Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
April 2013 Volume 42 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April 2013 Volume 42 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Depletion of JARID1B induces cellular senescence in human colorectal cancer

  • Authors:
    • Katsuya Ohta
    • Naotsugu Haraguchi
    • Yoshihiro Kano
    • Yoshinori Kagawa
    • Masamitsu Konno
    • Shimpei Nishikawa
    • Atsushi Hamabe
    • Shinichiro Hasegawa
    • Hisataka Ogawa
    • Takahito Fukusumi
    • Mamoru Uemura
    • Junichi Nishimura
    • Taishi Hata
    • Ichiro Takemasa
    • Tsunekazu Mizushima
    • Yuko Noguchi
    • Miyuki Ozaki
    • Toshihiro Kudo
    • Daisuke Sakai
    • Taroh Satoh
    • Miwa Fukami
    • Masaru Ishii
    • Hirofumi Yamamoto
    • Yuichiro Doki
    • Masaki Mori
    • Hideshi Ishii
  • View Affiliations / Copyright

    Affiliations: Department of Frontier Science for Cancer and Chemotherapy, Osaka University, Graduate School of Medicine, Suita, Osaka 565-0871, Japan, Department of Gastroenterological Surgery, Osaka University, Graduate School of Medicine, Suita, Osaka 565-0871, Japan, Laboratory of Cellular Dynamics, WPI-Immunology Frontier Research Center, Osaka University, Suita, Osaka 565-0871, Japan
  • Pages: 1212-1218
    |
    Published online on: January 25, 2013
       https://doi.org/10.3892/ijo.2013.1799
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The global incidence of colorectal cancer (CRC) is increasing. Although there are emerging epigenetic factors that contribute to the occurrence, development and metastasis of CRC, the biological significance of epigenetic molecular regulation in different subpopulations such as cancer stem cells remains to be elucidated. In this study, we investigated the functional roles of the H3K4 demethylase, jumonji, AT rich interactive domain 1B (JARID1B), an epigenetic factor required for the continuous cell growth of melanomas, in CRC. We found that CD44+/aldehyde dehydrogenase (ALDH)+ slowly proliferating immature CRC stem cell populations expressed relatively low levels of JARID1B and the differentiation marker, CD20, as well as relatively high levels of the tumor suppressor, p16̸INK4A. Of note, lentiviral‑mediated continuous JARID1B depletion resulted in the loss of epithelial differentiation and suppressed CRC cell growth, which was associated with the induction of phosphorylation by the c‑Jun N‑terminal kinase (Jnk̸Sapk) and senescence‑associated β‑galactosidase activity. Moreover, green fluorescent‑labeled cell tracking indicated that JARID1B‑positive CRC cells had greater tumorigenicity than JARID1B‑negative CRC cells after their subcutaneous inoculation into immunodeficient mice, although JARID1B‑negative CRC cells resumed normal growth after a month, suggesting that continuous JARID1B inhibition is necessary for tumor eradication. Thus, JARID1B plays a role in CRC maintenance. JARID1B may be a novel molecular target for therapy‑resistant cancer cells by the induction of cellular senescence.

Introduction

Human colorectal cancer (CRC) is one of the most frequently diagnosed cancers in the Western world and a leading cause of mortality in the USA. Genetic events (mutations, deletions, genome amplifications and chromosome translocations) are involved in the initiation and progression of CRC and their stepwise accumulation is a driving force of malignancies (1). Epigenetic regulation also plays a critical role in the pathogenesis of CRC. DNA methylation is a component of the epigenetic gene-silencing complex (2), whereas histone (H3 and H4) post-translational modifications comprise a ubiquitous component of rapid epigenetic changes (3). Epigenetic changes are associated with altered transcription (4). Metastasis correlates with the loss of epithelial differentiation, induction of epithelial mesenchymal transition and the acquisition of a migratory phenotype, which are controlled by epigenetic alterations caused by the dysregulation of the transcriptome in CRC (4).

