Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
October-2016 Volume 49 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2016 Volume 49 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer

  • Authors:
    • Tonghai Huang
    • Kelin She
    • Guilin Peng
    • Wei Wang
    • Jun Huang
    • Jingpei Li
    • Zheng Wang
    • Jianxing He
  • View Affiliations / Copyright

    Affiliations: Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong 510515, P.R. China, State Key Laboratory of Respiratory Disease, National Clinical Research Center for Respiratory Disease, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong 510120, P.R. China, Department of Thoracic Surgery, Shenzhen People's Hospital, Shenzhen, Guangdong 518020, P.R. China
  • Pages: 1437-1444
    |
    Published online on: July 29, 2016
       https://doi.org/10.3892/ijo.2016.3637
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

MicroRNAs are a class of small endogenous non-coding RNAs that play crucial roles in the initiation and progression of human cancers. miR-186 was found decreased in various human malignancies and function as a tumor suppressor. However, the regulating mechanism of miR-186 in growth and metastasis of human non-small cell lung cancer (NSCLC) is still poorly understood. We investigated the role of miR-186 in the growth and metastasis of human NSCLC. In the present study, we found that miR-186 was significantly decreased in lung cancer tissues and cells. Furthermore, overexpression of miR-186 suppressed lung cancer cell proliferation, migration and invasion, and induced cell apoptosis. Moreover, we found that confirmed mitogen-activated protein kinase kinase kinase 2 (MAP3K2) protein was increased in lung cancer tissues and confirmed that MAP3K2 is a target gene of miR-186. In addition, knockdown of MAP3K2 by RNA interference inhibited lung cancer cell proliferation, migration and invasion, and promoted cell apoptosis in vitro. Furthermore, we observed tthat the overexpression of MAP3K2 partially reversed the inhibitory effect of miR-186 on the proliferation and metastasis of A549 and HCC827 cell lines. Taken together, our data indicated that miR-186 regulates lung cancer growth and metastasis through suppressing MAP3K2 expression, at least partly. Therefore, miR-186-MAP3K2 may represent a new and useful potential clinical treatment and diagnosis target for NSCLC.

Introduction

Lung carcinoma is one of the most common cancers in both male and female and the leading cause of cancer related death all around the world (1). In 2015, there were an estimated more than 222,0000 new cases of lung cancer accounting for 14% of all new diagnoses from cancer, and leading to an estimated 158,040 cancer deaths, in the United States (2). Moreover, it is anticipated that the incidence of lung cancer will keep increasing in Asian and many developing countries with the high and increasing number of smoking. Rates of lung cancer are mainly determined by smoking patterns, but medical, occupational, and environmental radiation exposures, have also been shown to increase risks of lung cancer (3).

Lung cancer is a heterogeneous disease that has historically been divided into two main types based on the disease patterns and treatment strategies: small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) (4,5), and NSCLC comprises approximately 80% of all lung cancers (6). Although the treatments of lung cancer have advanced and improved greatly, the 5-year survival rate of lung cancer patients is little improved (1). Over the last decades, the local control for early-stage non-small cell lung cancer (NSCLC) has dramatically improved for lung cancer patients (7,8). However, nearly 20% of early-stage lung cancer patients are developing distant metastasis (9,10). In recent decades, tremendous efforts were made to understand the occurrence and development of lung cancer, but the metastasis mechanisms of NSCLC have not been clarified.

MicroRNAs (miRNAs) are a class of small endogenous non-coding RNAs with approximately 18–22 nucleotides in length. miRNAs can directly bind to the 3′ untranslated regions (3′-UTRs) of target genes resulting in negatively regulating mRNA stability or suppressing translation (11,12). Increasing number of research has proven that miRNAs are involved in various cellular and molecular processes including growth, apoptosis, differentiation, metabolism and immunity (13,14). In addition, many studies have confirmed that miRNAs play crucial roles in the initiation and progression of human cancers, such as ovarian cancer (15), hepatocellular carcinoma (16), breast cancer (17) and lung carcinoma (18). miR-186 was found deregulated in various human cancers. The expression of miR-186 was observed significantly increased in pancreatic cancer tissues (19). Nevertheless, recent studies reported the expression of miR-186 was decreased in various human malignancies and function as a tumor suppressor (20,21). A previous study showed that miR-186 was significantly decreased in non-small cell lung cancer (22,23). However, the concrete mechanism of miR-186 in lung cancer metastasis remains elusive.

