This article is mentioned in:

Introduction

Rhabdomyosarcoma (RMS) is a tumor that derives from early skeletal muscle cells and displays characteristics of muscle differentiation (1–6). There are two major histologic subtypes of RMS: alveolar (A)RMS and embryonal (E)RMS (7). Clinical evidence indicates that ARMS is more aggressive and has a significantly worse outcome than ERMS (8). It is well known that RMS cells, particularly ARMS cells, can infiltrate the bone marrow (BM) and, because they can resemble hematologic blasts, are sometimes misdiagnosed as acute leukemia blasts.

Genetic characterization of RMS has identified markers that show a correlation with histologic subtype. Specifically, ARMS is characterized by the translocation t(2;13)(q35;q14) in 70% of cases or the variant t(1;13)(p36;q14) in a smaller percentage of cases (9). These translocations disrupt the paired box 3 (PAX3) and 7 (PAX7) genes on chromosome 2 and 1, respectively, and the forkhead (FKHR) gene on chromosome 13, which leads to generation of PAX3-FKHR and PAX7-FKHR fusion genes in RMS (10–13). These fusion genes encode the fusion proteins PAX3-FKHR and PAX7-FKHR, which are involved in cell survival and dysregulation of the cell cycle in ARMS cells (14).

Moreover, both ARMS and ERMS are characterized by important epigenetic mutations and an epigenetic imbalance that may affect some important genes. One of the most common epigenetic changes is loss of imprinting (LOI) at chromosome locus 11p15.5, which alters the expression of the tandem gene IGF2-H19 (15–18). Encoded by the insulin-like growth factor 2 (IGF2) gene, IGF2 is a growth factor essential for normal embryonic and neonatal growth and development, while H19 gives rise to a non-coding mRNA that has the opposite effect on cell proliferation.

IGF2 signals through the tyrosine kinase insulin-like growth factor 1 receptor (IGF1R), which is frequently overexpressed in human RMS (19–25) and a number of other cancers (25). The function of H19-derived non-coding RNA (ncRNA) is largely unknown and still under debate. H19 is maternally expressed and may act either as a tumor suppressor or as an oncogene, depending on cancer type (26,27). It spans >2 kb and encodes short non-coding microRNAs, including miR-675, which was recently shown to be a negative regulator of IGF1R expression in mice (28). LOI in RMS cells due to hypermethylation of a differentially methylated region (DMR) that controls IGF2-H19 expression leads to formation of a potent autocrine loop (IGF2-IGF1R) and, at the same time, decreases the level of growth-suppressing H19-derived miRNAs.

The methylation of genomic DNA in cells is catalyzed by DNA methyltransferases (DNMTs). Recent studies have shown that application of methyltransferase inhibitors, such as 5-azacitidine (AzaC), may become a clinically relevant strategy for tumor growth inhibition (29,30). DNMT inhibitors, which are usually analogues of the cytidine nucleoside, bind to DNA methyltransferase 1, which results in DNA hypomethylation. As a result of DNA hypomethylation, some silenced tumor-suppressor genes like H19 may become activated.

In this study we evaluated the effect of the DNMT inhibitor AzaC on the tumorigenic potential of RMS cells. We found that DNA hypomethylation led to inhibition of RMS growth. This inhibition correlated with reactivation of H19 and upregulation of miR-675, which, as expected, negatively affected the expression of not only IGF1R (28) but also the insulin receptor (INSR), which we show for the first time. Thus, the downregulation of both receptors inhibits signaling of IGF2, insulin-like growth factor 1 (IGF1), and insulin (INS), which are all potent growth factors in RMS cells.

Materials and methods

Cell lines

We used human RMS cell lines (a gift of Dr Peter Houghton, World Children’s Research Hospital, Columbus, OH, USA), including the RH30 ARMS cell line and the RD ERMS cell line. RMS cells used for experiments were cultured in Roswell Park Memorial Institute medium (RPMI)-1640 (Sigma, St. Louis, MO, USA), supplemented with 100 IU/ml penicillin, 10 μg/ml streptomycin, and 50 μg/ml neomycin (Life Technologies, Grand Island, NY, USA) in the presence of 10% heat-inactivated fetal bovine serum (FBS) (Life Technologies). The cells were cultured in a humidified atmosphere at 37°C in 5% CO2 at an initial cell density of 2.5×104 cells/flask (Corning, Cambridge, MA, USA), and the medium was changed every 48 h.

