. There was a significant difference in the F/B ratio between the groups, with an increased ratio in the hypertension group compared with the control group. An increased F/B ratio, due to an increase in Firmicutes or a decline in Bacteroidetes counts, is broadly considered to be an indicator of gut microbiota dysbiosis and is associated with obesity, diabetes mellitus and cardiovascular disease (15,21,38). The F/B ratio is well validated in rodent and human samples; however, in pig models it requires further confirmation (39,40). These findings clearly indicated the role of the F/B ratio in the pathophysiology of hypertension. Spirochaetes were also increased in the hypertension group; however, this phylum was a very small proportion of the total population (0.03%).

Phascolarctobacterium spp. and Veillonellaceae belong to the same class within the Firmicutes phylum and produce high quantities of short chain fatty acids, acetate and propionate (41,42). The butyrate produced is predominantly used by colonocytes, while acetate and propionate are largely taken up by the liver. Acetate promotes hypercholesterolemia and hypertriglyceridemia, and results in liver steatosis, as it used for cholesterol and fatty acid production (43). Members of the Veillonellaceae family are generally responsible for polymicrobial infections, such as osteoarticular infections or endocarditis, and are rarely associated with monomicrobial infections in humans (44). In the present study, there was an increased abundance of the Veillonellaceae family in patients with hypertension compared with the control group.

At the genus level, there was an increased in the abundance of Prevotella _9, Megasphaera, Parasutterella and Escherichia-Shigella in the hypertension group, as compared with the healthy control group. It has previously been reported that the expansion of Prevotella copri, an intestinal bacterium, is associated with enhanced susceptibility to arthritis (45,46). Prevotella copri express a superoxide reductase and phosphoadenosine phosphosulfate reductase that may promote the development of inflammation. Furthermore, Prevotella copri was shown to enhance body weight loss and aggravate epithelial inflammation in a mouse model of colitis (45). Prevotella was overrepresented in individuals with hypertension in the present study, which is consistent with a previous study by Li et al (47), which indicated that these organisms may be increased as a response to hypertension; further investigations may strengthen the association of this bacteria with hypertension. Previous studies have shown that Parasutterella is increased by sugar and alcohol consumption (48,49). An increased abundance of Parasutterella in the gut is associated with dysbiosis, or a lack of microbial diversity (50,51). It has been reported Parasutterella is increased in the submucosa of the ileum in patients with Crohn's disease (50) and in rodents with hypertriglyceridemia-related acute necrotizing pancreatitis (51). However, Parasutterella is a relatively a new discovery, and additional research is required to further establish its role in hypertension and gut microbial dysbiosis. Escherichia-Shigella is closely genetically related to E. coli and produces Shiga-toxin that can cause various afflictions, including hemorrhagic colitis, septicemia, severe gastrointestinal tract inflammations in the ileocolonic area, thrombocytopenia, problems in urinary duct channels and hemolytic uremic syndrome (52).

At the species level, the data of the current study demonstrated that Faecalibacterium prausnitzii and Bacteroides uniformis were significantly decreased in the patients with hypertension compared with the healthy control group. Faecalibacterium prausnitzii, the sole known species of the Faecalibacterium genus, is one of the most common gut bacteria, which represents >10% of the intestinal microbiota in healthy individuals. It is reported to boost the immune system and serve as an anti-inflammatory agent (53). Low or depleted levels of F. prausnitzii are associated with inflammation and observed in a number of diseases, including inflammatory bowel diseases such as Crohn's (54). Increased gut microbial diversity with enrichment of bacterial colonies that produce metabolites such as short-chain fatty acids is favorable and helps to maintain normal physiological homeostasis (5). Faecalibacteria produce butyrate and other short-chain fatty acids through the fermentation of dietary fiber. Butyrate is considered to be one of the most useful short-chain fatty acids that benefits human health via several mechanisms; it reduces the inflammation in adipose tissue and the intestine (55), protects against obesity (induced by food) (56) and cardiovascular disease (57), and improves insulin sensitivity in patients with type 2 diabetes mellitus (58,59). Yan et al (60) reported that Klebsiella spp., Streptococcus spp. and Parabacteroides merdae were frequently distributed in hypertensive gut microbiota, but in our study groups no significant differences among these bacteria were observed. The current study revealed the relative predominance of various microbial populations in the gut at the phylum, genus and species levels in fecal samples from patients with grade 3 hypertension and the healthy controls. The findings illustrate a clear disparity between the study groups, and population comparisons revealed a clear difference in the intestinal microbial populations between the hypertension and healthy control groups.