In the present study, we found that miR-186 was significantly decreased in lung cancer tissues. Overexpression of miR-186 suppressed lung cancer cell proliferation, invasion, migration and induced apoptosis by direct targeting of mitogen-activated protein kinase kinase kinase 2 (MAP3K2). Our results revealed the miR-186-MAP3K2 may represent a new potential target for diagnosis and treatment of lung carcinoma.

Materials and methods

Clinical specimens

A total of 20 cases of NSCLC specimens (20 tumor tissues and 20 matched adjacent normal tissues) were obtained from the Nanfang Hospital, Southern Medical University from 2014 to 2015. All patients underwent surgery before receiving chemotherapy and/or radiation therapy. All patients were histologically diagnosed according to the clinicopathological criteria of the UICC. The median age of NSCLC patients was 51.7 years (range, 49–68 years). All of the malignant tissues were from stage II–III tumors. The study was approved by the Ethics Committee of the Nanfang Hospital, Southern Medical University, and all volunteers provided informed consents for the use of their specimens in this study.

Cell lines and culture condition

Primary pulmonary epithelial cells (HPAEpiC) were purchased from ScienCell Research Laboratories (Carlsbad, CA, USA) and cultured according to the supplier’s instructions using alveolar epithelial cell medium (ScienCell Research Laboratories; cat. #3201) with 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA). Human lung cancer cell lines A549, 95-D, HCC827 and NCI-H1650 were obtained from Shanghai Institute of Cell Biology (Shanghai, China). Four cancer cell lines were cultured in the RPMI-1640 medium (ATCC, Manassas, VA, USA) with 10% FBS. The media contained 100 UI/ml penicillin and 100 μg/ml streptomycin. Cells were cultured and maintained in a humidified incubator at 37°C and supplemented with 5% CO2.

Plasmid construction

The 3′-untranslated region (3′-UTR) of MAP3K2 was amplified from human genomic DNA and cloned downstream of psi-CHECK2 vector (Promega, Madison, WI, USA), and termed MAP3K2-3′UTR-WT. Mutations of miR-186 binding sites (AUUCUUU to CAAUCU) were introduced by QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA), and termed MAP3K2-3′UTR-MUT.

For overexpression plasmid cloning, MAP3K2 cDNA was first reverse-transcribed from the RNA of the A549 cells using M-MLV Reverse Transcriptase (Promega) with oligo(dT)18 primer. The coding region (1860 bp) was then amplified by PCR from cDNA and inserted into the HindIII/BamHI site of the pcDNA3.1 vector (Promega). The following sequences were used: forward primer 5′-AAGCTTATGGATGATCA GCAAGC-3′ and reverse primer 5′-GGATCCCTAGTGATA ATGCACAAACAT-3′. Cloned products were confirmed by DNA sequencing.

Cell transfection

A549 or HCC827 (1×104) cells/well were seeded in 96-well culture plates. After culture for 24 h, miR-186 mimics (100 mM) (Shanghai GenePharma Co., Ltd., Shanghai, China) or MAP3K2-siRNA (100 mM) (GenePharma) or pcDNA3.1-MAP3K2 (20 μg) or equal amount of negative control sequences and vectors were transfected into A549 or HCC827 cells using Lipofectamine 2000 (Beyotime Institute of Biotechnology, Shanghai, China). After cultured for different times, cells were harvested and used in further study.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA from tissues or 1×107 cells was extracted using TRIzol reagent (Invitrogen Inc., Waltham, MA, USA). SYBR PrimeScript miRNA RT PCR kit (Takara Bio, Dalian China) was used to detect the miR-186 expression level and results were normalized to U6. For qRT-PCR, 2 μg of total RNA was used for reverse-transcription PCR using M-MLV Reverse Transcriptase (Promega). SYBR-Green Real-Time Master Mix (Toyobo Co., Ltd., Osaka, Japan) was used to analyze the relative expression of MAP3K2 and GAPDH was used as an internal control. All primers were synthesized by Sangon (Sangon Biotech Co., Ltd., Shanghai, China) (Table I). Applied Biosystems 7500 Sequence Detection system (Applied Biosystems, Foster City, CA, USA) was used to perform qRT-PCR and data collection. miR-186 and MAP3K2 expression levels were calculated and normalized using the 2−ΔΔCt method.

Table I

Primer sequences used for miRNA and mRNA expression analysis.

Table I

Primer sequences used for miRNA and mRNA expression analysis.