The basic nucleosome unit has four core histone proteins (H2A, H2B, H3 and H4). Histones H3 and H4 are generally associated with active gene transcription. Their acetylation levels are crucial with respect to the chromatin status and regulation of gene expression (5). Using the H3K4 demethylase, jumonji, AT rich interactive domain 1B (JARID1B), as a biomarker, a small subpopulation of tumor-initiating cells was isolated from a melanoma sample (6). JARID1B depletion has been shown to eliminate melanoma cell growth (6). Therefore, in this study, we investigated the effect of JARID1B depletion by lentiviral transfer of small hairpin RNA (shRNA) molecules on CRC cells. We identified a novel phenotype and cellular senescence in CRC induced by continuous JARID1B depletion, as well as tumor elimination and regression, which suggests a potential role for JARID1B in CRC diagnosis and therapy.

Materials and methods

Immunohistochemistry

Immunohistochemical staining was performed on 4-μm sections of formalin-fixed, paraffin-embedded surgical tumor samples. The sections were mounted, deparaffinized in xylene and rehydrated in descending concentrations of ethanol. Antigen retrieval was performed using citrate buffer (10 mM, pH 6.0) heated in a pressure cooker for 5 min. The blocking of endogenous peroxidases was accomplished by incubating the sections in 3% hydrogen peroxide (H2O2; Wako Pure Chemical Industries, Ltd.) for 5 min. The sections were incubated with rabbit anti-JARID1B antibody (1:100; Novus Biologicals) overnight at 4°C. Immunostaining for JARID1B was performed using the Envision + Dual Link System and Vectastain ABC kit (Vector Laboratories) according to the manufacturer’s instructions. The sections were counterstained with hematoxylin and eosin.

Cell culture

Three CRC cell lines (Colo201, DLD1 and HCT116) were used. Colo201 and DLD1 cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS). HCT116 and human embryonic kidney (HEK)-293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS. Transfection was performed using FuGENE-6 (Roche) transfection reagent according to the manufacturer’s instructions, followed by lentiviral production in HEK-293T cells and viral infection (Roche).

Proliferation and MTT assays

Quantification of cell proliferation was based on measurements of bromodeoxyuridine (BrdU) incorporation during DNA synthesis in replicating (cycling) cells using the BrdU Cell Proliferation ELISA kit (colorimetric) (Roche). The cells (1.0×105) were incubated with 0–1×10−2μM 5-fluorouracil (5-FU; Kyowa Hakko Kirin Co., Ltd.) for 48 h and analyzed using the Cell Proliferation kit I (MTT; Roche).

Flow cytometry and cell sorting

Allophycocyanin (APC)-conjugated anti-human CD44 (BD Biosciences) and fluorescein isothiocyanate-conjugated anti-human aldehyde dehydrogenase (ALDH; the Aldefluor kit, Aldagen) were used to characterize cancer cells. Labeled cells (1×106) were analyzed using the BD FACSAria II cell sorter system (Becton-Dickinson), followed by data analysis using the Diva program (Becton-Dickinson). The fluorescent ubiquitination-based cell cycle indicator (Fucci)-G1 DsRed2 contains a fragment of human Cdt1 (amino acids 30–120), which is ubiquitinated by the ubiquitin ligase complex SCFskp2 during the S and G2 phases and degraded by proteasomes, thereby denoting the G1 phase (7). Fucci-S/G2/M Green contains a fragment of human geminin (amino acids 1–110) linked to enhanced green fluorescent protein (EGFP), which is ubiquitinated by the E3 ligase complex APCcdh1 and degraded by proteasomes during the M and G1 phases, denoting the S, G2 and M phases (7). DsRed2 and mKO2 or EGFP and mAG were excited by 488-nm laser lines and their emission was detected with 530/30BP and 585/42BP filters, respectively.

Reactive oxygen species (ROS) assay and senescence-associated (SA) β-galactosidase (SA-β-gal) analysis

The ROS assay was performed as described previously (8). To evaluate the effects of ROS, 10 μM N-acetyl cysteine (NAC; Wako Pure Chemical Industries, Ltd.), a general antioxidant and ROS inhibitor, was added. The cells (2×105) were treated with 20–100 μM H2O2 (Wako Pure Chemical Industries, Ltd.) for 1 h to induce oxidative stress. Intracellular ROS and SA-β-gal (the Senescence Detection kit) were analyzed using NAC (9). Intracellular ROS levels were determined by incubating the cells for 30 min at 37°C with 5 μM CellROX™ Deep Red reagent (Invitrogen Life Technologies) in complete medium, followed by cytometry.