Limitations of the present study include the difficulty of obtaining the human intestinal contents for microbial community analysis. Ideally, mucosal biopsy samples should be used instead of stool samples, as mucosal microbiota may differ from stool microbiota. However, mucosal sampling presents practical challenges, including disruption of the biofilm when the biopsy is performed and the effect of bowel preparation prior to colonoscopy on the microbiota (61,62). Stool samples are therefore used as a proxy for the study of the gut microbiota as these samples are easier to collect than biopsy samples, especially in healthy volunteers. However, animal experiments need to be performed and the gut microbiota of patients with hypertension may be transplanted into germ-free animals to verify the association of gut dysbiosis with hypertension. Diet is considered another important factor influencing the gut microbial community. In the present study, it was not possible to evaluate the relationship between the gut microbiota and dietary habits of the participants because of the incomplete nutritional information. However, the conclusions are unlikely to be affected by this potential confounding factor, due to likely similar dietary habits and lifestyles of the enrolled subjects from Xi'an, China.

The findings from the DGGE and high-throughput sequencing were consistent and stable. PCR-DGGE is a useful molecular fingerprinting method to qualitatively analyze bacterial communities, especially in the identification of dominant bacteria within a sample. DGGE is fast and multiple samples can be analyzed simultaneously (63). However, it is a semi-quantitative technique and does not give direct phylogenetic identification; thus, it is not optimized for numerical assessment of gut microbiota components (64). When qPCR is used in combination with DGGE, it can provide more detailed information on the diversity and abundance of the gut microbiota (65-67). Metagenomics is the most recent development in the study of the gut microbiota. It is a more sensitive, advanced and authenticated technique, and may be more suitable for examining the microbial ecology. Despite being comparatively expensive, metagenomic techniques have the advantages that they are high throughput, phylogenetically characterize the microbiota components, and quantify the relative proportions of organisms present. On the other hand, PCR-DGGE analysis may be useful as a preliminary test to analyze larger shifts in the bacterial community, as it is economical and less time consuming than high-throughput sequencing.

In conclusion, the findings of current study revealed that the gut microbiota composition was different in the patients with hypertension compared with the healthy control group. More specifically, there was a significant difference in the similarity of bacterial populations, with a significantly increased F/B ratio in the patients with hypertension. It was concluded that hypertension-associated gut dysbiosis is characterized by an imbalance in the normal gut flora. Understanding the fluctuations in microbial composition, and the F/B ratio in particular, may help to identify potential biomarkers for hypertension and other related diseases.

Supplementary Data

Acknowledgments

The authors would like to thank Dr Lei Jine (Department of Pathology, First Affiliated Hospital of Xi'an Jiaotong University) for providing the samples from the grade 3 hypertensive patients. The authors are indebted to the Center for Disease Control and Prevention of Shaanxi Province for the equipment and technical support.

Funding

This project was funded by the National Natural Science Foundation of China (grant no. NSFC81730056).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

NM designed and executed the experiments, analyzed the data and wrote the manuscript. SH helped in the analyses and interpretation of data. SZ, LY, HL, SU, YW helped perform the experiments. JX conceived and designed the study, critically reviewed and drafted the manuscript and take responsibility for the integrity of the work as a whole. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Informed written consent was obtained from all participants in the study. The present study was performed with the approval of the Ethical Committee of Xi'an Jiaotong University School of Medical Sciences, under the guidelines of the World Medical Association and the Declaration of Helsinki.

Patient consent for publication

Informed written consent for publication was obtained from all the participants.

Competing interests

The authors declare that they have no competing interests.

References

1 

Lim SS, Vos T, Flaxman AD, Danaei G, Shibuya K, Adair-Rohani H, Amann M, Anderson HR, Andrews KG, Aryee M, et al: A comparative risk assessment of burden of disease and injury attributable to 67 risk factors and risk factor clusters in 21 regions, 1990-2010: A systematic analysis for the global burden of disease study 2010. Lancet. 380:2224–2260. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Lackland DT and Weber MA: Global burden of cardiovascular disease and stroke: Hypertension at the core. Can J Cardiol. 31:569–571. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Mills KT, Bundy JD, Kelly TN, Reed JE, Kearney PM, Reynolds K, Chen J and He J: Global disparities of hypertension prevalence and control: A systematic analysis of population-based studies from 90 countries. Circulation. 134:441–450. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Durgan DJ, Ganesh BP, Cope JL, Ajami NJ, Phillips SC, Petrosino JF, Hollister EB and Bryan RM Jr: Role of the gut microbiome in obstructive sleep apnea-induced hypertension. Hypertension. 67:469–474. 2016. View Article : Google Scholar :