NamePrimer sequence (5′-3′)
miR-186-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTTTGGGCT
U6-RT CGCTTCACGAATTTGCGTGTCAT
U6-F CTCGCTTCGGCAGCACA
U6-R AACGCTTCACGAATTTGCGT
miR-186-F ACACTCCAGCTGGGCAGCAGCACACT
Universal-R CTCAACTGGTGTCGTGGA
MAP3K2-F CTTGCTACATGAGCGAATTGTT
MAP3K2-R AATCTGACGGGTGTATTTCCTA
GAPDH-F TGTTCGTCATGGGTGTGAA
GAPDH-R ATGGCATGGACTGTGGTCAT

[i] F, forward primer; R, reverse primer; RT, reverse transcription primer.

Protein extraction and western blotting

Lung cancer tissues and cells were washed with PBS (pH 7.4) twice and lysed in RIPA lysis and extraction buffer (Thermo Fisher Scientific, Waltham, MA, USA) with 1% (v/v) aprotinin (Millipore, Billerica MA, USA) and 1% (v/v) pepstatin (Millipore) on ice for 20 min. The lysates or homogenates were centrifuged at 12000 × g, 4°C for 15 min. Then the collected supernatant and protein concentration was determined using a Pierce BCA protein assay kit (Thermo Fisher Scientific). Protein samples were separated by 12% SDS-PAGE and detected by western blot analysis using rabbit monoclonal anti-MAP3K2 (ab33918; Abcam, Cambridge, MA, USA) and rabbit monoclonal anti-GAPDH (ab181602; Abcam). Goat anti-rabbit IgG H&L (ab6721; Abcam) secondary antibody with HRP conjugated and results were developed using the ECL technique (SuperSignal West Femto; Pierce, Rockford, IL, USA).

Cell viability assay

The Cell Counting Kit-8 was used to estimate cell proliferation (24). In brief, 1×104 A549 or HCC827 cells/well were seeded in 96-well culture plates. After transfected with miR-186 mimics (100 mM) (GenePharma) or MAP3K2-siRNA (100 mM) (GenePharma) or pcDNA3.1-MAP3K2 (20 μg) for 24, 48 and 72 h, cells were treated with CCK-8 solution for 1 h at room temperature. The absorbance was measured at 450 nm using a microplate reader Thermo Plate (Rayto Life and Analytical Science Co., Ltd., Shenzhen, China).

Apoptosis assay

The apoptosis of A549 or HCC827 cells transfected with miR-186 mimics or MAP3K2-siRNA or pcDNA3.1-MAP3K2 (20 μg) was tested using Annexin V-FITC/PI apoptosis detection kit (BD Biosciences, San Jose, CA, USA) by flow cytometry as previously described (24). All experiments were performed in triplicate.

Invasion and migration assay

The invasion and migration ability of A549 or HCC827 cells transfected with miR-186 mimics or MAP3K2-siRNA or pcDNA3.1-MAP3K2 (20 μg) was analyzed in 24-well Transwell chambers (8 μm; Millipore) as previously described (25). The invading cells were fixed with 4% paraformaldehyde in PBS, stained with 0.5% crystal violet (Sigma-Aldrich, St. Louis, MO, USA) for 15 min and counted. Invaded or migrated cells were counted under a microscope (IX71; Olympus, Tokyo, Japan) at ×200 magnification.

Statistical analysis

All experiments were performed in triplicate and data were expressed as the mean ± SD. The difference among groups was determined by one-way analysis of variance (ANOVA) analysis and comparison between two groups was analyzed by a paired/unpaired Student’s t-test using SPSS 18.0 program (SPSS Inc., Chicago, IL, USA). The differences were considered statistically significant at P<0.05.

Results

miR-186 is decreased in human lung cancer tissues and cells

We first investigated the miR-186 expression levels in human lung cancer tissues and corresponding normal tissues. We found that miR-186 was markedly decreased in human lung cancer tissues (P=0.0066; Fig. 1A). Furthermore, we also detected the miR-186 expression levels in four lung cancer cell lines. We found that miR-186 was significantly decreased in A549, 95-D and HCC827 cells (Fig. 1B). Based on the above results, lung cancer cell lines A549 and HCC827 were selected for the present study.

Figure 1

Expression of miR-186 in lung cancer tissues and cell lines. (A) Expression of miR-186 in lung cancer tissues and non-cancerous tissues was examined by qRT-PCR. (B) Expression of miR-186 in lung cancer cells and primary pulmonary epithelial cells was examined by qRT-PCR. **P<0.01.