Flow cytometry analysis of receptor expression

The expression of IGF1R, and INSR in RMS cell lines was evaluated by flow cytometry analysis as previously described (31). The antigens were detected with anti-human/mouse INS R/CD220 conjugated with APC (R&D Systems, Minneapolis, MN, USA); and phycoerythrin (PE)-anti-IGF1R monoclonal antibody, clone no. 33255 (R&D Systems). Briefly, the cells were stained in phosphate-buffered saline (PBS) (Ca2+- and Mg2+-free) supplemented with 2% bovine calf serum (BCS) (HyClone Laboratories, Inc., Logan, UT, USA). After the final wash, cells were resuspended in PBS and analyzed by FACS using the Navios Flow Cytometer (Beckman Coulter, Inc., Brea, CA, USA).

Quantitative reverse transcription-PCR (RT-qPCR)

Total RNA was isolated from cells treated with 5-azacitidine (AzaC), 2′-deoxy-5-azacytidine (DAC), or trichostatin A (TsA) (all from Sigma) and from cell controls with the RNeasy kit (Qiagen, Valencia, CA, USA). The RNA was reverse-transcribed with MultiScribe Reverse Transcriptase and oligo-dT primers (Applied Biosystems, Foster City, CA, USA). Quantitative assessment of mRNA levels was performed by RT-qPCR on an ABI 7500 instrument with Power SYBR-Green PCR Master Mix reagent. Real-time conditions were as follows: 95°C (15 sec), 40 cycles at 95°C (15 sec), and 60°C (1 min). According to melting point analysis, only one PCR product was amplified under these conditions. The relative quantity of a target, normalized to the endogenous control β-2 microglobulin gene and relative to a calibrator, is expressed as 2−ΔΔCt (fold difference), where Ct is the threshold cycle, ΔCt = (Ct of target genes) - (Ct of endogenous control gene, β-2 microglobulin), and ΔΔCt = (ΔCt of samples for target gene) - (ΔCt of calibrator for the target gene). The following primer pairs were used: IGF2 forward, CCATGTCCTCCTCGCATCTC and reverse, CGTGGCAGAGCTGGTGAAG; H19 forward, GGCTCTGGAAGGTGAAGCTAGA and reverse, GCGGGCGCTGCTGTT.

Methylation studies using a combined bisulfite restriction analysis (COBRA) assay and bisulfite sequencing

DNA was isolated with the DNeasy Blood and Tissue kit (Qiagen), and exactly 100 ng of genomic DNA prepared from the indicated cells were used for bisulfite modification with the EpiTect Bisulfite kit (Qiagen) according to the manufacturer’s instructions. Bisulfite-treated DNA was subjected to nested PCR with methylation-specific primers for the human H19-IGF2 DMR (32): 1st outer primer hH19O forward, AGG TGT TTT AGT TTT ATG GAT GAT GG and reverse, TCC TAT AAA TAT CCT ATT CCC AAA TAA CC; 2nd inner primer hH19I forward, TGT ATA GTA TAT GGG TAT TTT TGG AGG TTT and hH19-DMR-I reverse, same as hH19-DMR-O reverse. Next, the PCR products were cut with BstUI restriction enzyme and visualized on an agarose gel. In parallel after agarose gel electrophoresis, the PCR products were eluted using the QIAquick Gel Extraction kit (Qiagen). The eluted amplicons were subsequently ligated into the pCR2.1-TOPO vector and transformed into TOP10 bacteria using the TOPO TA Cloning kit (Invitrogen Life Technologies, Carlsbad, CA, USA). The plasmids were prepared using the QIAprep Spin Miniprep kit (Qiagen), sequenced with M13 forward and reverse primers, and the methylation pattern visualized using CpGviewer software. All experiments were conducted with three independent isolations of all cell populations.

miR-675 transfection and H19 gene cloning

Full-length H19 and Exon1 complementary DNA (GenBank: AF087017.1) was PCR-amplified and cloned into the pcDNA3.1 expression vector, and the vector was introduced into RH30 cells using Lipofectamine 2000 (both from Invitrogen Life Technologies). Cells were positively selected with G418 (200 μg/ml) for 2 weeks. The level of H19 overexpression was assessed by RT-qPCR, and the cells were subjected to proliferation assays. Enhanced expression of miR-675 was performed by transfecting RD and RH30 cells with miR-675-3p, -5p, or both (Sigma). Cells were seeded into 24-well plates (3×104) and transfected with Lipofectamine 2000 (Invitrogen Life Technologies) and 40 μM microRNA for 24 h. In parallel, cells were transfected with MISSION miRNA Negative Control (Sigma). Next, cells were replated for proliferation assays or receptor expression analysis by flow cytometry.