5 

Yang T, Santisteban MM, Rodriguez V, Li E, Ahmari N, Carvajal JM, Zadeh M, Gong M, Qi Y, Zubcevic J, et al: Gut dysbiosis is linked to hypertension. Hypertension. 65:1331–1340. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Mell B, Jala VR, Mathew AV, Byun J, Waghulde H, Zhang Y, Haribabu B, Vijay-Kumar M, Pennathur S and Joe B: Evidence for a link between gut microbiota and hypertension in the Dahl rat. Physiol Genomics. 47:187–197. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Nutting CW, Islam S and Daugirdas JT: Vasorelaxant effects of short chain fatty acid salts in rat caudal artery. Am J Physiol. 261:H561–H567. 1991.PubMed/NCBI

8 

Pluznick JL, Zou DJ, Zhang X, Yan Q, Rodriguez-Gil DJ, Eisner C, Wells E, Greer CA, Wang T, Firestein S, et al: Functional expression of the olfactory signaling system in the kidney. Proc Natl Acad Sci USA. 106:2059–2064. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Galla S, Chakraborty S, Mell B, Vijay-Kumar M and Joe B: Microbiotal-host interactions and hypertension. Physiology (Bethesda). 32:224–233. 2017.

10 

Menni C, Graham D, Kastenmuller G, Alharbi NH, Alsanosi SM, McBride M, Mangino M, Titcombe P, Shin SY, Psatha M, et al: Metabolomic identification of a novel pathway of blood pressure regulation involving hexadecanedioate. Hypertension. 66:422–429. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Thursby E and Juge N: Introduction to the human gut microbiota. Biochem J. 474:1823–1836. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Sekirov I, Russell SL, Antunes LC and Finlay BB: Gut micro-biota in health and disease. Physiol Rev. 90:859–904. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Sanz Y and Moya-Perez A: Microbiota, inflammation and obesity. Adv Exp Med Biol. 817:291–317. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Mariat D, Firmesse O, Levenez F, Guimarăes V, Sokol H, Doré J, Corthier G and Furet JP: The firmicutes/bacteroidetes ratio of the human microbiota changes with age. BMC Microbiol. 9:1232009. View Article : Google Scholar : PubMed/NCBI

15 

Khalesi S, Sun J, Buys N and Jayasinghe R: Effect of probiotics on blood pressure: A systematic review and meta-analysis of randomized, controlled trials. Hypertension. 64:897–903. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Mann GV: Studies of a surfactant and cholesteremia in the Maasai. Am J Clinl Nutr. 27:464–469. 1974. View Article : Google Scholar

17 

Kiessling G, Schneider J and Jahreis G: Long-term consumption of fermented dairy products over 6 months increases HDL cholesterol. Eur J Clin Nutr. 56:843–849. 2002. View Article : Google Scholar : PubMed/NCBI

18 

Collado MC, Rautava S, Isolauri E and Salminen S: Gut micro-biota: A source of novel tools to reduce the risk of human disease? Pediatr Res. 77:182–188. 2015. View Article : Google Scholar

19 

Frank DN, St Amand AL, Feldman RA, Boedeker EC, Harpaz N and Pace NR: Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc Natl Acad Sci USA. 104:13780–13785. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, Nielsen T, Pons N, Levenez F, Yamada T, et al: A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464:59–65. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Ley RE, Turnbaugh PJ, Klein S and Gordon JI: Microbial ecology: Human gut microbes associated with obesity. Nature. 444:1022–1023. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Kau AL, Ahern PP, Griffin NW, Goodman AL and Gordon JI: Human nutrition, the gut microbiome and the immune system. Nature. 474:327–336. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Muyzer G, de Waal EC and Uitterlinden AG: Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol. 59:695–700. 1993.PubMed/NCBI

24 

Fromin N, Hamelin J, Tarnawski S, Roesti D, Jourdain-Miserez K, Forestier N, Teyssier-Cuvelle S, Gillet F, Aragno M and Rossi P: Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns. Environ Microbiol. 4:634–643. 2002. View Article : Google Scholar : PubMed/NCBI