Forced expression of miR-186 induces cell apoptosis and suppresses proliferation

To evaluate the biological functions of miR-186 on cell apoptosis and proliferation, miR-186 mimics were first transfected into A549 and HCC827 cells. Expression of miR-186 was assessed using qRT-PCR analysis and a respective 26.73- and 22.92-fold increased in miR-186 mimic-transfected cells compared with negative control (Fig. 2A). Furthermore, we investigated miR-186 on cell apoptosis using flow cytometric analysis. We found that more apoptotic cells were observed in A549 (Fig. 2B) and HCC827 (Fig. 2C) cells after forced expression of miR-186. The apoptosis rates of A549 cells transfected with miR-186 mimics and NC were 14.2±1.2 and 5.7±0.9%, respectively (Fig. 2D). In addition, the apoptosis rates of HCC827 cells transfected with miR-186 mimics and NC were 15.6±1.1 and 9.6±1.3%, respectively (Fig. 2D). Finally, we studied the role of miR-186 on proliferation using CCK-8 assay. We found that overexpression of miR-186 exhibited significantly lower proliferation rates of A549 (Fig. 2E) and HCC827 (Fig. 2F) cells.

Figure 2

miR-186 inhibits growth and promotes apoptosis of lung cancer cells in vitro. (A) miR-186 expression level was tested by qRT-PCR in A549 and HCC827 cells transfected with miR-186 mimics and negative control. (B) Flow cytometric analysis of A549 cell apoptosis after miR-186 transfection. (C) Flow cytometric analysis of HCC827 cell apoptosis after miR-186 transfection. (D) The apoptosis rates of A549 and HCC827 cells after miR-186 transfection. (E) The effect of miR-186 on A549 cell proliferation was determined by CCK-8 assay at 24, 48 and 72 h. (F) The effect of miR-186 on HCC827 cell proliferation was determined by CCK-8 assay at 24, 48 and 72 h. ***P<0.001.

Overexpression of miR-186 inhibits cell migration and invasion

Migration and invasion abilities of A549 and HCC827 cells after transfected with miR-186 mimics were assessed using Transwell assay. Transfection of miR-186 mimics markedly reduced the number of A549 (Fig. 3A and B) and HCC827 (Fig. 3C and D) cells that passed through the Transwell chamber. The results indicated that miR-186 might inhibit cell migration and invasion.

Figure 3

miR-186 inhibits migration and invasion of lung cancer cells in vitro. (A) The effect of miR-186 on A549 cell migration and invasion was determined by Transwell assay. (B) The average invaded or migrated A549 cells in different experimental groups. (C) The effect of miR-186 on HCC827 cell migration and invasion was determined by Transwell assay. (D) The average invaded or migrated HCC827 cells in different experimental groups. **P<0.01.

miR-186 directly targets MAP3K2 3′UTR

To evaluate the molecular mechanism by which miR-186 inhibits the proliferation and metastasis of A549 and HCC827 cells, we first detected the protein expression level of MAP3K2 in human lung cancer tissues and compared non-cancerous tissues using western blot analysis. We found that MAP3K2 was increased in tumor tissues (Fig. 4A). Furthermore, overexpression of miR-186 suppressed the protein expression of MAP3K2 in A549 and HCC827 cells (Fig. 4B). Moreover, we predicted that the MAP3K2 is one of the target genes of miR-186 in human using the predication tool TargetScan and miRanda. miR-186 has one predictive target site in the MAP3K2 3′ UTR (Fig. 4C). In addition, the luciferase activity of MAP3K2 3′UTR-WT was significantly decreased upon overexpressed by miR-186 in A549 cells, whereas, its mutant type was not changed (Fig. 4D). Taken together, our data indicated that MAP3K2 is a direct target gene of miR-186.

Figure 4

miR-186 directly targets MAP3K2. (A) Western blot analysis of the MAP3K2 protein expression in lung cancer tissues and non-cancerous tissues. (B) Western blot analysis of the MAP3K2 protein expression level in A549 and HCC827 cells after miR-186 transfection. (C) Sequence alignment between miR-186 and the 3′UTR of human MAP3K2. (D) The effect of miR-186 on the activity of luciferase reporter containing either MAP3K2-3′UTR-WT or MAP3K2-3′UTR-MUT was tested by luciferase reporter gene assays. **P<0.01.

