Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
August 2012 Volume 41 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August 2012 Volume 41 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Promoter methylation of RASSF1A modulates the effect of the microtubule-targeting agent docetaxel in breast cancer

Retraction in: /10.3892/ijo.2025.5745
  • Authors:
    • Eun Young Gil
    • Uk Hyun Jo
    • Hoiseon Jeong
    • Young Mi Whang
    • Ok Hee Woo
    • Kyu Ran Cho
    • Jae Hong Seo
    • Aeree Kim
    • Eun Sook Lee
    • Insong Koh
    • Yeul Hong Kim
    • Kyong Hwa Park
  • View Affiliations / Copyright

    Affiliations: Division of Oncology/Hematology, Department of Internal Medicine, Korea University College of Medicine, Seoul, Republic of Korea, Division of Oncology/Hematology, Department of Pathology, Korea University College of Medicine, Seoul, Republic of Korea, Division of Oncology/Hematology, Department of Radiology, Korea University College of Medicine, Seoul, Republic of Korea, Division of Oncology/Hematology, Department of Surgery, Korea University College of Medicine, Seoul, Republic of Korea, Department of Physiology, College of Medicine, Hanyang University, Seoul, Republic of Korea
  • Pages: 611-620
    |
    Published online on: May 10, 2012
       https://doi.org/10.3892/ijo.2012.1470
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Docetaxel is one of the most commonly used chemotherapeutic agents in breast cancer. To avert from significant toxicities with no clinical benefit, identification of predictive markers for response is one of the most important unsolved clinical needs. Therefore, the potential associations of RASSF1A hypermethylation and response to docetaxel-based chemotherapy were evaluated, and the underlying mechanism was studied. The expression of RASSF1A in breast cancer cell lines and tissues of normal breast, ductal carcinoma in situ (DCIS), and breast cancer (n=45) was analyzed by immunohistochemistry and western blot analysis. Immunohistochemical staining showed that the expression of RASSF1A was frequently lost in primary breast cancers and human breast cancer cell lines, while normal breast tissues or DCIS displayed moderate to strong expression. Furthermore, quantitative methylation analysis of the RASSF1A promoter region in 45 primary breast cancers revealed that RASSF1A was frequently methylated in primary breast cancers (≥20% methylation in 53% of the patients), and prospective analysis in patients with locally advanced or recurrent breast cancer showed that the mean level of methylation of RASSF1A was significantly higher in patients who did not respond to docetaxel-based chemotherapy (30.6±8.5%) than patients with partial or complete response (20.1±11.2%, p=0.042). Finally, in vitro studies showed that RASSF1A had cooperative activity in suppression of cancer cell growth and proliferation by enhancing docetaxel-induced cell cycle arrest. Our results suggest that hypermethylated RASSF1A is an important modulating factor for the efficacy of docetaxel-based chemotherapy in breast cancer.

Introduction

Breast cancer is one the most common cancers in women worldwide as well as in Korea (1). Although treatment outcome of breast cancer has been greatly improved due to early diagnosis and development of various targeted agents, prognosis of patients with locally advanced breast cancer still remains to be improved. Recently, neoadjuvant chemotherapy has increasingly been considered, since the chance for breast conservation is significantly increased and the treatment outcome was similar to that in patients who received adjuvant chemotherapy after primary surgery (2,3). Therefore, it is critical to identify biologic markers for response to commonly used chemotherapeutic agents in a neoadjuvant setting. To date, several studies have been conducted for the identification of the predictive markers for response to neoadjuvant chemotherapy, and some biologic characteristics of tumors such as hormone receptor status, HER-2 overexpression, and Ki-67 labeling index have been suggested as potential biomarkers (4,5). However, none of these has been proposed as a marker based on the biologically relevant mechanisms in their cytotoxicity for a specific chemotherapeutic agent. Thus, the multi-factorial molecular mechanisms determining chemotherapy response remain largely unclear.

Taxanes, including docetaxel, in combination with other cyctotoxic agents or targeted agents are the standard treatment for locally advanced or metastatic breast cancers. Many clinical trials have demonstrated the efficacy of the taxanes in this group of patients, however, about 20% of breast cancers do not shrink significantly or progress with neoadjuvant treatment and 30–40% of the patients who had residual disease ultimately get recurrent cancer (2,3). Therefore, identification of promising biomarker which can guide physicians to select best treatment regimen is clearly unmet need in this era of personalized care.

In breast cancers, multitudes of genes are known to be suppressed by epigenetic mechanisms in the promoter region, and RASSF1A is one of the most frequently silenced genes in this type of cancer (6). Moreover, inactivation of the RASSF1A gene by the methylation is known as an early event in the carcinogenesis of breast cancer (7–9), and recent studies have suggested detection of methylated RASSF1A in serum or body fluids as a biomarker for early breast cancer development (9–11). Furthermore, there is a growing amount of data, demonstrating that methylation status in the promoter region of RASSF1A is associated with poor prognosis in breast cancer patients (12–14) as well as patients with other cancers (15–18). Epigenetic or genetic modification of RASSF1A gene may have effects on key biological processes including apoptosis, cell cycle regulation, mitosis, and microtubule dynamics in cancer cells, which have been shown in numerous studies (19–22). Our recent data showed that RASSF1A protein enhances microtubule-targeted drugs in inducing G2/M arrest in non-small cell lung carcinoma (NSCLC) cells (23), implicating RASSF1A in cytotoxicity of anti-mitotic drugs. However, only a few studies have thus far been focused on the biologic consequence of the methylation of RASSF1A in various cancer types (24,25), but not in breast cancer. Therefore, we hypothesized that commonly-silenced RASSF1A in breast cancer can modulate the response to the frequently used cytotoxic agent, docetaxel.