25 

Lu Y, Xie L and Chen J: A novel procedure for absolute real-time quantification of gene expression patterns. Plant Methods. 8:92012. View Article : Google Scholar : PubMed/NCBI

26 

Sun H, Tang JW, Fang CL, Yao XH, Wu YF, Wang X and Feng J: Molecular analysis of intestinal bacterial microbiota of broiler chickens fed diets containing fermented cottonseed meal. Poult Sci. 92:392–401. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Peiffer JA, Spor A, Koren O, Jin Z, Tringe SG, Dangl JL, Buckler ES and Ley RE: Diversity and heritability of the maize rhizosphere microbiome under field conditions. Proc Natl Acad Sci USA. 110:6548–6553. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Peña AG, Goodrich JK, Gordon JI, et al: QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7:335–336. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Magoc T and Salzberg SL: FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics. 27:2957–2963. 2011. View Article : Google Scholar : PubMed/NCBI

30 

DeSantis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL, Keller K, Huber T, Dalevi D, Hu P and Andersen GL: Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72:5069–5072. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Edgar RC: Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26:2460–2461. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Wang Q, Garrity GM, Tiedje JM and Cole JR: Naive bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. App Environ Microbiol. 73:5261–5267. 2007. View Article : Google Scholar

33 

Team RC: R: A language and environment for statistical computing. R foundation for statistical computing; Vienna, Austria: 2012

34 

De Vuyst L, Moens F, Selak M, Riviere A and Leroy F: Summer meeting 2013: Growth and physiology of bifidobacteria. J Appl Microbiol. 116:477–491. 2014. View Article : Google Scholar

35 

Kearney PM, Whelton M, Reynolds K, Whelton PK and He J: Worldwide prevalence of hypertension: A systematic review. J Hypertens. 22:11–19. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Arima H, Chalmers J, Woodward M, Anderson C, Rodgers A, Davis S, Macmahon S and Neal B; PROGRESS Collaborative Group: Lower target blood pressures are safe and effective for the prevention of recurrent stroke: The PROGRESS trial. J Hyperten. 24:1201–1208. 2006. View Article : Google Scholar

37 

Goldstein LB, Adams R, Alberts MJ, Appel LJ, Brass LM, Bushnell CD, Culebras A, Degraba TJ, Gorelick PB, Guyton JR, et al: Primary prevention of ischemic stroke: A guideline from the american heart association/American stroke association stroke council: Cosponsored by the atherosclerotic peripheral vascular disease interdisciplinary working group; cardiovascular nursing council; clinical cardiology council; nutrition, physical activity, and metabolism council; and the quality of care and outcomes research interdisciplinary working group: The American academy of neurology affirms the value of this guideline. Stroke. 37:1583–1633. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Tilg H and Kaser A: Gut microbiome, obesity, and metabolic dysfunction. J Clin Invest. 121:2126–2132. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Duca FA, Sakar Y, Lepage P, Devime F, Langelier B, Doré J and Covasa M: Replication of obesity and associated signaling pathways through transfer of microbiota from obese-prone rats. Diabetes. 63:1624–1636. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Pedersen R, Andersen AD, Molbak L, Stagsted J and Boye M: Changes in the gut microbiota of cloned and non-cloned control pigs during development of obesity: Gut microbiota during development of obesity in cloned pigs. BMC Microbiol. 13:302013. View Article : Google Scholar : PubMed/NCBI

41 

Duncan SH, Holtrop G, Lobley GE, Calder AG, Stewart CS and Flint HJ: Contribution of acetate to butyrate formation by human faecal bacteria. Br J Nutr. 91:915–923. 2004. View Article : Google Scholar : PubMed/NCBI

42 

Watanabe Y, Nagai F and Morotomi M: Characterization of Phascolarctobacterium succinatutens sp. Nov.an asaccharolytic, succinate-utilizing bacterium isolated from human feces. Appl Environ Microbiol. 78:511–518. 2012. View Article : Google Scholar :

43 

Wong JM, de Souza R, Kendall CW, Emam A and Jenkins DJ: Colonic health: Fermentation and short chain fatty acids. J Clin Gastroenterol. 40:235–243. 2006. View Article : Google Scholar : PubMed/NCBI

44 

Marchandin H and Jumas-Bilak E: The family Veillonellaceae: The prokaryotes: Firmicutes and tenericutes. Rosenberg E, DeLong EF, Lory S, Stackebrandt E and Thompson F: Springer, Berlin Heidelberg; Berlin, Heidelberg: pp. 433–453. 2014