Protein analysis

Western blot analysis and immunoprecipitation were performed. Total cell lysates were prepared using lysis buffer [50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (pH 7.5), 150 mM NaCl, 1% TritonX-100] containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitors. Cell lysates containing 20 μg of protein were electrophoresed on TGX™ gels (Bio-Rad). Subsequently, proteins were transferred onto a PVDF membrane (Bio-Rad). The primary antibodies were JARID1B (1:2,000; Novus Biologicals), c-Jun N-terminal kinase (Jnk/Sapk; 1:1,000; Cell Signaling Technology, Danvers, MA), phospho-Jnk/Sapk (1:1,000; Cell Signaling Technology) and β-actin (loading control; 1:5,000; Cell Signaling Technology). Western blotting signals were detected and quantified by image analysis software (Multi Gauge version 3, Fujifilm). The means ± standard deviation (SD) of three independent experiments were determined.

Chromatin immunoprecipitation (ChIP) analysis

ChIP analysis was performed using the ChIP-IT Express Enzymatic kit (Active Motif, Carlsbad, CA). The antibodies used for ChIP analysis were histone H3 (ab1791, Abcam), H3K4 me3 (ab8580, Abcam), H3K4 me2 (ab32356, Abcam) and H3K4 me1 (ab8895, Abcam), with rabbit immunoglobulin G (IgG) (ab46540, Abcam) used as the negative control. Immunoprecipitated DNA (100 ng) was quantified by real-time quantitative PCR (qPCR) using the following primers: human p16/INK4A promoter, 5′-AACCGCTGCACGCCTCTGAC-3′ (forward) and 5′-CCGCGGCTGTCGTGAAGGTT-3′ (reverse). The means ± SD of three independent experiments were determined.

RNA interference (RNAi)

RNAi involved the transfection of small interfering RNA (siRNA) oligos (Cosmo Bio Co., Ltd) or infection with an shRNA-encoding lentivirus against JARID1B (NM_006618, Sigma-Aldrich) and a control (SHC002, Sigma-Aldrich). The target sequences were as follows: KDM5B #1 (100 μM), GAGCCAGAGGCCAUG AAUAUT (sense) and AUAUUCAUGGCCUCUGCUC (anti-sense), and KDM5B #2 (100 μM), GGGAACGAGUUAA GAAAAU (sense) and AUUUUUCUUAACUAGUUCCC (antisense). siRNA oligos were previously validated. siRNA duplexes were transfected into subconfluent cells using Lipo-fectamine RNAiMAX (Invitrogen Life Technologies). The shRNA target sequence was as follows: JARID1B, 5′-CCGGC CCACCAATTTGGAAGGCATTCTCGAGAATGCCTTCC AAATTGGTGGGTTTTT-3′.

Real-time reverse transcription PCR (qRT-PCR)

Real-time qRT-PCR was performed using a Light Cycler (Roche). Amplified signals were confirmed on the basis of the dissociation curves and normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH). PCR primer sequences were as follows: human GAPDH, 5′-ATGTTCGTCATGGGTGTG AA-3′ (forward) and 5′-TGAGTCCTTCCACGATACCA-3′ (reverse); human JARID1B, 5′-CGACAAAGCCAAGAGTC TCC-3′ (forward) and 5′-GGATAGATCGGCCTCGTGTA-3′ (reverse); and human p16/INK4A, 5′-GTGTGCATGACGTGC GGG-3′ (forward) and 5′-GCAGTTCGAATCTGCACCG TAG-3′ (reverse). The means ± SD of three independent experiments were determined.

Animal experiments

Six-week-old female NOD/SCID mice were maintained in a pathogen-free environment. All procedures for animal studies were approved by the Institutional Ethical Committee of the Faculty of Medicine, Osaka University. 1×106 tumor cells (viability >90%) per 50 μl Matrigel (BD Biosciences) were injected subcutaneously. Tumor volume was measured by callipering the largest diameter (A) and its perpendicular (B), and calculated according to the NCI protocol [TV = (A × B2)/2].