To this end, we prospectively investigated the relationship between the methylation level of RASSF1A gene and response to docetaxel-based chemotherapy in patients with locally advanced or recurrent breast cancer using methylation-specific pyrosequencing analysis, and found that the mean level of methylation in the promoter region of RASSF1A showed a significant association with response to docetaxel-based chemotherapy. Further in vitro study showed that RASSF1A had cooperative activity in suppression of cancer cell growth and proliferation by enhancing docetaxel-induced cell cycle arrest.

Materials and methods

Cell culture and transfection

Three human breast cancer cell lines, ZR-75-1, MDA-MB-231, and MCF-7 cells, were obtained from the Korean Cell Line Bank (Seoul, Korea). For transfection, cells were transiently transfected with 1 μg of RASSF1A DNA (kindly provided by Dr S. Tommasi of the Beckman Research Institute, Duarte, CA, USA) or the empty pcDNA 3.1 plasmid using the Lipofectamine reagent (Invitrogen, Carlsbad, CA, USA). To generate cells stably expressing RASSF1A, cells were transfected and selected in geneticin (G418) (Life Technologies Inc., Grand Island, NY, USA). Only low passage cells (passage <10) were used for experiments.

Patients and tissues

A total of 45 primary breast cancer tissues were obtained from newly diagnosed breast cancer patients who were scheduled to receive docetaxel-based chemotherapy for locally advanced or metastatic disease. Ten non-cancer tissues were obtained from 5 patients with DCIS and 5 normal breast tissues from reduction mammoplasty. All patients gave their informed consent, and the study was approved by the Ethics and Scientific Committees of our Institution (no. 2008–267). Tissues were processed and stored as frozen block at −80°C or paraffin-embedded block in Korea Lung Tissue Bank (Seoul, Korea) until analysis. Clinicopathological data involving age, TNM stage, tumor grade, ER/PR/HER-2 expression status, and response to docetaxel-based chemotherapy were collected. Responders in this study were defined as the patients who achieved a partial or complete response to chemotherapy, according to the RECIST criteria version 1.1 (26).

Cell proliferation assays

Cell proliferation was assessed by both colorimetric MTT assay and [3H]-thymidine incorporation. Thus, each breast cancer cell line was incubated with docetaxel for 48 h after 24 h of serum starvation. For the MTT assay, the cells were incubated for 4 h with MTT reagent and then lysed in 50% dimethylformamide (DMSO) and 20% SDS-PAGE at 37°C. Optical densities (OD) at 550 and 670 nm were measured using a plate reader (BioRad, Hercules, CA, USA), and differential OD between 550 and 670 nm (OD 550–670 nm) was determined. For [3H]-thymidine incorporation assay, 1 μl of [3H]-thymidine (Amersham, Buckinghamshire, UK) was added per well and plates were incubated for 18 h. Then, cells were harvested in a cell harvester, and radioactivity (dpm) was counted using a β-counter. The results were expressed as dpm/mg protein or as percentage of the control (defined as 100%).

Methylation-specific PCR (MSP) analysis

Genomic DNA was extracted from control, 5-aza-deoxycytidine-treated (10 μM for 3 days) cells using QIAamp® DNA Blood Mini Kit (Qiagen, Valencia, CA, USA), by following the manufacturer’s instructions. Bisulfite modification of DNA (1 μg) was performed using the EZ DNA Methylation-Gold kit™ (Zymo Research, Orange, CA, USA). Based on the promoter sequence of RASSF1A, methylation- and unmethylation-specific primers were designed using Serologicals CpGware software (http://apps.serologicals.com/CPGWARE/dna_form2.html) methylated, 5′-GCTAAC AAACGCGAACCG-3′; 5′-GGGTTTTGCGAGAGCGCG-3′ and unmethylated, 5′-CACTAACAAACACAAAC CAAAC-3′; 5′-GGTTTTGTGAGAGTGTGTTTAG-3′; product sizes 169 and 169 bp, respectively (PMID: 11333291). Bisulfite-modified DNA (2 μl out of 10 μl elute) was used for each PCR. All experiments were performed in triplicate and repeated at least three times.

Quantitation of RASSF1A promoter methylation by pyrosequencing

Bisulfite-treated DNA from tumors was used for PCR amplifications. Pyrosequencing was performed using the PSQ96ID system (Qiagen) including PyroMark Gold Q96 reagents. Primers were designed by the PyroMark Assay design 2.0 (Qiagen). The primers amplify a stretch of the RASSF1A exon 1 (Ensemble ID: ENST00000266020). The primers target CpG regions within this stretch. PCR was carried out using 2 μl bisulfite-treated DNA under the following conditions: 94°C for 5 min, 45x (94°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec), 72°C for 5 min. Intactness of the PCR product was assessed by electrophoresis on 2% agarose gel (Seakem® LE Agarose, Lonza) and subsequent ethidium bromide staining. The pyrosequencing primers target a 46-nt segment, which lies within the previously amplified stretch of RASSF1A exon 1 and contains 7 CpGs(GTCGGGGTTCGTTTTGTGGTTTCGTTCGG TTCGCGTTTGTTAGCGT).