Cell cycle analysis

The cells were incubated with or without 0.5, 1, 2, 5, 10, 20, or 50 μM AzaC (Sigma). After 96 h, the cells were collected, washed with PBS, centrifuged at 1,200 rpm for 8 min, and resuspended in 1 ml RPMI-1640 medium supplemented with 10% FBS at a concentration of 106 cells/ml. Then, 2 μl of Vybrant DyeCycle Orange Stain (Invitrogen Life Technologies) was added to the cells, which were gently vortexed. Samples were kept at 37°C for 30 min in the dark and were analyzed using a flow cytometer (Navios, Beckman Coulter, Inc.).

Annexin V/propidium iodide (PI) assays for apoptosis

For Annexin V/PI assays, cells were stained with Annexin V-FITC and PI and evaluated for apoptosis by flow cytometry according to the manufacturer’s instructions (BD Biosciences, San Diego, CA, USA). Briefly, 1×106 cells were washed twice with PBS and stained with 5 μl of Annexin V-FITC and 10 μl of PI (5 μg/ml) in 1X binding buffer (10 mM HEPES, pH 7.4, 140 mM NaOH, 2.5 mM CaCl2) for 15 min at room temperature in the dark. The apoptotic cells were determined using a Navios flow cytometer (Beckman Coulter, Inc.). Annexin V+ PI− cells represented the early apoptotic populations, while Annexin V+ PI+ cells represented either late apoptotic or secondary necrotic populations.

Chemotaxis assay

Polycarbonate membranes (8-μm) were covered with 50 μl of 0.5% gelatin. The cells were detached with 0.5 mmol/l ethylenediaminetetraacetic acid (EDTA), washed in RPMI-1640, resuspended in RPMI-1640 with 0.5% bovine serum albumin (BSA), and seeded at a density of 3×104 in 120 μl into the upper chambers of Transwell inserts (Corning). The lower chambers were filled with IGF1 (100 ng/ml), IGF2 (100 ng/ml), INS (10 ng/ml), or 0.5% BSA in RPMI-1640 (control). After 24 h, the inserts were removed from the Transwell supports. Cells remaining in the upper chambers were scraped off with cotton wool, and cells that had transmigrated were stained by HEMA 3 according to the manufacturer’s instructions (Thermo Fisher Scientific, Pittsburgh, PA, USA) and counted either on the lower side of the membrane or on the bottom of the Transwell chamber.

Colony-formation assay

Cells were incubated with or without 1 or 5 μM AzaC for 72 h, collected, counted, mixed in 0.35% top agar (in RPMI-1640 medium supplemented with 10% FBS) and plated at 1,250 cells/well onto 24-well plates containing a solidified bottom layer (0.5% base agar in the same growth medium). Every 3 days, colonies were fed with 250 μl/well culture medium with 10% FBS. After 21 days, unstained colonies were counted.

Cell proliferation

Cells were plated in culture flasks at an initial density of 104 cells/cm2 in the presence or absence of AzaC and miR-675-3p or -5p or both. The cell number was calculated at 24, 48, 72, and 96 h after culture initiation. At the indicated time points, the cells were harvested from the culture flasks by trypsinization, and the number of cells was determined using a Navios cytometer.