Statistical analysis

Categorical variables were compared by the Chi-square test. Continuous variables (medians/interquartile ranges) were compared using the Wilcoxon test. Statistical analyses were performed using JMP software (JMP version 8.01, SAS Institute). P-values <0.05 were considered to indicate statistically significant differences.

Results

Ubiquitous JARID1B expression in clinical samples and various CRC cell lines

A number of studies have revealed the importance of the correlation between different types of cancer (melanoma, prostate and breast cancer) and epigenetic factors; however, to date, no study has suggested the existence of such a correlation for gastrointestinal cancer (6,10,11). JARID1B was ubiquitously expressed in some clinical samples of gastrointestinal cancer (modified differentiated adenocarcinoma, Fig. 1A). In addition, we also confirmed ubiquitous JARID1B expression in 11 CRC cell lines. Relative JARID1B expression in 11 colon adenocarcinoma cell lines and one melanoma cell line (SK MEL) as a positive control was assessed using qPCR (Fig. 1B) (6). Colo201 and HCT116 cells expressed higher JARID1B levels than DLD1 cells in vitro (Fig. 1C). In the Colo201 and HCT116 cells, the expression of the tumor suppressor, p16/INK4A, was increased in JARID1B-depleted cells compared with that in the control cells (Fig. 1D), suggesting that JARID1B and p16/INK4A expression is inversely correlated.

Figure 1

Ubiquitous JARID1B expression in clinical samples and cell lines. (A) A sample of clinical colon adenocarcinoma (moderately differentiated); left panel, hematoxylin and eosin staining (×200); right panel, immunohistological staining of JARID1B (×200). Scale bar, 100 μm. (B) JARID1B expression in 11 CRC cell lines and one positive control (SK MEL). (C) Relative JARID1B expression in 11 CRC cell lines and one positive control (SK MEL). (D) Both synthesized oligo RNA-mediated (siRNA) and lentiviral-mediated depletion (shRNA) of endogenous JARID1B resulted in a significant increase in p16/INK4A expression in Colo201 cells. Relative expression is shown.

JARID1B controls p16/INK4A expression

JARID1B plays a role in the compaction of active chromatin, which impedes the access of transcription factors to genes and induces gene silencing (5). Thus, JARID1B expression may be associated with cell cycle progression. Fucci transfectants of CRC cells revealed that endogenous JARID1B expression increased in the late G1 phase (Fig. 2A and B), suggesting the association of JARID1B with p16/INK4A, which plays a critical role in the G1-S transition checkpoint (12,13). ChIP analysis indicated that compared with the control cells, multimethylated forms of H3K4 were preferentially associated with the promoter sequence of the p16/INK4A genes in JARID1B-depleted cells (Fig. 2C). JARID1B depletion led to the trimethylation of the p16/INK4A promoter (Fig. 2D). Thus, JARID1B may play a role in active chromatin compaction of the p16/INK4A promoter, which contributes to gene silencing. Therefore, JARID1B depletion may lead to p16/INK4A activation.

Figure 2

JARID1B controlled cell cycle and p16/INK4A expression. (A) Cell cycle phase of Fucci-labeled HCT116 cells separated by flow cytometry and FACS. (B) Relative JARID1B expression by stage (early and late G1, S and G2/M). (C) ChIP assay of the promoter region of p16/INK4A in Colo201 cells. (D) The relative ratio is shown in columns. me1, monomethyl; me2, dimethyl; me3, trimethyl. The control includes all methyl modifications.