Immunohistochemistry and immunofluorescence

Expression of RASSF1A protein in tissue samples and breast cancer cell lines were determined with anti-RASSF1A monoclonal antibody (clone eB114, eBioscience, Minneapolis, MI, USA) as previously described (27). The staining results were evaluated according to the immunodetection of stain intensity and amounts of positive cells by two pathologists (A.K. and H.J.), who discussed each case until they reached a consensus. The degree of staining was subdivided as follows: the stain intensity could be from 0 to 3 (0, no staining; 1, focal or fine granular, weak staining; 2, linear or cluster, strong staining; and 3, diffuse, intense staining); and the positive cells in the observed breast tissue samples ranged from 0 to 3 in percentage (0, no staining; 1, <30%; 2, 30–70%; and 3, >70%). The samples were scored by their summation: 0–1 (-); 2–3 (+); 4 (++); 5–6 (+++). Any staining score 2 or above (+) was considered as positive expression.

For immunofluorescence, cells were plated on 18 mm coverslips and treated on the next day with 10 μM 5-aza-deoxycytidine (Sigma Co., St. Louis, MO, USA). After 48-h treatment, cells were fixed with 4% paraformaldehyde, permeabilized in 0.25% Triton X-100 in PBS, and blocked in PBS/5% BSA. RASSF1A was detected using anti-RASSF1A (eBioscience) followed by incubation with fluorescent conjugated secondary antibodies (Molecular Probes, Eugene, OR, USA). After washing, cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma Co.), mounted on glass slides, and examined by a DP40 (Olympus, Tokyo, Japan).

Western blot analysis

The expressions of proteins were detected using relevant antibodies (anti-RASSF1A, Cdk1, Cdk2, Cdk4, cyclin B, Cell Signaling, Boston, MA, USA; anti-cyclin D1, Calbiochem, San Diego, CA, USA; anti-p21, Santa Cruz Biotechnology, Santa Cruz, CA, USA). The collected cells were lysed with 10 μl of dilution buffer containing 20 mM 3-morpholinopropanesulfonic acid (pH 7.2), 25 mM β-glycerophosphate, 5 mM EDTA, 1 mM sodium orthovanadate, 1 mM dithiothreitol, and protease inhibitors (100 μg/ml phenylmethylsulfonyl fluoride, 1 μg/ml aprotinin, and 1 μg/ml leupeptin). The total cell lysates were resolved on 8–12% SDS-PAGE as previouslydescribed (23).

Cell cycle analysis

The cell cycle distribution was determined by flow cytometric analysis of propidium iodide (PI) labeled cells. Thus, cells were seeded at 1x105 cells/60-mm plate and treated with docetaxel. The cells were harvested, fixed in 70% ethanol, and then stored at −20°C. The cells were then washed twice with ice-cold PBS and incubated with ribonuclease and PI. Cell cycle was analyzed by BD FACScan flow cytometry (Becton Dickinson, Franklin Lakes, NJ, USA) and CellQuest software.

Statistical analysis

Mean methylation level of RASSF1A according to the clinicopathological parameters were analyzed by Student’s t-test. A logistic regression model was applied to determine whether a factor was independent predictor of response to chemotherapy in a multivariate analysis. A two-sided 0.05-level test was determined for statistical significance. All data analyses were conducted with SPSS software (SPSS Inc., Chicago, IL, USA).

Results

RASSF1A protein and mRNA expressions are downregulated in breast cancer cell lines and primary breast cancers

Western blot analysis and RT-PCR revealed the loss of RASSF1A protein and mRNA expression in 3 breast cancer cell lines (ZR-75-1, MDA-MB-231, MCF-7) (Fig. 1A). Next, we evaluated the expression of RASSF1A using immunohistochemical analysis, and Fig. 1B shows that benign breast tissues and DCIS tissues were strongly positive for RASSF1A, whereas invasive ductal carcinoma tissues were negative for RASSF1A staining. Further analysis of primary invasive ductal carcinoma of breast revealed that RASSF1A was lost in 27 (60%) out of 45 primary breast samples (Table I), thus indicating that RASSF1A expression is low or lost in many cases of primary breast cancer specimens as well as selected breast cancer cell lines. These results support earlier hypothesis that the loss of RASSF1A is one of the important events in the breast cancer carcinogenesis (7,8).

Figure 1

Decreased expression of RASSF1A in breast cancer. (A) Expression of RASSF1A in 3 breast cancer cell lines, determined by western blot analysis and RT-PCR analysis. β-actin and GAPDH were used as internal controls. (B) RASSF1A protein expression in normal breast, DCIS and invasive ductal carcinoma. Brown staining in immunohistochemistry is indicative of RASSF1A protein expression (magnification x100).

Table I

Correlation between RASSF1A gene methylation, protein expression, and clinicopathological characteristics of breast cancer patients (n=45).

Table I

Correlation between RASSF1A gene methylation, protein expression, and clinicopathological characteristics of breast cancer patients (n=45).