Silence MAP3K2 expression induces cell apoptosis and suppresses proliferation

To evaluate the role of MAP3K2 in miR-186-induced cell apoptosis and proliferation, MAP3K2-siRNA was transfected into A549 and HCC827 cells to specifically knock down MAP3K2 expression. MAP3K2 expression level was remarkably repressed at mRNA (Fig. 5A) and protein (Fig. 5B) level in A549 and HCC827 cells after MAP3K2-siRNA transfection. Furthermore, increased number of apoptotic cells were observed in A549 (Fig. 5C) and HCC827 (Fig. 5D) cells following repressed MAP3K2 expression. The apoptosis rates of A549 cells transfected with MAP3K2-siRNA and NC-siRNA were 20.0±1.4 and 9.4±1.2%, respectively (Fig. 5E). In addition, the apoptosis rates of HCC827 cells transfected with MAP3K2-siRNA and NC-siRNA were 24.1±1.9 and 10.5±1.3%, respectively (Fig. 5E). Finally, we found that the knock-down of MAP3K2 exhibited significantly lower proliferation rates of A549 (Fig. 5F) and HCC827 (Fig. 5G) cells.

Figure 5

The knock-down of MAP3K2 inhibits growth and promotes apoptosis of lung cancer cells in vitro. (A) MAP3K2 mRNA expression level was tested by qRT-PCR in A549 and HCC827 cells transfected with MAP3K2-siRNA. (B) MAP3K2 protein expression level was tested by western blot analysis in A549 and HCC827 cells transfected with MAP3K2-siRNA. (C) Flow cytometric analysis of A549 cell apoptosis after MAP3K2-siRNA transfection. (D) Flow cytometric analysis of HCC827 cell apoptosis after MAP3K2-siRNA transfection. (E) The apoptosis rates of A549 and HCC827 cells after MAP3K2-siRNA transfection. (F) A549 cell proliferation was determined by CCK-8 assay at 24, 48 and 72 h after MAP3K2-siRNA transfection. (G) HCC827 cell proliferation was determined by CCK-8 assay at 24, 48 and 72 h after MAP3K2-siRNA transfection. **P<0.01.

Silencing MAP3K2 expression inhibits cell migration and invasion

Transfection of MAP3K2-siRNA markedly reduced the number of A549 (Fig. 6A and B) and HCC827 (Fig. 6C and D) cells that passed through the Transwell chamber.

Figure 6

The knock-down of MAP3K2 inhibits migration and invasion of lung cancer cells in vitro. (A) The effect of MAP3K2 on A549 cell migration and invasion was determined by Transwell assay. (B) The average invaded or migrated A549 cells in different experimental groups. (C) The effect of MAP3K2 on HCC827 cell migration and invasion was determined by Transwell assay. (D) The average invaded or migrated HCC827 cells in different experimental groups. **P<0.01.

MAP3K2 ameliorated the inhibitory effect of miR-186 on cell proliferation and metastasis

For further study, MAP3K2 was overexpressed after transfection of pcDNA3.1-MAP3K2 vectors in miR-186 A549 and HCC827 cells (Fig. 7A). In addition, overexpression of MAP3K2 in A549 (Fig. 7B) and HCC827 (Fig. 7C) overexpressing miR-186 cells significantly decreased the inhibitory effect of miR-186 on lung cancer cell proliferation (Fig. 7B and C). Moreover, overexpression of MAP3K2 in A549 and HCC827 overexpressing miR-186 cells significantly reduced miR-186 induced cell apoptosis (Fig. 7D and E). Moreover, overexpression of MAP3K2 in A549 (Fig. 7F and G) and HCC827 (Fig. H and I) overexpressing miR-186 cells significantly decreased the inhibitory effect of miR-186 on lung cancer cell migration and invasion (Fig. 7F–I).

Figure 7

MAP3K2 ameliorated the inhibitory effect of miR-186 on cell proliferation and metastasis. (A) MAP3K2 expression levels in A549 and HCC827 cells were detected using western blot analysis. (B and C) A549 and HCC827 cell proliferation was determined by CCK-8 assay at 24, 48 and 72 h. (D and E) A549 and HCC827 cell apoptosis rates were determined through flow cytometry. (F and G) A549 cell migration and invasion abilities in different experimental groups. (H and I) HCC827 cell migration and invasion abilities in different experimental groups.

Discussion

In recent years, increased number of studies found that miRNAs played critical roles in fundamental cellular processes (26,27), and an increasingly recognized that miRNAs are abnormally expressed and involved in a variety of human cancers (16,18,24,28). The expression of miR-186 has been found disordered in different human cancers. Zhang et al (19) found that miR-186 was significantly upregulated in pancreatic cancer and might play a critical role in diagnosis and prognosis of pancreatic cancer. Whereas, miR-186 was discovered decreased in lung adenocarcinoma and correlated with patient survival (22,23). Furthermore, tumor-suppressive effects of miR-186 in medulloblastomas (29), endometrial (20) and prostate cancer (21) were also observed. However, little is known of the potential role of miR-186 on growth and metastasis of human non-small cell lung cancer.

