Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
November-2017 Volume 51 Issue 5

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 51 Issue 5

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells

  • Authors:
    • Wan Huai Teo
    • Hsin-Pai Chen
    • Jason C. Huang
    • Yu-Jiun Chan
  • View Affiliations / Copyright

    Affiliations: Department of Biotechnology and Laboratory Science in Medicine, School of Biomedical Science and Engineering, National Yang-Ming University, Taipei, Taiwan, R.O.C., Division of Infectious Diseases, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, R.O.C.
    Copyright: © Teo et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1415-1426
    |
    Published online on: September 25, 2017
       https://doi.org/10.3892/ijo.2017.4135
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Increasing evidence suggests a link between persistent human cytomegalovirus (HCMV) infection and cancer. Although the role of HCMV in cancer is still elusive, recent studies revealed the presence of HCMV nucleic acids and proteins in different cancer types such as glioblastoma, colorectal, breast, and prostate cancers, and neuroblastoma. Although HCMV may not be directly associated with the neoplastic transformation, the presence of HCMV DNA in the tumorous tissue has been associated with altered clinical outcomes in cancer patients. However, the mechanisms involved in the association between colorectal cancer (CRC) and HCMV are unclear. In this study, we investigated the influence of HCMV infection on CRC or their derived cells. Proliferation and migration assays revealed a high infection efficiency in CRC-derived HT29 and SW480 ‘stem‑like’ cells. After 24, 48 and 72 h of HCMV infection, both HT29 and SW480 parental and stem‑like cells showed a significant increase in cell proliferation and viability (p<0.0001). Moreover, HCMV infection promoted cell migration. These results demonstrate a significant phenotypic alteration in the CRC cell line upon HCMV infection. Using epithelial to mesenchymal transition (EMT) assays, we demonstrated that the EMT markers and driver genes were upregulated during the virus infection. The WNT signaling pathway, which is associated with the proliferation and migration of CRC cells, was upregulated (6-fold) in HCMV-infected cells as compared to the non‑infected cells at day 7 from infection.

Introduction

According to the World Health Organization, colorectal cancer (CRC) is the third leading cause of cancer-related death in the world after lung and liver cancers. Of the 8.8 million deaths reported in 2015, 774,000 cases were attributed to CRC (1). There are at least four types of human colorectal carcinogenesis, namely adenoma-carcinoma, hereditary non-polyposis colorectal cancer (HNPCC), de novo cancer, and colitis cancer (2). Many cases of CRC are related to environmental or dietary factors rather than heritable genetic changes. These factors include the environmental and food-borne mutagens, specific intestinal commensals, pathogens, and chronic intestinal inflammation, which subsequently induce tumor development. The progression from adenoma to cancer and metastatic stage involves the reciprocal failure of protective mechanisms such as adenomatous polyposis coli (APC), p53, and transforming growth factor β (TGF-β) as well as the induction of oncogenic pathways such as K-RAS and β-catenin (3–6).

For the past decade, the development of CRC is seldom being linked to infectious diseases. However, recent studies showed that the proteins immediate early 1 (IE1) and pp65 of human cytomegalovirus (HCMV) were detected in colorectal polyps and adenocarcinomas but not the adjacent non-neoplastic colon biopsy samples (7). The presence of HCMV proteins, mRNA of early genes, and DNA was demonstrated through immunochemical staining, in situ hybridization, and polymerase chain reaction (PCR), respectively (7,8). In addition, our previous study reported the presence of HCMV nucleic acids in the tumorous epithelium of CRC. Furthermore, the existence of HCMV in CRC was correlated with the poor outcome in elderly group but better outcome in the younger group (8,9). Dimberg et al showed that the HCMV-DNA-positive rate was significantly higher in cancerous tissue as compared with the paired normal tissue (10). Growing evidence demonstrates that HCMV infection occurs in tumor tissues and its gene products may promote important oncogenic pathways in CRC (11).

Human cytomegalovirus belongs to the subfamily of β-herpesviruses. Upon infection, it gets adapted and remains lifelong in the host. The viral replication cycle is reactivated whenever the host immunity is impaired, resulting in disease relapse (12). HCMV comprises a genome of ~235 kb with >200 open reading frames (ORFs) that encode >180 proteins. Among these proteins, some are essential for its replication and a vast majority may interfere with the cellular and immunological functions to enable the virus to coexist with its host (13). Several studies provide evidence that HCMV proteins and nucleic acids are frequently detected in tissue specimens from patients with cancers of different origin, including cancer of colon (7,8–11), breast (14), prostate (15), and mucoepidermoid salivary gland (16) as well as glioblastoma (17–19) and neuroblastoma (20). In addition, HCMV proteins are believed to function as 'oncomodulators' in cancer. There have been a number of studies suggesting HCMV proteins such as IE, US28, pp65, non-coding RNA β 2.7kb (β 2.7 kb) and other transcripts enable the virus to provide mechanisms for oncomodulation, thus enable the virus to evade from host immune and aid in the oncogenic transformation (21–23). Some of the HCMV gene products and proteins are known to accelerate cancer progression via certain pathways. Some of these pathways are involved in the suppression of the local immune response against tumors, while others are involved in the promotion of cell proliferation, apoptosis, angiogenesis and metastasis.

Increasing evidence revealed HCMV infection in glioblastoma multiforme (GBM) and glioma stem cell (GSC), which are believed to cause the recurrence of GBM after the surgery or therapy (24–27). However, the impact of HCMV infection in CRC and developing tumors is questionable, especially in colon cancer stem cell (CSC). To date, there is no well establish cell model to study the interaction of HCMV and CRC. In this direction, we studied the influence and effect of HCMV in CRC-derived cell lines.