RASSF1A methylation
RASSF1A expression
Clinicopathological characteristicsNumber of patients (no.)Level of methylation (%, mean±SD)PPositive (no.)Negative (no.)P
Age (years)
  <35417.7±18.7NS13NS
  ≥354121.7±16.61724
Menopausal status
  Premenopausal2818.5±16.3NS7210.013
  Postmenopausal1727.0±16.2611
Primary tumor size (cm)
  <2.01316.9±16.6NS67NS
  ≥2.03223.7±16.52012
Stage
  II-III3018.7±14.40.0881020NS
  IV, recurrent1527.7±16.487
ER
  Positive1928.2±17.70.024613NS
  Negative2617.0±14.41214
PR
  Positive1529.5±17.40.026312NS
  Negative3017.9±15.11515
HER-2
  Positive1621.6±15.6NS97NS
  Negative2921.8±17.4920
Triple negativity
  Yes1514.4±11.90.041510NS
  No3024.8±17.01317
Tumor grade
  G122.5±0.1NS02NS
  G21921.7±19.1712
  G32423.3±15.41113
Ki-67 (%)
  ≥203522.0±17.5NS17180.034
  <201021.6±16.719
p53 (%)
  ≥102822.9±17.1NS1018NS
  <101719.8±16.189
Response to chemotherapy
  Responders3220.1±11.20.04214170.343
  Non-responders1330.6±8.5310

[i] ER, estrogen receptor; PR, progesterone receptor; HER-2, human epidermal growth factor receptor 2; NS, not statistically significant.

RASSF1A promoter is methylated in breast cancer cell lines

Next, we investigated underlying mechanism of downregulation of RASSF1A, and tested whether any epigenetic modification regulates RASSF1A gene expression in breast cancer cell lines, as reported previously (28,29). RASSF1A mRNA and protein levels were restored after treatment with the demethylating agent in dose-dependent manner, implying that DNA methylation might be a mechanism involved in the RASSF1A inactivation in the selected cells (Fig. 2A, upper panel). Moreover, immunofluorescence study revealed that RASSF1A protein expression was restored by the demethylating agent, mainly in the perinuclear area of the cancer cells (Fig. 2A, lower panel). Based on the results of the demethylating agent, the methylation status of the RASSF1A promoter was determined by MSP analysis before and after treatment of 3 different breast cancer cell lines with 5-aza-deoxycytidine, and the demethylating agent induced the appearance of unmethylated alleles of the RASSF1A (Fig. 2B). Therefore, the decreased RASSF1A gene expression was associated with the RASSF1A promoter methylation in breast cancer.

Figure 2

Suppression of RASSF1A by methylation in breast cancer. (A) Re-expression of RASSF1A by treatment of 3 different breast cancer cell lines with 5-azadeoxycytidine. Western blot analysis and RT-PCR show that RASSF1A is re-expressed by treatment with increasing concentrations of 5-azadeoxycytidine (upper panel). β-actin and GAPDH were used as internal controls. Immunofluorescence study confirms the re-expression of perinuclear RASSF1A (red) in breast cancer cells by 5-azadeoxycytidine treatment (x400, lower panel). (B) MSP analysis before and after treatment of ZR 75-1, MDA-MB-231 and MCF-7 cells with 5-azadeoxycytidine. Bisulfite-converted universally methylated human DNA standard served as a positive control for methylation, and human lymphocyte DNA was included as an unmethylated RASSF1A. M, methylated alleles; U, unmethylated alleles.

Quantitative analysis of RASSF1A methylation by pyrosequencing and relationship with clinicopathological characteristics of breast cancer patients

The associations between the promoter methylation status of RASSF1A and relevant demographic and clinicopathological characteristics are shown in Table I. The 7 CpG sites were analyzed by methylation-sensitive pyrosequencing and a representative pyrogram is shown in Fig. 3A. Pyrosequencing showed that the mean level of methylation in 7 CpG sites in the 45 primary breast cancers ranged from 1.08% to 59.8%, and 24 of 45 tumors (53.3%) exhibited a high level of methylation (>20%). Interestingly, triple negative tumors had significantly lower level of methylation in the promoter region of RASSF1A at 14.4±11.9% compared to non-triple negative tumors (24.8±17.0%, p=0.041; Fig. 3B). Furthermore, it is of an interest to note that the mean level of methylation in RASSF1A was significantly higher in patients who did not respond to docetaxel-based chemotherapy (30.6±8.5 %) than patients with partial or complete response (20.1±11.2 %, p=0.042; Fig. 3C). Mean level of methylation in 7 CpG sites of the promoter region of RASSF1A in ER-positive tumors was significantly higher at 28.2±17.7% compared to ER-negative tumors (17.0±14.4%, p=0.024). Positive for PR showed the same pattern of association as observed in ER (positive: 29.5±17.4%, negative: 17.9±15.1%, p=0.026). However, there was no significant correlation between RASSF1A protein expression and the level of promoter methylation or any clinicopathological characterisitics in primary breast cancers in this study (Table I).

Figure 3

Quantitative analysis of RASSF1A methylation by pyrosequencing. (A) Pyrogram from quantification of methylation of 7 CpG sites at the RASSF1A promoter. During the pyrosequencing reaction, a ‘C’ is incorporated if the template CpG is methylated, while a ‘T’ is incorporated if the template CpG is unmethylated. In the resulting pyrogram, the proportion of C:T reflects the degree of methylation at the particular CpG sites assessed. (B) Comparison of mean level of methylation of RASSF1A between non-triple negative breast cancer (TNBC) and TNBC patients. Bar indicates mean level of methylation of RASSF1A in each group. P denotes significance of t-test. (C) Comparison of mean level of methylation of RASSF1A between non-responder and responder to chemotherapy. Bar indicates mean level of methylation of RASSF1A in each group.

Multivariate analysis showed that low level of methylation (<20%) in RASSF1A was an independent predictor for response to chemotherapy after adjusted for ER (negative vs positive), PR (negative vs positive), HER-2 (negative vs positive), tumor grade (grade I/II vs III), p53 immunostaining (low; <20% vs high; ≥20%), and Ki-67 (low vs high) in these 45 patients (odds ratio = 15.99, 95% confidence interval = 1.16–219.29, p=0.03; Table II). Patients with low level of p53 immunostaining (<20%) were also more sensitive to docetaxel-based chemotherapy than the patients with tumors of high level of p53 immunostaining.