In the present study, we first analyzed the expression of miR-186 in 20 lung cancer tissues and four cancer cell lines. Results showed that miR-186 was significantly decreased in cancer tissues and cell lines. The results were similar with previous research (22,23). To understand the biological role of miR-186 in lung cancer, the impacts of miR-186 on cell proliferation, metastasis and apoptosis were analyzed using CCK-8 assay, Transwell assay and flow cytometry apoptosis assay, respectively. Here, we found that overexpression of miR-186 induced A549 and HCC827 cell apoptosis and suppressed cell proliferation. Also, upregulation of miR-186 inhibited A549 and HCC827 cell migration and invasion. These findings suggested miR-186 played important roles in occurrence and metastasis of human non-small cell lung cancer and might be a useful diagnostic and predictive biomarker.

Subsequently, to understand the mechanism of miR-186 in regulating cell growth and metastasis, we demonstrated that mitogen-activated protein kinase kinase kinase 2 (MAP3K2) is a direct target of miR-186 in human lung cancer. MAP3K2, a member of serine/threonine protein kinase family in MAPK signaling pathway, is able to activate c-Jun N-terminal kinase (JNK) and ERK5 and preferentially activates other kinases involved in the MAP kinase signaling pathway (30,31). MAP3K2 was found to have important roles in epidermal growth factor (EGF), T-cell receptor and fibroblast growth factor 2 (FGF-2) signaling pathways in MAP3K2 knockout mice (30,32,33). A previous study found that MAP3K2 is able to discriminate tumor from normal cells (34) and MAP3K2 contributed to growth of human hepatocellular carcinoma (35), and miR-520b suppressed hepatoma cell proliferation by targeting MEKK2 (MAP3K2) (35), suggesting that MAP3K2 may play important roles in the development of human cancer. In the present study, we found that MAP3K2 protein was significantly increased in human lung cancer tissues and cell lines. Furthermore, luciferase assays and western blot analysis confirmed that miR-186 directly targets MAP3K2 in lung cancer. In addition, knockdown of MAP3K2 by RNA interference assay markedly reduced the expression of MAP3K2 and suppressed lung cancer cell proliferation, migration and invasion and induced cell apoptosis. All the results indicate that decreased expression of miR-186 promotes cell proliferation and suppresses cell apoptosis capacity of human lung cancer through the MAP3K2-mediated signal pathway.

In conclusion, we demonstrated that miR-186 is decreased in human lung cancer tissues and cell lines, which targets MAP3K2 directly. miR-186 mimics transfection and knockdown of MAP3K2 inhibited cell proliferative and metastasis of A549 and HCC827 cells and promoted cell apoptosis. Based on the above, the present study may represent a novel indicator of poor prognosis in human lung cancer, and miR-186-MAP3K2 may represent a potential therapeutic target for diagnosis and therapy of human lung cancer.

References

1 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2013. CA Cancer J Clin. 63:11–30. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Smith RA, Manassaram-Baptiste D, Brooks D, Doroshenk M, Fedewa S, Saslow D, Brawley OW and Wender R: Cancer screening in the United States, 2015: A review of current American cancer society guidelines and current issues in cancer screening. CA Cancer J Clin. 65:30–54. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Novaes FT, Cataneo DC, Ruiz RL Jr, Defaveri J, Michelin OC and Cataneo AJ: Lung cancer: histology, staging, treatment and survival. J Bras Pneumol. 34:595–600. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Youlden DR, Cramb SM and Baade PD: The International Epidemiology of lung cancer: Geographical distribution and secular trends. J Thorac Oncol. 3:819–831. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Johnson JL, Pillai S and Chellappan SP: Genetic and biochemical alterations in non-small cell lung cancer. Biochem Res Int. 2012:9404052012. View Article : Google Scholar : PubMed/NCBI

6 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Ginsberg RJ and Rubinstein LV: Randomized trial of lobectomy versus limited resection for T1 N0 non-small cell lung cancer. Lung Cancer Study Group. Ann Thorac Surg. 60:615–622; discussion 622–613. 1995. View Article : Google Scholar : PubMed/NCBI