JARID1B depletion induces cellular senescence in CRC cells

p16/INK4A is associated with the SA phenotype, which occurs by the retinoblastoma-inhibiting action of cyclin-dependant kinases, leading to G1 cell cycle arrest (13–15), with the involvement of ROS (16). SA-β-gal activity was detected in the JARID1B-depleted CRC cells but not in the mock-transfected control cells (Fig. 3A and B). The effect of JARID1B depletion on SA-β-gal activity was similar to that of H2O2 exposure with an ROS inducer in the medium but not similar to that of the negative experimental control with NAC in the medium (Fig. 3A and B). This suggests that intracellular ROS may be involved in cellular senescence induction. The results from the present study illustrated that intracellular ROS levels were higher in JARID1B-depleted CRC cells than in mock-transfected control cells (Fig. 3C), which supports the involvement of ROS in senescence induction in JARID1B-depleted cells. Immunoblot analysis of SA phenotypes revealed the increased phosphorylation of Jnk/Sapk, an inducer of cellular senescence, in JARID1B-depleted cells; JARID1B expression was decreased by RNAi (Fig. 3D).

Figure 3

Induction of CRC cellular senescence by JARID1B depletion. (A) Phase-contrast microscopy of SA-β-gal activity in JARID1B-depleted and control Colo201 cells. NAC, N-acetyl cysteine; H2O2, hydrogen peroxide. Scale bar, 100 μm. (B) Quantitative analysis of SA-β-galactosidase in Colo201 cells. (C) Intracellular ROS levels measured using CellROX-labeled APC and flow cytometry in Colo201 cells. (D) Immunoblot analysis of SA proteins in JARID1B-depleted and control Colo201 cells.

JARID1B depletion suppresses CRC growth

JARID1B depletion suppressed CRC cell growth in vitro by intracellular ROS accumulation and cellular senescence activation. Therefore, we investigated its effects on tumor growth in vivo. JARID1B-positive and -negative CRC cells were sorted using a fluorescent tracer vector controlled by the JARID1B promoter (Fig. 4A). CRC cells were separated on the basis of d2-Venus expression and the fluorescent intensity depended on the endogenous expression of the JARID1B promoter (Fig. 4B). JARID1B-positive and -negative CRC cells were subcutaneously inoculated into immunodeficient NOD/SCID mice to assess their tumorigenicity (Fig. 4C). Endogenous JARID1B-positive CRC cells produced substantial tumor growth compared with the JARID1B-negative cells (Fig. 4D).

Figure 4

Tumorigenicity of JARID1B-depleted cells. (A) Visualization of JARID1B promoter activity using fluorescent d2-Venus labeling. (B) Quantitative RT-PCR analysis of JARID1B in sorted endogenous JARID1B-expressing and JARID1B-non-expressing CRC Colo201 cells (JPCs and JNCs, respectively). (C) Three weeks after injection, JPCs (blue circle) and JNCs (red circle) in mice. (D) Tumorigenicity of sorted endogenous JPCs or JNCs. JPCs had higher tumorigenicity.

JARID1B depletion suppresses therapy-resistant CRC cell growth

We measured cell proliferation following JARID1B depletion and observed that JARID1B depletion significantly suppressed cell proliferation (Fig. 5A) and cell invasion (data not shown). Hence, we determined the resistance of CRC cells to chemotherapy, a feature of JARID1B-depleted cells (17,18). The MTT assay illustrated that compared with the controls, continuous JARID1B depletion induced resistance to 5-FU in culture (Fig. 5B), suggesting that JARID1B depletion contributes to cancer stem cell (CSC) suppression. The depletion of endogenous JARID1B has been shown to suppress tumorigenicity and eliminate CSCs in melanomas (6). Thus, we inhibited endogenous JARID1B using shRNA and confirmed the CSC fraction. Depletion of endogenous JARID1B reduced the CD44+/ALDH+ CSC fraction, indicating that continuous endogenous JARID1B inhibition contributed to the eradication of CRC stem cells (Fig. 5C).

Figure 5

Suppression of cell growth and chemoresistance by JARID1B depletion. (A) Lentiviral-mediated depletion of endogenous JARID1B suppressed Colo201 cell proliferation compared with that of the controls, as shown by MTT assay (proliferation assay). (B) Chemosensitivity assay. JARID1B-depleted and control Colo201 cells were exposed to 5-FU in an MTT assay (proliferation assay). (C) Flow cytometric analyses of endogenous JARID1B-depleted Colo201 cells (#1 and #2). CD44+/ALDH+ fractions were smaller in JARID1B-depleted cells than in the control cells.