Table II

Multivariate logistic regression model for response to chemotherapy.

Table II

Multivariate logistic regression model for response to chemotherapy.

FactorResponse to chemotherapy
OR (95% CI)P
ER (negative vs positive)0.000.99
PR (negative vs positive)8.970E80.99
HER-2 (negative vs positive)4.31 (.53–34.96)0.17
Grade (I vs II/III)0.61 (.016–23.35)0.79
p53 immunoreactivity (low vs high)49.02 (1.46–1639.25)0.03
Ki-67 immunoreactivity (low vs high)0.17 (.004–7.06)0.35
RASSF1A methylation (low vs high)15.99 (1.16–219.29)0.03

[i] OR, odds ratio; CI, confidence interval; ER, estrogen receptor; PR, progesterone receptor; HER-2, human epidermal growth factor receptor 2.

RASSF1A modulates docetaxel-induced cell death

Since the docetaxel-based chemotherapy seemed less effective in patients with methylated promoter region of RASSF1A, we examined potential interaction between RASSF1A and docetaxel. Therefore, we transfected RASSF1A or control vector to the breast cancer cells (ZR-75-1, MDA-MB-231, MCF-7), and investigated whether reintroduction of RASSF1A had any growth inhibitory effect on breast cancer cells. As shown in Fig. 4A, the number of round-shape cells which are typical features of apoptotic cells was increased in RASSF1A transfected cells compared with the control vector-transfected cells and the effect was greatly enhanced after treatment of docetaxel. Next, the cooperative effect was confirmed in a proliferation assay showing that docetaxel induced a marked reduction of [3H]-thymidine incorporation in the cells stably transfected with RASSF1A, compared with the control vector-transfected cells (Fig. 4B). Therefore, these results indicate that the anti-proliferative effect of docetaxel was enhanced in the presence of RASSF1A in breast cancer cells.

Figure 4

RASSF1A modulates growth inhibitory effect of docetaxel. (A) The effect of RASSF1A on docetaxel-induced cell growth inhibition in 3 breast cancer cell lines was analyzed by phase contrast light microscopy. Control vector indicates pcDNA3.1. (B) Upper right panel, expression status of RASSF1A in RASSF1A and control vector stably transfected cells. Upper left and low panel, [3H]-thymidine incorporation assay in each stably transfected breast cancer cell line. Statistical analysis was performed on the basis of PBS-treated, control vector transfected cells in each cell type. *p<0.05.

RASSF1A enhances docetaxel-induced cell cycle arrest

The cooperative effects of RASSF1A and docetaxel in the cell survival and proliferation prompted us to investigate whether reintroduction of RASSF1A, in addition to docetaxel, has any impact on the cell cycle progression. When the RASSF1A-transfected breast cancer cells were treated with docetaxel for 24 h, they showed statistically significant increase of G2/M phase cell population, compared to those of empty vector transfected cells (p=0.02, Fig. 5A). The result indicates that the cooperative effect of RASSF1A and docetaxel is accompanied with cell cycle arrest at the G2/M phase. Further analysis using western blot analysis showed that the cell cycle arrest at the G2/M phase in the breast cancer cells was associated with the induction of cyclin B1, Cdk2 and p21 by both RASSF1A and docetaxel (Fig. 5B). Maximum cyclin B1, Cdk2 and p21 induction was observed when docetaxel was applied to the RASSF1A-transfected breast cancer cells, whereas Cdk1, Cdk4, and cyclin D1 were greatly decreased when breast cancer cells reintroduced with RASSF1A were treated with docetaxel. These findings indicate that the effects of RASSF1A and docetaxel on the G2/M phase cell cycle arrest are associated with accumulation of cyclin B1/Cdk2/p21 and suppression of Cdk1, Cdk4, and cyclin D1 in breast cancer cells.

Figure 5

RASSF1A enhances docetaxel-induced cell cycle arrest. (A) The effect of RASSF1A on docetaxel-induced cell cycle arrest was evaluated in MDA-MB-231 cells stably transfected with RASSF1A or control vector. Cells were analyzed for cell cycle progression. Positions of cell populations with 2N and 4N DNA content are indicated (upper panel). Histogram plotting of the cell cycle progression is shown in lower left, while comparison of cells in G2/M phase is shown in lower right. Columns, means (n=3); bars, SEM; *p<0.05. Expression of cell cycle regulating proteins is shown by western blot analysis. Three breast cancer cell lines transfected with RASSF1A and control vector were analyzed with or without exposure to docetaxel (10 nM).

Discussion

RASSF1A has been reported to be frequently silenced in many cancer types including breast cancer; however, the biologic relevance in clinical standpoint has not yet been clearly characterized. Because there is a probability that unsatisfactory response in breast cancer treatment may in part be due to silencing of gene, the role and clinical relevance of a frequently silenced tumor suppressor gene, RASSF1A, was examined in this study. In the current study, we found that the promoter region of RASSF1A was frequently methylated in the primary breast cancer samples from 45 locally advanced or metastatic cancer patients, in good agreement with previous reports. In addition, we showed that level of methylation of RASSF1A was independent factor for response to docetaxel-based chemotherapy in this study. Moreover, RASSF1A enhanced docetaxel-mediated growth inhibition by inducing cell cycle arrest and altering the level of related proteins. Our results demonstrated that methylation status of RASSF1A modulates the efficacy of docetaxel chemotherapy and regulates docetaxel mediated cell cycle arrest in breast cancers.