Phosphorylation of intracellular pathway proteins and western blotting

Western blotting was performed on extracts prepared from RMS cell lines (2×106 cells) that were kept in RPMI medium containing low levels of BSA (0.5%) to render the cells quiescent, as previously described (33). The cells were divided and stimulated with optimal doses of IGF1 (100 ng/ml), IGF2 (100 ng/ml), INS (10 ng/ml) for 5 min at 37°C and then lysed (for 10 min) on ice in RIPA buffer (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), containing protease and phosphatase inhibitors (Roche Diagnostics Corp., Indianapolis, IN, USA). Subsequently, the extracted proteins were separated by either 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and the fractionated proteins were transferred to a PVDF membrane (Bio-Rad, Hercules, CA, USA). Phosphorylation of the intracellular kinases, p42/44 mitogen-activated protein kinase (MAPK) (Thr202/Tyr204) was detected using commercial mouse phospho-specific mAb (p42/44) polyclonal antibody (Cell Signaling Technology, Inc., Danvers, MA, USA) with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG secondary antibody (Santa Cruz Biotechnology, Inc.). Equal loading in the lanes was evaluated with appropriate mAb: p42/44 anti-MAPK clone no. 9102 (Cell Signaling Technology, Inc.). The membranes were developed with an enhanced chemiluminescence (ECL) reagent (Amersham Pharmacia Biotech, Little Chalfont, UK).

Statistical analysis

All results are presented as mean ± standard error of the mean (SEM). Statistical analysis of the data was performed using the non-parametric Mann-Whitney test or Student’s t-test, with p<0.05 considered significant.

Results

Hypermethylation at the DMR for the IGF2-H19 tandem gene is erased after exposure of RMS cells to AzaC

Hypermethylation of the DMR at the IGF2-H19 locus (known as LOI) is an important epigenetic change occurring in ARMS and ERMS cells and leads to overexpression of IGF2 and downregulation of H19. As mentioned above, while IGF2 is an autocrine factor for RMS cells that stimulates proliferation of these cells after binding to the IGF1R and INSR, H19-derived ncRNA gives rise to several miRNAs that negatively regulate cell proliferation. One of these miRNAs, miR-675, downregulates IGF1R, which in turn binds IGF2 and IGF1 in murine placental cells (28).

To better address the LOI phenomenon at the DMR for the IGF2-H19 locus and the role of IGF2 and H19-derived miR-675 in the proliferation of RMS cells, we employed the DNMT inhibitor AzaC to reverse hypermethylation of the DMR at the IGF2-H19 locus (Fig. 1A and B). We found that exposure of the RH30 ARMS cell line and the RD ERMS cell line to 5 μM AzaC resulted in demethylation of the hypermethylated DMR for this tandem gene from ~76 to 25% and from ~80 to 29%, respectively.

Figure 1 The effect of 5-azacytidine (AzaC) on the methylation state of the differentially methylated region (DMR) at the IGF2-H19 locus and expression of this tandem gene. After 72 h of AzaC treatment, the DMR for the IGF2-H19 locus became demethylated in (A) RH30 and (B) RD cells as evaluated by bisulfite modification of DNA followed by sequencing. (C–F) Time-lapse expression of H19 and insulin-like growth factor 2 (IGF2) mRNA by quantitative reverse transcription-PCR (RT-qPCR) in cells exposed to different doses of AzaC. Increase in expression of H19 mRNA and a decrease in expression of IGF2 mRNA was noted in (C and E) RH30 and (D and F) RD cells. *P<0.05.

The erasure of methylation at the DMR for the IGF2-H19 locus in response to increasing doses of AzaC resulted, as predicted, in upregulation of H19 and downregulation of IGF2 expression at the mRNA level (Fig. 1C–F). Similar results were obtained by employing another DNMT inhibitor, decitabine (data not shown). At the same time, TsA, which is a potent deacetylating agent, did not change the IGF2/H19 mRNA ratio in RMS cells (data not shown).

Downregulation of IGF2 after AzaC treatment was subsequently confirmed at the protein level in RH30- and RD-derived conditioned media by employing a sensitive ELISA (data not shown).

Exposure to AzaC inhibits proliferation of RMS cells

Next, we performed in vitro assays to see whether AzaC, by down-regulating IGF2 and upregulating H19, affects proliferation of RMS cells. First, to exclude a non-specific toxic effect of AzaC treatment on RMS cells, we evaluated the effect of increasing doses of AzaC on Annexin V binding in RH30 and RD cells (data not shown). By employing PI staining and Annexin V binding, we found that AzaC does not significantly affect cell survival at concentrations <10 μM.