45 

Hofer U: Microbiome: Anelloviridae go viral. Nat Rev Microbiol. 12:4–5. 2014. View Article : Google Scholar

46 

Scher JU, Sczesnak A, Longman RS, Segata N, Ubeda C, Bielski C, Rostron T, Cerundolo V, Pamer EG, Abramson SB, et al: Expansion of intestinal Prevotella copri correlates with enhanced susceptibility to arthritis. ELife. 2:e012022013. View Article : Google Scholar : PubMed/NCBI

47 

Li J, Zhao F, Wang Y, Chen J, Tao J, Tian G, Wu S, Liu W, Cui Q, Geng B, et al: Gut microbiota dysbiosis contributes to the development of hypertension. Microbiome. 5:142017. View Article : Google Scholar : PubMed/NCBI

48 

Zhang X, Wang H, Yin P, Fan H, Sun L and Liu Y: Flaxseed oil ameliorates alcoholic liver disease via anti-inflammation and modulating gut microbiota in mice. Lipids Health Dis. 16:442017. View Article : Google Scholar : PubMed/NCBI

49 

Noble EE, Hsu TM, Jones RB, Fodor AA, Goran MI and Kanoski SE: Early-life sugar consumption affects the rat micro-biome independently of obesity. J Nutr. 147:20–28. 2017. View Article : Google Scholar

50 

Chiodini RJ, Dowd SE, Chamberlin WM, Galandiuk S, Davis B and Glassing A: Microbial population differentials between mucosal and submucosal intestinal tissues in advanced crohn's disease of the ileum. PLoS One. 10:e01343822015. View Article : Google Scholar : PubMed/NCBI

51 

Huang C, Chen J, Wang J, Zhou H, Lu Y, Louz L, Zheng J, Tian L, Wang X, Cao Z and Zeng Y: Dysbiosis of intestinal microbiota and decreased antimicrobial peptide level in paneth cells during hypertriglyceridemia-related acute necrotizing pancreatitis in rats. Front Microbiol. 8:7762017. View Article : Google Scholar : PubMed/NCBI

52 

Amani J, Ahmadpour A, Imani Fooladi AA and Nazarian S: Detection of E. coli O157:H7 and Shigella dysenteriae toxins in clinical samples by PCR-ELISA. Braz J Infect Dis. 19:278–284. 2015. View Article : Google Scholar : PubMed/NCBI

53 

Miquel S, Martin R, Rossi O, Bermúdez-Humarán LG, Chatel JM, Sokol H, Thomas M, Wells JM and Langella P: Faecalibacterium prausnitzii and human intestinal health. Curr Opin Microbiol. 16:255–261. 2013. View Article : Google Scholar : PubMed/NCBI

54 

Cao Y, Shen J and Ran ZH: Association between Faecalibacterium prausnitzii reduction and inflammatory bowel disease: A meta-analysis and systematic review of the literature. Gastroenterol Res Pract. 2014:8727252014. View Article : Google Scholar : PubMed/NCBI

55 

Vinolo MA, Rodrigues HG, Nachbar RT and Curi R: Regulation of inflammation by short chain fatty acids. Nutrients. 3:858–876. 2011. View Article : Google Scholar

56 

Lin HV, Frassetto A, Kowalik EJ Jr, Nawrocki AR, Lu MM, Kosinski JR, Hubert JA, Szeto D, Yao X, Forrest G and Marsh DJ: Butyrate and propionate protect against diet-induced obesity and regulate gut hormones via free fatty acid receptor 3-independent mechanisms. PLoS One. 7:e352402012. View Article : Google Scholar : PubMed/NCBI

57 

Berni Canani R, Di Costanzo M and Leone L: The epigenetic effects of butyrate: Potential therapeutic implications for clinical practice. Clin Epigenetics. 4:42012. View Article : Google Scholar : PubMed/NCBI

58 

Henagan TM, Stefanska B, Fang Z, Navard AM, Ye J, Lenard NR and Devarshi PP: Sodium butyrate epigenetically modulates high-fat diet-induced skeletal muscle mitochondrial adaptation, obesity and insulin resistance through nucleosome positioning. Br J Pharmacol. 172:2782–2798. 2015. View Article : Google Scholar : PubMed/NCBI