There are a few studies suggesting the methylated RASSF1A as a potential biomarker for poor prognosis in breast cancer (12–14). However, no biologically relevant mechanism, thus far, has been presented. In this context, we showed herein that the methylation status of RASSF1A was significantly associated with response to docetaxel-based chemotherapy: cell line studies showed that RASSF1A per se had docetaxel-like effect in suppressing growth and proliferation of breast cancer cells via inducing cell cycle arrest. Furthermore, cooperative activity of RASSF1A in docetaxel-induced cell cycle arrest could be a potential mechanism for differential response among breast cancer patients.

Docetaxel is one of the prototype taxane and a front line chemotherapeutic agent in the treatment of breast, ovary, lung, and head and neck cancers. Despite of its widespread use and success in clinical practice, there are significant shortcomings including myelosuppression, peripheral neuropathy, and primary or secondary resistance (30). Nevertheless, there is no rational biomarker for the identification of patients who are most likely to respond to docetaxel. Of the predictive markers for the response to neoadjuvant chemotherapy, biology-based tumor types have been shown to be most consistent and reproducible among the studies (4). However, it is still unsatisfactory marker due to strong heterogeneity within the subgroups. More mechanistic markers such as Ki-67 (31) and topoisomerase IIα (32) have also been suggested as valuable predictive markers for response to anthracyclines and other chemotherapeutics. For the taxanes, however, no biologic marker has been suggested for the prediction of response based on mechanistic study. In the present study, we found a significant association between the methylation level of RASSF1A and response to docetaxel-based chemotherapy in patients with locally advanced or recurrent breast cancer. Additional multivariate analysis showed that low level of methylation (<20%) in the promoter region of RASSF1A was an independent factor for response to docetaxel-based chemotherapy after adjusted for ER, PR, HER-2, p53 immunoreactivity, and Ki-67 staining. Furthermore, the specific modulating effect of RASSF1A on docetaxel-induced cytotoxicity was demonstrated in the cell culture system. Therefore, the loss of RASSF1A for the prediction of docetaxel-based chemo-therapy also seems to deserve further investigation.

It is now well known that taxanes exert their anti-cancer effect by inducing mitotic arrest of cancer cells. When cells are exposed to anti-mitotics, they are arrested in mitosis and then undergo one of several fates; death in mitosis, unequal division, or exit without division (33). However, little is known about how cells respond to this prolonged cell cycle delay. Recent studies suggested that commitment to mitotic exit is determined by the level of cyclin B1 in anti-mitotics exposed cells (34). Therefore, it seems important to define the factors that govern the degradation of cyclin B1 during a prolonged mitotic arrest. Notably, our present results showed that overexpression of RASSF1A in breast cancers induced the accumulation of cyclin B1, as observed in docetaxel-treated cells in consistent with previous studies (21,35). Furthermore, the accumulation of cyclin B1 in the RASSF1A-transfected cells was significantly enhanced by docetaxel. Thus, RASSF1A could be considered as one of the factors controlling degradation of cyclin B1 during the mitotic arrest which was induced by docetaxel in breast cancer cells. In the present study, the accumulation of p21 and decreased levels of Cdk 1, Cdk 4, and cyclin D1 were also found to be involved in the induction of cell cycle arrest and apoptosis by both docetaxel and RASSF1A. In addition, decreased expression of Cdk 1 by RASSF1A might also contribute to cell death after mitotic exit, since Cdk 1 has been shown to inhibit caspase-9 (36). Our present observations therefore show that RASSF1A might be an important biologic contributor to docetaxel-induced cell cycle arrest and, finally, cell death in breast cancer cells.

In conclusion, the data presented herein led us to propose that hypermethylated RASSF1A might be an important modulating factor for efficacy of docetaxel-based chemotherapy in breast cancers. We also provided mechanistic data that the tumor suppressor, RASSF1A, has a cooperative effect along with docetaxel in inducing cell cycle arrest in breast cancer. Our results are expected to contribute to the identification of biomarkers in predicting the response of breast cancer patients to docetaxel. Since our data are limited by the small sample size and locally advanced stage cancers in most of the cases, the statistical significances shown here are still marginal. Therefore, further research with a large number of clinical samples is needed to confirm our results.

Acknowledgements

This study was supported by a grant of the Korea Healthcare technology R&D Project, Ministry for Health, Welfare & Family Affairs, Republic of Korea (A084400). Tissue samples were provided by the Korean Lung Tissue Bank through the Infrastructure Project for Basic Science of the Ministry of Education, Science and Technology, Korea.

References

1 

Jung KW, Park S, Kong HJ, et al: Cancer statistics in Korea: incidence, mortality, survival, and prevalence in 2008. Cancer Res Treat. 43:1–11. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Rastogi P, Anderson SJ, Bear HD, et al: Preoperative chemotherapy: updates of National Surgical Adjuvant Breast and Bowel Project Protocols B-18 and B-27. J Clin Oncol. 26:778–785. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Mauri D, Pavlidis N and Ioannidis JP: Neoadjuvant versus adjuvant systemic treatment in breast cancer: a meta-analysis. J Natl Cancer Inst. 97:188–194. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Darb-Esfahani S, Loibl S, Muller BM, et al: Identification of biology-based breast cancer types with distinct predictive and prognostic features: role of steroid hormone and HER2 receptor expression in patients treated with neoadjuvant anthracycline/taxane-based chemotherapy. Breast Cancer Res. 11:R692009. View Article : Google Scholar