8 

Timmerman R, Paulus R, Galvin J, Michalski J, Straube W, Bradley J, Fakiris A, Bezjak A, Videtic G, Johnstone D, et al: Stereotactic body radiation therapy for inoperable early stage lung cancer. JAMA. 303:1070–1076. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Chi A, Liao Z, Nguyen NP, Xu J, Stea B and Komaki R: Systemic review of the patterns of failure following stereotactic body radiation therapy in early-stage non-small-cell lung cancer: clinical implications. Radiother Oncol. 94:1–11. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Martini N, Bains MS, Burt ME, Zakowski MF, McCormack P, Rusch VW and Ginsberg RJ: Incidence of local recurrence and second primary tumors in resected stage I lung cancer. J Thorac Cardiovasc Surg. 109:120–129. 1995. View Article : Google Scholar : PubMed/NCBI

11 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Bartel DP and Chen CZ: Micromanagers of gene expression: The potentially widespread influence of metazoan microRNAs. Nat Rev Genet. 5:396–400. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Chen CZ, Li L, Lodish HF and Bartel DP: MicroRNAs modulate hematopoietic lineage differentiation. Science. 303:83–86. 2004. View Article : Google Scholar

14 

Kim VN: MicroRNA biogenesis: Coordinated cropping and dicing. Nat Rev Mol Cell Biol. 6:376–385. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Zhang S, Lu Z, Unruh AK, Ivan C, Baggerly KA, Calin GA, Li Z, Bast RC Jr and Le XF: Clinically relevant microRNAs in ovarian cancer. Mol Cancer Res. 13:393–401. 2015. View Article : Google Scholar :

16 

Zhao N, Sun H, Sun B, Zhu D, Zhao X, Wang Y, Gu Q, Dong X, Liu F, Zhang Y, et al: miR-27a-3p suppresses tumor metastasis and VM by down-regulating VE-cadherin expression and inhibiting EMT: An essential role for Twist-1 in HCC. Sci Rep. 6:230912016. View Article : Google Scholar : PubMed/NCBI

17 

Gomes BC, Santos B, Rueff J and Rodrigues AS: Methods for studying MicroRNA expression and their targets in formalin-fixed, paraffin-embedded (FFPE) breast cancer tissues. Methods Mol Biol. 1395:189–205. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Kim G, An HJ, Lee MJ, Song JY, Jeong JY, Lee JH and Jeong HC: Hsa-miR-1246 and hsa-miR-1290 are associated with stemness and invasiveness of non-small cell lung cancer. Lung Cancer. 91:15–22. 2016. View Article : Google Scholar

19 

Zhang Y, Li M, Wang H, Fisher WE, Lin PH, Yao Q and Chen C: Profiling of 95 microRNAs in pancreatic cancer cell lines and surgical specimens by real-time PCR analysis. World J Surg. 33:698–709. 2009. View Article : Google Scholar

20 

Myatt SS, Wang J, Monteiro LJ, Christian M, Ho KK, Fusi L, Dina RE, Brosens JJ, Ghaem-Maghami S and Lam EW: Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer. Cancer Res. 70:367–377. 2010. View Article : Google Scholar

21 

Erdmann K, Kaulke K, Thomae C, Huebner D, Sergon M, Froehner M, Wirth MP and Fuessel S: Elevated expression of prostate cancer-associated genes is linked to down-regulation of microRNAs. BMC Cancer. 14:82. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Cai J, Wu J, Zhang H, Fang L, Huang Y, Yang Y, Zhu X, Li R and Li M: miR-186 downregulation correlates with poor survival in lung adenocarcinoma, where it interferes with cell-cycle regulation. Cancer Res. 73:756–766. 2013. View Article : Google Scholar

23 

Cui G, Cui M, Li Y, Liang Y, Li W, Guo H and Zhao S: MiR-186 targets ROCK1 to suppress the growth and metastasis of NSCLC cells. Tumour Biol. 35:8933–8937. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Ruan WD, Wang P, Feng S, Xue Y and Zhang B: MicroRNA-497 inhibits cell proliferation, migration, and invasion by targeting AMOT in human osteosarcoma cells. Onco Targets Ther. 9:303–313. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Wang J, Liu G, Li Q, Wang F, Xie F, Zhai R, Guo Y, Chen T, Zhang N, Ni W, et al: Mucin1 promotes the migration and invasion of hepatocellular carcinoma cells via JNK-mediated phosphorylation of Smad2 at the C-terminal and linker regions. Oncotarget. 6:19264–19278. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Tian L, Fang YX, Xue JL and Chen JZ: Four microRNAs promote prostate cell proliferation with regulation of PTEN and its downstream signals in vitro. PLoS One. 8:e758852013. View Article : Google Scholar : PubMed/NCBI