Next, by employing an anchorage-dependent proliferation assay in plastic dishes (Fig. 2A and C) and an anchorage-independent colony-forming assay in soft agar (Fig. 2B and D), we observed an AzaC dose-dependent inhibition of RH30 (Fig. 2A and B) and RD (Fig. 2C and D) cell proliferation. The effect of AzaC on proliferation of RMS cells was subsequently evaluated by employing FACS-based time-lapse monitoring of the cell cycle (Fig. 3). We found that AzaC at a dose of 5 μM inhibits cell proliferation in G2/M phase and reduces the number of cells in G1 phase in both RH30 (Fig. 3A) and RD (Fig. 3B) cells.

Figure 2 5-Azacytidine (AzaC) affects anchorage-dependent and -independent cell proliferation. (A and B) RH30 and (C and D) RD cells were treated with increasing doses of AzaC (0–10 μM), and their proliferative capacity was measured in cultures in (A and C) anchorage-dependent plastic dishes and (B and D) anchorage-independent soft agar cultures. Combined data from three independent experiments are shown. *P<0.05.

Figure 3 Cell cycle analysis of rhabdomyosarcoma (RMS) cells exposed to 5-azacytidine (AzaC). AzaC inhibits cell proliferation in G2/M phase and decreases the number of cells in G1 phase. Data were collected by flow cytometry and analyzed by ModFit software. (A) RH30 cells, (B) RD cells. A representative analysis out of three independent experiments is shown.

We are aware that this effect is most likely the result of a combined increase in H19 expression as well as epigenetic changes in other genes that regulate the cell cycle. At this point, however, we observed that AzaC treatment did not reactivate other epigenetically regulated suppressor genes, such as p16INK4A and p14, and did not increase the expression of p21waf1 and p53 (data not shown). Furthermore, despite the fact that IGF2 is downregulated in RMS cells after AzaC treatment, addition of this growth factor to RMS cells did not abrogate AzaC-mediated G2/M inhibition, which again indicates major involvement of H19-derived miR-675 in expression of the IGF2 signaling receptor, IGF1R.

The negative effect of H19 expression on RMS cell proliferation may be partially explained by miR-675-mediated downregulation of IGF1R expression

As mentioned above, H19-derived miR-675 downregulates the expression of IGF1R in murine placental cells (24). To address whether miR-675 is involved in regulation of IGF1R expression in human RMS cells, we measured the expression of two isoforms of this miRNA (miR-675-3p and -5p) in RH30 and RD cells, unexposed and exposed to AzaC (Fig. 4A and B). We observed an AzaC dose-dependent increase in both miR-675 isoforms in these cells.

Figure 4 The H19-derived miR-675 effect on proliferation of rhabdomyosarcoma (RMS) cells. (A and B) Increase in H19-derived miR-675 expression in (A) RH30 and (B) RD cells treated by increasing doses of 5-azacytidine (AzaC). miR-675 expression was evaluated by quantitative reverse transcription-PCR (RT-qPCR), and U6RNA served as internal control. (C and D) Effect of H19 and H19 Exon1 cDNA cloned into the pcDNA3.1 vector on proliferation of RH30 cells in (C) plastic dishes and (D) a soft agar colony-forming assay. (E and F) Effect of H19-encoded miR-675 (-3p and -5p) on proliferation of (E) RH30 and (F) RD cells. All experiments were repeated three times. *P<0.05.

Next, to shed more light on the role of H19 and miR-675 on proliferation of RMS cells we cloned the entire H19 gene and H19 Exon1 (E1.1) into the pcDNA3.1 expression vector and transfected them into RH30 cells. We observed an inhibitory effect of H19 and H19 Exon1 (E1.1) ncRNA on proliferation of RMS cells, both in plastic dishes (Fig. 4C) and in a soft agar colony-forming assay (Fig. 4D). To better address the potential involvement of H19-encoded miR-675, we transfected RH30 and RD cells with miR-675-3p or -5p and observed the expected decrease in proliferation of RH30 and RD cells (Fig. 4E and F).

Effect of AzaC on the expression of the IGF1R and INSR

Our results described above demonstrate an inhibitory effect of AzaC on the proliferation of RMS cells due to upregulation of miR-675 and downregulation of IGF1R expression. However, it is known that, in addition to IGF2, IGF1 and INS also affect the proliferation of RMS cells (19–25). While IGF2 binds to IGF1R, both IGF1 and INS interact also with the INSR. Since we did not see a positive effect of IGF1 or INS as a replacement for IGF2 in AzaC-treated cells, we asked whether miR-675 also downregulates the INSR.