5 

Chang HR, Glaspy J, Allison MA, et al: Differential response of triple-negative breast cancer to a docetaxel and carboplatin-based neoadjuvant treatment. Cancer. 116:4227–4237. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Christensen BC, Kelsey KT, Zheng S, et al: Breast cancer DNA methylation profiles are associated with tumor size and alcohol and folate intake. PLoS Genet. 6:e10010432010. View Article : Google Scholar : PubMed/NCBI

7 

Yan PS, Shi H, Rahmatpanah F, et al: Differential distribution of DNA methylation within the RASSF1A CpG island in breast cancer. Cancer Res. 63:6178–6186. 2003.PubMed/NCBI

8 

Yeo W, Wong WL, Wong N, Law BK, Tse GM and Zhong S: High frequency of promoter hypermethylation of RASSF1A in tumorous and non-tumourous tissue of breast cancer. Pathology. 37:125–130. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Honorio S, Agathanggelou A, Schuermann M, et al: Detection of RASSF1A aberrant promoter hypermethylation in sputum from chronic smokers and ductal carcinoma in situ from breast cancer patients. Oncogene. 22:147–150. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Shukla S, Mirza S, Sharma G, Parshad R, Gupta SD and Ralhan R: Detection of RASSF1A and RARbeta hypermethylation in serum DNA from breast cancer patients. Epigenetics. 1:88–93. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Yazici H, Terry MB, Cho YH, et al: Aberrant methylation of RASSF1A in plasma DNA before breast cancer diagnosis in the Breast Cancer Family Registry. Cancer Epidemiol Biomarkers Prev. 18:2723–2725. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Kioulafa M, Kaklamanis L, Mavroudis D, Georgoulias V and Lianidou ES: Prognostic significance of RASSF1A promoter methylation in operable breast cancer. Clin Biochem. 42:970–975. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Karray-Chouayekh S, Trifa F, Khabir A, et al: Aberrant methylation of RASSF1A is associated with poor survival in Tunisian breast cancer patients. J Cancer Res Clin Oncol. 136:203–210. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Martins AT, Monteiro P, Ramalho-Carvalho J, et al: High RASSF1A promoter methylation levels are predictive of poor prognosis in fine-needle aspirate washings of breast cancer lesions. Breast Cancer Res Treat. 129:1–9. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Kim DH, Kim JS, Ji YI, et al: Hypermethylation of RASSF1A promoter is associated with the age at starting smoking and a poor prognosis in primary non-small cell lung cancer. Cancer Res. 63:3743–3746. 2003.PubMed/NCBI

16 

Wang J, Lee JJ, Wang L, et al: Value of p16INK4a and RASSF1A promoter hypermethylation in prognosis of patients with resectable non-small cell lung cancer. Clin Cancer Res. 10:6119–6125. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Seidel C, Bartel F, Rastetter M, et al: Alterations of cancer-related genes in soft tissue sarcomas: hypermethylation of RASSF1A is frequently detected in leiomyosarcoma and associated with poor prognosis in sarcoma. Int J Cancer. 114:442–447. 2005. View Article : Google Scholar : PubMed/NCBI

18 

Fischer JR, Ohnmacht U, Rieger N, et al: Promoter methylation of RASSF1A, RARbeta and DAPK predict poor prognosis of patients with malignant mesothelioma. Lung Cancer. 54:109–116. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Ahmed-Choudhury J, Agathanggelou A, Fenton SL, et al: Transcriptional regulation of cyclin A2 by RASSF1A through the enhanced binding of p120E4F to the cyclin A2 promoter. Cancer Res. 65:2690–2697. 2005. View Article : Google Scholar : PubMed/NCBI

20 

Donninger H, Vos MD and Clark GJ: The RASSF1A tumor suppressor. J Cell Sci. 120:3163–3172. 2007. View Article : Google Scholar : PubMed/NCBI

21 

Song MS, Song SJ, Ayad NG, et al: The tumour suppressor RASSF1A regulates mitosis by inhibiting the APC-Cdc20 complex. Nat Cell Biol. 6:129–137. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Liu L, Tommasi S, Lee DH, Dammann R and Pfeifer GP: Control of microtubule stability by the RASSF1A tumor suppressor. Oncogene. 22:8125–8136. 2003. View Article : Google Scholar : PubMed/NCBI

23 

Whang YM, Park KH, Jung HY, Jo UH and Kim YH: Microtubule-damaging agents enhance RASSF1A-induced cell death in lung cancer cell lines. Cancer. 115:1253–1266. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Reu FJ, Bae SI, Cherkassky L, et al: Overcoming resistance to interferon-induced apoptosis of renal carcinoma and melanoma cells by DNA demethylation. J Clin Oncol. 24:3771–3779. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Reu FJ, Leaman DW, Maitra RR, et al: Expression of RASSF1A, an epigenetically silenced tumor suppressor, overcomes resistance to apoptosis induction by interferons. Cancer Res. 66:2785–2793. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Eisenhauer EA, Therasse P, Bogaerts J, et al: New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer. 45:228–247. 2009. View Article : Google Scholar

27 

Pallares J, Velasco A, Eritja N, et al: Promoter hypermethylation and reduced expression of RASSF1A are frequent molecular alterations of endometrial carcinoma. Mod Pathol. 21:691–699. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Ateeq B, Unterberger A, Szyf M and Rabbani SA: Pharmacological inhibition of DNA methylation induces proinvasive and prometastatic genes in vitro and in vivo. Neoplasia. 10:266–278. 2008.PubMed/NCBI