27 

Brennecke J, Hipfner DR, Stark A, Russell RB and Cohen SM: bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell. 113:25–36. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Hauser B, Zhao Y, Pang X, Ling Z, Myers E, Wang P, Califano J and Gu X: Functions of MiRNA-128 on the regulation of head and neck squamous cell carcinoma growth and apoptosis. PLoS One. 10:e01163212015. View Article : Google Scholar : PubMed/NCBI

29 

Lv SQ, Kim YH, Giulio F, Shalaby T, Nobusawa S, Yang H, Zhou Z, Grotzer M and Ohgaki H: Genetic alterations in microRNAs in medulloblastomas. Brain Pathol. 22:230–239. 2012. View Article : Google Scholar

30 

Su B, Cheng J, Yang J and Guo Z: MEKK2 is required for T-cell receptor signals in JNK activation and interleukin-2 gene expression. J Biol Chem. 276:14784–14790. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Chayama K, Papst PJ, Garrington TP, Pratt JC, Ishizuka T, Webb S, Ganiatsas S, Zon LI, Sun W, Johnson GL, et al: Role of MEKK2-MEK5 in the regulation of TNF-alpha gene expression and MEKK2-MKK7 in the activation of c-Jun N-terminal kinase in mast cells. Proc Natl Acad Sci USA. 98:4599–4604. 2001. View Article : Google Scholar : PubMed/NCBI

32 

Schaefer BC, Ware MF, Marrack P, Fanger GR, Kappler JW, Johnson GL and Monks CR: Live cell fluorescence imaging of T cell MEKK2: Redistribution and activation in response to antigen stimulation of the T cell receptor. Immunity. 11:411–421. 1999. View Article : Google Scholar : PubMed/NCBI

33 

Sun W, Wei X, Kesavan K, Garrington TP, Fan R, Mei J, Anderson SM, Gelfand EW and Johnson GL: MEK kinase 2 and the adaptor protein Lad regulate extracellular signal-regulated kinase 5 activation by epidermal growth factor via Src. Mol Cell Biol. 23:2298–2308. 2003. View Article : Google Scholar : PubMed/NCBI

34 

Cazares LH1, Troyer D, Mendrinos S, Lance RA, Nyalwidhe JO, Beydoun HA, Clements MA, Drake RR and Semmes OJ: Imaging mass spectrometry of a specific fragment of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase kinase 2 discriminates cancer from uninvolved prostate tissue. Clin Cancer Res. 15:5541–5551. 2009. View Article : Google Scholar : PubMed/NCBI

35 

Zhang W, Kong G, Zhang J, Wang T, Ye L and Zhang X: MicroRNA-520b inhibits growth of hepatoma cells by targeting MEKK2 and cyclin D1. PLoS One. 7:e314502012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Huang T, She K, Peng G, Wang W, Huang J, Li J, Wang Z and He J: MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer. Int J Oncol 49: 1437-1444, 2016.
APA
Huang, T., She, K., Peng, G., Wang, W., Huang, J., Li, J. ... He, J. (2016). MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer. International Journal of Oncology, 49, 1437-1444. https://doi.org/10.3892/ijo.2016.3637
MLA
Huang, T., She, K., Peng, G., Wang, W., Huang, J., Li, J., Wang, Z., He, J."MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer". International Journal of Oncology 49.4 (2016): 1437-1444.
Chicago
Huang, T., She, K., Peng, G., Wang, W., Huang, J., Li, J., Wang, Z., He, J."MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer". International Journal of Oncology 49, no. 4 (2016): 1437-1444. https://doi.org/10.3892/ijo.2016.3637
Copy and paste a formatted citation
x
Spandidos Publications style
Huang T, She K, Peng G, Wang W, Huang J, Li J, Wang Z and He J: MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer. Int J Oncol 49: 1437-1444, 2016.
APA
Huang, T., She, K., Peng, G., Wang, W., Huang, J., Li, J. ... He, J. (2016). MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer. International Journal of Oncology, 49, 1437-1444. https://doi.org/10.3892/ijo.2016.3637
MLA
Huang, T., She, K., Peng, G., Wang, W., Huang, J., Li, J., Wang, Z., He, J."MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer". International Journal of Oncology 49.4 (2016): 1437-1444.
Chicago
Huang, T., She, K., Peng, G., Wang, W., Huang, J., Li, J., Wang, Z., He, J."MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer". International Journal of Oncology 49, no. 4 (2016): 1437-1444. https://doi.org/10.3892/ijo.2016.3637
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team