In order to clarify this issue, we applied a bioinformatic tool (rna22v1.0) to search for potential miR-675 targets in the INSR mRNA. As with IGF1R, we observed the presence of miR-675-3p and/or -5p sites in the 3′UTR and coding sequence of the INSR gene (data available upon request).

To confirm whether AzaC affects the expression of the INSR, we first evaluated the expression of the INSR in parallel with the expression of IGF1R in RH30 and RD cells by FACS analysis (Fig. 5A and B). We found that exposure of RMS cells to AzaC decreases the expression of IGF2-, IGF1-, and INS-binding receptors in a dose-dependent manner and, moreover, attenuates activation of MAPK p42/44 in RMS cells stimulated with INS, IGF1 and 2 and exposed to AzaC (Fig. 5C and D).

Figure 5 Effects of 5-azacytidine (AzaC) on the expression of the insulin receptor (INSR) and the insulin-like growth factor 1 receptor (IGF1R). (A) RH30 and (B) RD cells were exposed to increasing doses of AzaC, and after 48 h the receptor expression of the INSR and the IGF1R was assessed by flow cytometry. *P<0.05. (C and D) Effect of AzaC treatment on insulin (INS), insulin-like growth factor 1 (IGF1) and 2 (IGF2) signaling in rhabdomyosarcoma (RMS) cells. (C) RH30 and (D) RD cells, untreated or AzaC-treated for 72 h, were stimulated by INS (10 ng/ml), IGF1 (100 ng/ml), or IGF2 (100 ng/ml) for 5 min, and phosphorylation was assessed by western blotting. The experiment was repeated three times with similar results.

This effect of AzaC on INSR and IGF1R signaling was correlated with a decrease in the chemotactic responsiveness of RH30 and RD cells to INS, IGF1 and 2 gradients (Fig. 6A and B). Importantly, as was the case for the IGF1R (Fig. 5A and B), downregulation of the INSR in RH30 and RD cells transfected with miR-675-3p and -5p isoforms was observed by FACS analysis (Fig. 6C and D).

Figure 6 Chemotaxis of rhabdomyosarcoma (RMS) cells exposed to 5-azacytidine (AzaC) in response to insulin (INS), insulin-like growth factor 1 (IGF1), and 2 (IGF2). (A) RH30 and (B) RD cells unexposed (white bars) or exposed to a chemotactic gradient of INS (10 ng/ml), IGF1 (100 ng/ml), or IGF2 (100 ng/ml). (C and D) Effect of miR-675-3p and -5p employed alone or in combination with expression of insulin receptor (INSR) and insulin-like growth factor 1 receptor (IGF1R) in (C) RH30 and (D) RD cells according to FACS analysis. All experiments were repeated three times with similar results. *P<0.05.

Discussion

Changes in DNA methylation are among the most common molecular alterations in human neoplasia (34–37). The best characterized are related to hypermethylation of DNA in the DMRs of genes that regulate cell proliferation, such as the IGF2-H19 tandem gene (38).

The IGF2-H19 locus is part of a cluster of imprinted genes on human chromosome 11p15, which also includes KCNQ1 (39). In normal tissues, methylation of the DMR for this gene on the paternal chromosome prevents binding of the CTCF insulator protein to the DMR, which allows the distal enhancer to stimulate the expression of IGF2 from the paternal chromosome. On the maternal chromosome, the DMR for IGF2-H19 is demethylated and CTCF binds to this region of DNA, with the result that the distal enhancer activates transcription of only the H19 gene (40). Thus, in normal somatic cells a balance is established between transcription of IGF2 and H19 from paternally and maternally derived chromosomes, respectively. This balance is perturbed in several malignancies in which DMRs on both maternally and paternally derived chromosomes are hypermethylated, and a distal enhancer stimulates transcription of the IGF2 gene from both chromosomes (41). This situation is known as LOI for this particular DMR.