29 

Liu Z, Wu J, Xie Z, et al: Quantification of regional DNA methylation by liquid chromatography/tandem mass spectrometry. Anal Biochem. 391:106–113. 2009. View Article : Google Scholar : PubMed/NCBI

30 

McGrogan BT, Gilmartin B, Carney DN and McCann A: Taxanes, microtubules and chemoresistant breast cancer. Biochim Biophys Acta. 1785:96–132. 2008.PubMed/NCBI

31 

Caudle AS, Gonzalez-Angulo AM, Hunt KK, et al: Predictors of tumor progression during neoadjuvant chemotherapy in breast cancer. J Clin Oncol. 28:1821–1828. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Coon JS, Marcus E, Gupta-Burt S, et al: Amplification and overexpression of topoisomerase IIalpha predict response to anthracycline-based therapy in locally advanced breast cancer. Clin Cancer Res. 8:1061–1067. 2002.PubMed/NCBI

33 

Gascoigne KE and Taylor SS: How do anti-mitotic drugs kill cancer cells? J Cell Sci. 122:2579–2585. 2009. View Article : Google Scholar : PubMed/NCBI

34 

Gascoigne KE and Taylor SS: Cancer cells display profound intra- and interline variation following prolonged exposure to antimitotic drugs. Cancer Cell. 14:111–122. 2008. View Article : Google Scholar

35 

Whang YM, Kim YH, Kim JS and Yoo YD: RASSF1A suppresses the c-Jun-NH2-kinase pathway and inhibits cell cycle progression. Cancer Res. 65:3682–3690. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Allan LA and Clarke PR: Phosphorylation of caspase-9 by CDK1/cyclin B1 protects mitotic cells against apoptosis. Mol Cell. 26:301–310. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gil EY, Jo UH, Jeong H, Whang YM, Woo OH, Cho KR, Seo JH, Kim A, Lee ES, Koh I, Koh I, et al: Promoter methylation of RASSF1A modulates the effect of the microtubule-targeting agent docetaxel in breast cancer Retraction in /10.3892/ijo.2025.5745. Int J Oncol 41: 611-620, 2012.
APA
Gil, E.Y., Jo, U.H., Jeong, H., Whang, Y.M., Woo, O.H., Cho, K.R. ... Park, K.H. (2012). Promoter methylation of RASSF1A modulates the effect of the microtubule-targeting agent docetaxel in breast cancer Retraction in /10.3892/ijo.2025.5745. International Journal of Oncology, 41, 611-620. https://doi.org/10.3892/ijo.2012.1470
MLA
Gil, E. Y., Jo, U. H., Jeong, H., Whang, Y. M., Woo, O. H., Cho, K. R., Seo, J. H., Kim, A., Lee, E. S., Koh, I., Kim, Y. H., Park, K. H."Promoter methylation of RASSF1A modulates the effect of the microtubule-targeting agent docetaxel in breast cancer Retraction in /10.3892/ijo.2025.5745". International Journal of Oncology 41.2 (2012): 611-620.
Chicago
Gil, E. Y., Jo, U. H., Jeong, H., Whang, Y. M., Woo, O. H., Cho, K. R., Seo, J. H., Kim, A., Lee, E. S., Koh, I., Kim, Y. H., Park, K. H."Promoter methylation of RASSF1A modulates the effect of the microtubule-targeting agent docetaxel in breast cancer Retraction in /10.3892/ijo.2025.5745". International Journal of Oncology 41, no. 2 (2012): 611-620. https://doi.org/10.3892/ijo.2012.1470
Copy and paste a formatted citation
x
Spandidos Publications style
Gil EY, Jo UH, Jeong H, Whang YM, Woo OH, Cho KR, Seo JH, Kim A, Lee ES, Koh I, Koh I, et al: Promoter methylation of RASSF1A modulates the effect of the microtubule-targeting agent docetaxel in breast cancer Retraction in /10.3892/ijo.2025.5745. Int J Oncol 41: 611-620, 2012.
APA
Gil, E.Y., Jo, U.H., Jeong, H., Whang, Y.M., Woo, O.H., Cho, K.R. ... Park, K.H. (2012). Promoter methylation of RASSF1A modulates the effect of the microtubule-targeting agent docetaxel in breast cancer Retraction in /10.3892/ijo.2025.5745. International Journal of Oncology, 41, 611-620. https://doi.org/10.3892/ijo.2012.1470
MLA
Gil, E. Y., Jo, U. H., Jeong, H., Whang, Y. M., Woo, O. H., Cho, K. R., Seo, J. H., Kim, A., Lee, E. S., Koh, I., Kim, Y. H., Park, K. H."Promoter methylation of RASSF1A modulates the effect of the microtubule-targeting agent docetaxel in breast cancer Retraction in /10.3892/ijo.2025.5745". International Journal of Oncology 41.2 (2012): 611-620.
Chicago
Gil, E. Y., Jo, U. H., Jeong, H., Whang, Y. M., Woo, O. H., Cho, K. R., Seo, J. H., Kim, A., Lee, E. S., Koh, I., Kim, Y. H., Park, K. H."Promoter methylation of RASSF1A modulates the effect of the microtubule-targeting agent docetaxel in breast cancer Retraction in /10.3892/ijo.2025.5745". International Journal of Oncology 41, no. 2 (2012): 611-620. https://doi.org/10.3892/ijo.2012.1470
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team