Discussion

Histone methylation/demethylation generally deactivates and activates genes by controlling the access of transcription factors to DNA. Histone dysregulation caused by genetic and epigenetic alterations is a hallmark of cancer (9,19). JARID1A/B-mediated histone H3K4 demethylation contributes to the silencing of retinoblastoma target genes in senescent cells, presumably by compacting chromatin and silencing certain genes (20). Distinct SA changes in histone-modification patterns are consistent with a repressive chromatin environment in the retinoblastoma tumor suppressor pathway (20). We found that JARID1B depletion, i.e., the inhibition of H3K4 demethylation, stimulated p16/INK4A transcription and suppressed tumor cell growth in vitro and in vivo, suggesting that it plays a role in cell growth regulation in human CRC (6).

The present findings are consistent with the notions that JARID1B depletion induces Jnk/Sapk-related senescence in CRC cells (21) and that endogenous JARID1B plays a role in controlling the cellular growth of CRCs. In cellular senescence, normal diploid cells lose the ability to divide. This anti-proliferative stress-response program acts as a potent tumor-suppressing mechanism (14,22). Growth-promoting and tumor suppressor genes are important factors controlling cancer cell proliferation. Cellular senescence can be triggered by a number of factors, including aging, DNA damage, oncogene activation and oxidative stress. Senescent cells have distinctive features, including stable cell cycle arrest and SA-β-gal activity. The tumor suppressor p16/INK4A plays a key role in regulating senescence induction, as may the tumor suppressor, p53. p16 acts through the retinoblastoma pathway to inhibit cyclin-dependant kinases, leading to G1 cell cycle arrest and senescence (14,23). Our results demonstrate that JARID1B plays a key role in CRC maintenance and that its continuous inhibition induces cellular senescence.

In the present study, we present a novel hypothesis that JARID1B suppression is an essential factor in cancer eradication. Although CSCs play a critical role in the survival, relapse and metastasis of malignant cancer cells (17), our data confirm the correlation between JARID1B suppression and CSCs. ALDH and CD44, a hyaluronic acid receptor, are considered useful markers of CRC stem cells (18). ALDH1A1 is responsible for CSC ALDH activity (24). It is known that CD44+/ALDH+ double-positive cells are CSC enrichment markers for reconstituted tumors in immunodeficient mice (18,24). In our study, endogenous JARID1B expression was lower in CD44+/ALDH+ cells than in CD44+/ALDH− or CD44−/ALDH− cells, suggesting that slowly proliferating JARID1B-expressing cells had a relatively undifferentiated phenotype that was compatible with that of CSCs (17,18). Our results demonstrate that JARID1B is involved in cell cycle regulation and that JARID1B facilitates cellular amplification and CSC maintenance. Future reports should further clarify the correlation between epigenetic factors and CSCs.

Therapeutic approaches to CRC include conventional therapies (surgical removal and chemoradiotherapy) and gene delivery strategies. For example, continuous JARID1B depletion could be achieved with antisense oligonucleotides or low-molecular-weight pharmacological therapeutics (25). A combination of p16/INK4A gene therapy and anti-JARID1B treatment may lead to the efficient induction of a SA phenotype in CRC cells.

Acknowledgements

We thank Dr Atsushi Miyawaki for providing us with the Fucci System plasmids. This study was partly supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology (H.I. and M.M.); a Grant-in-Aid from the 3rd Comprehensive 10-year Strategy for Cancer Control, Ministry of Health, Labour and Welfare (H.I. and M.M.); a grant from the Kobayashi Cancer Research Foundation (H.I.); and a grant from the Princess Takamatsu Cancer Research Fund, Japan (H.I.). M.K., T.K., D.S., T.S. and H.I. were partially supported by Chugai Co., Ltd. and Yakult Honsha Co., Ltd. via institutional endowments.