LOI at the IGF2-H19 locus is observed in patients suffering from Beckwith-Wiedemann syndrome, in which neonates suffer from organomegaly and frequently develop pediatric sarcomas, including RMS (42). However, LOI at the IGF2-H19 locus that develops independently of Beckwith-Wiedemann syndrome is also observed in RMS (15,16) as well as in several other malignancies in mice and humans. In all these cases, the proliferation of malignant cells is driven by overexpression of IGF2. These cells also have higher expression of IGF1R and INSR because of the lack of H19-derived miR-675, which downregulates the expression of IGF1R (28). What is most important in this report, we provide for the first time evidence that miR-675 also downregulates the expression of INSR.

Thus, in toto, LOI at the IGF2-H19 locus leads to enhanced stimulation of cancer cells by the family of insulin-like growth factors and INS due to upregulation of autocrine IGF2 and, as a result of H19 downregulation, to the high expression of IGF1R and INSR, which bind IGF2 and 1, as well as INS.

Based on these findings, it was tempting to postulate that demethylation of the DMR at the IGF2-H19 locus would have the opposite effect, leading to attenuation of INS and insulin-like growth factor signaling in RMS cells. To test this hypothesis, we employed the DNMT inhibitor AzaC to widely demethylate the DNA in RMS cells. We were aware that this non-specific approach would also lead to the demethylation of several other genes. To our surprise, however, exposure of RMS cells to AzaC resulted in inhibition of cell proliferation that was paralleled by a decrease in IGF2 expression, both at the mRNA and protein levels, as well as an increase in H19-derived miR-675, which led to downregulation of IGF1R and INSR expression. The inhibitory effect of miR-675 on the expression of IGF1R and also the INSR (as is shown here) in human RMS cells was also accomplished by exposure of RMS cells to an H19 expression vector or by transducing cells with miR-675.

We are aware that AzaC leads to demethylation of several other genes, but our data tend to confirm a crucial role of the IGF2-H19 locus in driving the pro-proliferative effect of INS and insulin-like growth factor signaling in human RMS cells. Moreover, a similar result was obtained with human ARMS and ERMS cell lines. In RMS cells, AzaC at non-cytotoxic doses strongly inhibited anchor-dependent cell proliferation, caused cell cycle arrest in G2 phase, as well as decreased anchor-independent growth in a colony-formation assay in soft agar in plastic dishes. Most importantly, the effect of AzaC on the methylation state of the DMR at the IGF2-H19 locus was confirmed in our study by DNA bisulfite exposure and subsequent sequencing.

Our results are in accordance with previously published study in which AzaC efficiently reactivated the expression of silenced H19 by demethylation of the DMR within the IGF2-H19 locus (43). By contrast, a potent deacetylating agent, TsA, did not influence the expression from IGF2-H19. This result is in agreement with results obtained with murine cells in which the epigenetic state of the IGF2-H19 locus was regulated by methylation and not by acetylation (44,45).

AzaC is a chemical analogue of the cytosine nucleoside, which is present in DNA and RNA. AzaC induces antineoplastic activity by employing two mechanisms (46,47). At low doses, it inhibits DNMT activity, causing hypomethylation and synthesis of DNA. As a ribonucleoside, at high doses AzaC incorporates into RNA, which leads to the disassembly of polyribosomes and defective methylation and acceptor function of transfer RNA and finally results in the inhibition of protein synthesis. AzaC is employed in some clinical settings, for example, as an antineoplastic drug to inhibit HIV and HTLV infection in leukemia or to induce γ-globin synthesis in thalassemia patients (48–52). Our results indicate that AzaC could also be employed as a drug for RMS patients. This, however, will require further study in animal xenotransplant models of RMS.

In conclusion, we have demonstrated for the first time the in vitro efficacy of AzaC as a novel potential drug for treatment of RMS. Our data also confirm a pivotal role for LOI at the IGF2-H19 locus in the proliferation and migration state of RMS cells. We also show that IGF1R is regulated by miR-675 in human cells, as has been reported for murine cells, and for the first time that miR-675 also regulates the expression of human INSR. Further studies are needed to assess whether changes in the methylation state of other genes also contribute to the observed effects of AzaC.

Acknowledgements

Supported by Maestro grant 2011/02/A/NZ4/00035 and Innovative Economy Operational Programme POIG.01.01.02-00-109/09 to M.Z.R., and FNP ‘Homing PLUS’ programme co-financed from European Union, Regional Development Fund to M.T.

References