59 

Gao Z, Yin J, Zhang J, Ward RE, Martin RJ, Lefevre M, Cefalu WT and Ye J: Butyrate improves insulin sensitivity and increases energy expenditure in mice. Diabetes. 58:1509–1517. 2009. View Article : Google Scholar : PubMed/NCBI

60 

Yan Q, Gu Y, Li X, Yang W, Jia L, Chen C, Han X, Huang Y, Zhao L, Li P, et al: Alterations of the gut microbiome in hypertension. Front Cell Infect Microbiol. 7:3812017. View Article : Google Scholar : PubMed/NCBI

61 

Zoetendal EG, von Wright A, Vilpponen-Salmela T, Ben-Amor K, Akkermans AD and de Vos WM: Mucosa-associated bacteria in the human gastrointestinal tract are uniformly distributed along the colon and differ from the community recovered from feces. Appl Environ Microbiol. 68:3401–3407. 2002. View Article : Google Scholar : PubMed/NCBI

62 

Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, Gill SR, Nelson KE and Relman DA: Diversity of the human intestinal microbial flora. Science. 308:1635–1638. 2005. View Article : Google Scholar : PubMed/NCBI

63 

Muyzer G: DGGE/TGGE a method for identifying genes from natural ecosystems. Curr Opin Microbiol. 2:317–322. 1999. View Article : Google Scholar : PubMed/NCBI

64 

Rinttila T, Kassinen A, Malinen E, Krogius L and Palva A: Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol. 97:1166–1177. 2004. View Article : Google Scholar : PubMed/NCBI

65 

Ponnusamy K, Choi JN, Kim J, Lee SY and Lee CH: Microbial community and metabolomic comparison of irritable bowel syndrome faeces. J Med Microbiol. 60:817–827. 2011. View Article : Google Scholar : PubMed/NCBI

66 

Jalanka-Tuovinen J, Salonen A, Nikkila J, Immonen O, Kekkonen R, Lahti L, Palva A and de Vos WM: Intestinal micro-biota in healthy adults: Temporal analysis reveals individual and common core and relation to intestinal symptoms. PLoS One. 6:e230352011. View Article : Google Scholar

67 

Zwielehner J, Liszt K, Handschur M, Lassl C, Lapin A and Haslberger AG: Combined PCR-DGGE fingerprinting and quantitative-PCR indicates shifts in fecal population sizes and diversity of Bacteroides, bifidobacteria and Clostridium cluster IV in institutionalized elderly. Exp Gerontol. 44:440–446. 2009. View Article : Google Scholar : PubMed/NCBI

68 

Huijsdens XW, Linskens RK, Mak M, Meuwissen SG, Vandenbroucke-Grauls CM and Savelkoul PH: Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR. J Clin Microbiol. 40:4423–4427. 2002. View Article : Google Scholar : PubMed/NCBI

69 

Matsuki T, Watanabe K, Fujimoto J, Miyamoto Y, Takada T, Matsumoto K, Oyaizu H and Tanaka R: Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl Environ Microbiol. 68:5445–5451. 2002. View Article : Google Scholar : PubMed/NCBI

70 

Bartosch S, Fite A, Macfarlane GT and McMurdo ME: Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Appl Environ Microbiol. 70:3575–3581. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

August-2019
Volume 44 Issue 2

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Mushtaq N, Hussain S, Zhang S, Yuan L, Li H, Ullah S, Wang Y and Xu J: Molecular characterization of alterations in the intestinal microbiota of patients with grade 3 hypertension. Int J Mol Med 44: 513-522, 2019.
APA
Mushtaq, N., Hussain, S., Zhang, S., Yuan, L., Li, H., Ullah, S. ... Xu, J. (2019). Molecular characterization of alterations in the intestinal microbiota of patients with grade 3 hypertension. International Journal of Molecular Medicine, 44, 513-522. https://doi.org/10.3892/ijmm.2019.4235
MLA
Mushtaq, N., Hussain, S., Zhang, S., Yuan, L., Li, H., Ullah, S., Wang, Y., Xu, J."Molecular characterization of alterations in the intestinal microbiota of patients with grade 3 hypertension". International Journal of Molecular Medicine 44.2 (2019): 513-522.
Chicago
Mushtaq, N., Hussain, S., Zhang, S., Yuan, L., Li, H., Ullah, S., Wang, Y., Xu, J."Molecular characterization of alterations in the intestinal microbiota of patients with grade 3 hypertension". International Journal of Molecular Medicine 44, no. 2 (2019): 513-522. https://doi.org/10.3892/ijmm.2019.4235