References

1 

Markowitz SD and Bertagnolli MM: Molecular origins of cancer: Molecular basis of colorectal cancer. N Engl J Med. 361:2449–2460. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Patai AV, Molnár B, Kalmár A, Schöller A, Tóth K and Tulassay Z: Role of DNA methylation in colorectal carcinogenesis. Dig Dis. 30:310–315. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Gargalionis AN, Piperi C, Adamopoulos C and Papavassiliou AG: Histone modifications as a pathogenic mechanism of colorectal tumorigenesis. Int J Biochem Cell Biol. 44:1276–1289. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Brabletz T, Jung A, Spaderna S, Hlubek F and Kirchner T: Opinion: migrating cancer stem cells-an integrated concept of malignant tumour progression. Nat Rev Cancer. 5:744–749. 2005. View Article : Google Scholar : PubMed/NCBI

5 

Kouzarides T: Chromatin modifications and their function. Cell. 128:693–705. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Roesch A, Fukunaga-Kalabis M, Schmidt EC, et al: A temporarily distinct subpopulation of slow-cycling melanoma cells is required for continuous tumor growth. Cell. 141:583–594. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Sakaue-Sawano A, Kurokawa H, Morimura T, et al: Visualizing spatiotemporal dynamics of multicellular cell-cycle progression. Cell. 132:487–498. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Haraguchi N, Ishii H, Mimori K, et al: CD13 is a therapeutic target in human liver cancer stem cells. J Clin Invest. 120:3326–3339. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Takahashi A, Imai Y, Yamakoshi K, et al: DNA damage signaling triggers degradation of histone methyltransferases through APC/C(Cdh1) in senescent cells. Mol Cell. 45:123–131. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Yamane K, Tateishi K, Klose RJ, et al: PLU-1 is an H3K4 demethylase involved in transcriptional repression and breast cancer cell proliferation. Mol Cell. 25:801–812. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Xiang Y, Zhu Z, Han G, et al: JARID1B is a histone H3 lysine 4 demethylase up-regulated in prostate cancer. Proc Natl Acad Sci USA. 104:19226–19231. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Kastan MB and Bartek J: Cell-cycle checkpoints and cancer. Nature. 432:316–323. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Ohtani N, Zebedee Z, Huot TJ, et al: Opposing effects of Ets and Id proteins on p16INK4a expression during cellular senescence. Nature. 409:1067–1070. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Rayess H, Wang MB and Srivatsan ES: Cellular senescence and tumor suppressor gene p16. Int J Cancer. 130:1715–1725. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Zhang X, Wu X, Tang W and Luo Y: Loss of p16(Ink4a) function rescues cellular senescence induced by telomere dysfunction. Int J Mol Sci. 13:5866–5877. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Vurusaner B, Poli G and Basaga H: Tumor suppressor genes and ROS: complex networks of interactions. Free Radic Biol Med. 52:7–18. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Reya T, Morrison SJ, Clarke MF and Weissman IL: Stem cells, cancer and cancer stem cells. Nature. 414:105–111. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Dewi DL, Ishii H, Kano Y, et al: Cancer stem cell theory in gastrointestinal malignancies: recent progress and upcoming challenges. J Gastroenterol. 46:1145–1157. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Hanahan D and Weinberg RA: Hallmarks of cancer: the next generation. Cell. 144:646–674. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Chicas A, Kapoor A, Wang X, et al: H3K4 demethylation by Jarid1a and Jarid1b contributes to retinoblastoma-mediated gene silencing during cellular senescence. Proc Natl Acad Sci USA. 109:8971–8976. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Maruyama J, Naguro I, Takeda K and Ichijo H: Stress-activated MAP kinase cascades in cellular senescence. Curr Med Chem. 16:1229–1235. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Rodier F and Campisi J: Four faces of cellular senescence. J Cell Biol. 192:547–556. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Ohtani N, Mann DJ and Hara E: Cellular senescence: its role in tumor suppression and aging. Cancer Sci. 100:792–797. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Marcato P, Dean CA, Giacomantonio CA and Lee PW: Aldehyde dehydrogenase: its role as a cancer stem cell marker comes down to the specific isoform. Cell Cycle. 10:1378–1384. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Yamamoto T, Nakatani M, Narukawa K and Obika S: Antisense drug discovery and development. Future Med Chem. 3:339–365. 2011. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ohta K, Haraguchi N, Kano Y, Kagawa Y, Konno M, Nishikawa S, Hamabe A, Hasegawa S, Ogawa H, Fukusumi T, Fukusumi T, et al: Depletion of JARID1B induces cellular senescence in human colorectal cancer. Int J Oncol 42: 1212-1218, 2013.
APA
Ohta, K., Haraguchi, N., Kano, Y., Kagawa, Y., Konno, M., Nishikawa, S. ... Ishii, H. (2013). Depletion of JARID1B induces cellular senescence in human colorectal cancer. International Journal of Oncology, 42, 1212-1218. https://doi.org/10.3892/ijo.2013.1799
MLA
Ohta, K., Haraguchi, N., Kano, Y., Kagawa, Y., Konno, M., Nishikawa, S., Hamabe, A., Hasegawa, S., Ogawa, H., Fukusumi, T., Uemura, M., Nishimura, J., Hata, T., Takemasa, I., Mizushima, T., Noguchi, Y., Ozaki, M., Kudo, T., Sakai, D., Satoh, T., Fukami, M., Ishii, M., Yamamoto, H., Doki, Y., Mori, M., Ishii, H."Depletion of JARID1B induces cellular senescence in human colorectal cancer". International Journal of Oncology 42.4 (2013): 1212-1218.
Chicago
Ohta, K., Haraguchi, N., Kano, Y., Kagawa, Y., Konno, M., Nishikawa, S., Hamabe, A., Hasegawa, S., Ogawa, H., Fukusumi, T., Uemura, M., Nishimura, J., Hata, T., Takemasa, I., Mizushima, T., Noguchi, Y., Ozaki, M., Kudo, T., Sakai, D., Satoh, T., Fukami, M., Ishii, M., Yamamoto, H., Doki, Y., Mori, M., Ishii, H."Depletion of JARID1B induces cellular senescence in human colorectal cancer". International Journal of Oncology 42, no. 4 (2013): 1212-1218. https://doi.org/10.3892/ijo.2013.1799
Copy and paste a formatted citation
x
Spandidos Publications style
Ohta K, Haraguchi N, Kano Y, Kagawa Y, Konno M, Nishikawa S, Hamabe A, Hasegawa S, Ogawa H, Fukusumi T, Fukusumi T, et al: Depletion of JARID1B induces cellular senescence in human colorectal cancer. Int J Oncol 42: 1212-1218, 2013.
APA
Ohta, K., Haraguchi, N., Kano, Y., Kagawa, Y., Konno, M., Nishikawa, S. ... Ishii, H. (2013). Depletion of JARID1B induces cellular senescence in human colorectal cancer. International Journal of Oncology, 42, 1212-1218. https://doi.org/10.3892/ijo.2013.1799
MLA
Ohta, K., Haraguchi, N., Kano, Y., Kagawa, Y., Konno, M., Nishikawa, S., Hamabe, A., Hasegawa, S., Ogawa, H., Fukusumi, T., Uemura, M., Nishimura, J., Hata, T., Takemasa, I., Mizushima, T., Noguchi, Y., Ozaki, M., Kudo, T., Sakai, D., Satoh, T., Fukami, M., Ishii, M., Yamamoto, H., Doki, Y., Mori, M., Ishii, H."Depletion of JARID1B induces cellular senescence in human colorectal cancer". International Journal of Oncology 42.4 (2013): 1212-1218.
Chicago
Ohta, K., Haraguchi, N., Kano, Y., Kagawa, Y., Konno, M., Nishikawa, S., Hamabe, A., Hasegawa, S., Ogawa, H., Fukusumi, T., Uemura, M., Nishimura, J., Hata, T., Takemasa, I., Mizushima, T., Noguchi, Y., Ozaki, M., Kudo, T., Sakai, D., Satoh, T., Fukami, M., Ishii, M., Yamamoto, H., Doki, Y., Mori, M., Ishii, H."Depletion of JARID1B induces cellular senescence in human colorectal cancer". International Journal of Oncology 42, no. 4 (2013): 1212-1218. https://doi.org/10.3892/ijo.2013.1799
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team