Materials and methods

Virus infection

The laboratory-adapted strain of HCMV AD169 obtained from American Type Culture Collection (ATCC, USA) was propagated in confluent monolayers of MRC-5 cells (ATCC) in minimal essential medium (MEM) (Gibco, Life Technologies, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Hyclone, USA). Supernatants were harvested from MRC-5 cells displaying 90–100% cytopathic effects (CPE) and the aliquots were store at −80°C. Infectious titers of all virus stocks were determined by performing the plaque assay on MRC-5 cells. Virus propagation was carried out by low multiplicity of infection (MOI).

Cell culture

HT29 and SW480 cells were provided by Professor Hsei-Wei Wang of National Yang-Ming University, Taiwan. HT29 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco, Life Technologies) and SW480 cells were cultured in Leibovitz's L-15 medium (Gibco, Life Technologies) supplemented with 10% FBS and 1% penicillin/streptomycin (Gibco, Life Technologies). MRC-5 cells (ATCC) were cultured in MEM supplemented with 10% FBS. All cells were cultured at 37°C with 5% CO2.

Sphere formation assays

For stem-like culture, HT29 and SW480 parental cells were resuspended in serum-free DMEM/F12 medium supplemented with 1X N-2 supplement (Gibco, Life Technologies), 10 ng/ml recombinant human epidermal growth factor (EGF) (Sigma-Aldrich, USA), 10 ng/ml basic fibroblast growth factor (bFGF) (Sigma-Aldrich), and 1% penicillin/streptomycin. Cells were plated at a density of 102, 103 or 104 cells/well, as per the experimental requirement, and monitored for 2–3 weeks until spheroids were formed.

Flow cytometry analysis

Flow cytometry assay was used to analyze the expression profile of the cancer stem cell marker CD44. Briefly, ~106 cells were washed with phosphate-buffered saline (PBS; Amresco, USA) and labeled with FITC-conjugated anti-CD44 (Miltenyi Biotec, Auburn, CA, USA) in the dark for 30 min at room temperature. Following incubation, cells were washed twice with PBS and analyzed using a Cytomics FC 500 Series flow cytometry system (Beckman Coulter, Indianapolis, IN, USA).

Immunofluorescence assays and determination of the infectivity rate of HCMV in CRC derived cells

To determine the HCMV infection in cells, immunofluorescence assays were carried out by labeling the non-infected and infected cells with cytomegalovirus immediate early (IE) antibody (GeneTex, USA) and anti-cytomegalovirus pp65 antibody (Abcam, USA). To determine viral infectivity, 103 parental and stem-like HT29 cells were infected with HCMV AD169 at MOI of 5 on coverslips. After 24, 48 and 72 h of infection, infected and non-infected cells were fixed with ice-cold methanol for 10 min at room temperature and washed thrice with PBS. Cells were blocked with 1% bovine serum albumin (Sigma-Aldrich) for 1 h at room temperature, followed by three washes of PBS. Both infected and non-infected cells were stained with 1:20 cytomegalovirus IE antibody for 1 h in a humidified chamber at 37°C. Following incubation, cells were washed thrice with PBS and probed with an anti-mouse IgG FITC (GeneTex) secondary antibody (1:2,000 dilution) for 1 h in a humidified chamber at 37°C. Cells were washed as described above and stained with 4′,6-diamidino-2-phenylindole (DAPI). The washing step was repeated and a coverslip was placed on the slide with a mounting agent. The slide was visualized using a fluorescence microscope fitted with a camera for cell counting. Five low-magnification fields were counted for each condition and the percentage of positive cells was calculated by dividing the number of IE-positive cells with the total number of nuclei, followed by multiplication with 100.

Cell viability and cell proliferation

Cell proliferation was evaluated in triplicates by a colorimetric WST-1 assay. The assay determines cellular viability by measuring the metabolic conversion of a water-soluble tetrazolium salt into a dark red formazan by mitochondrial dehydrogenases. The amount of formazan produced is proportional to the number of live cells, which is expressed as cellular viability. Briefly, 102 non-infected and infected cells were seeded in 96-well plates and incubated for 6, 12, 24, 48 and 72 h. The assay was performed by adding WST-1 (Roche, Germany) directly to culture wells, followed by incubation for 1 h at 37°C. Plates were read using DS2® (Dynex, USA) by measuring the absorbance of the dye at 450 nm wavelength, with 620 nm set as a reference wavelength. Each experimental condition was performed in triplicates.

To determine the growth effect of HCMV on infected cells, the cell proliferation was evaluated by direct cell counting. HCMV infected and non-infected cells were seeded at a density of 104 cells/cm2 in 24-well plates and cultured for 3, 6, 12, 24, 48 and 72 h. Following incubation, cells were washed with PBS and harvested by trypsinization. The cell number was determined following staining with 0.4% trypan blue by Countess Automated Cell Counter (Invitrogen/Life Technologies). The experiment was repeated thrice and each reaction condition was performed in triplicates.

Migration assays

For Transwell migration assays, dissociated stem-like or adherent parental HT29 and SW480 cells infected or non-infected with AD169 were plated at 103 cells/cm2 on the top chambers containing non-coated membrane with 8 µm pore size (Corning, NY, USA). Cells in the top chamber were grown in 100 µl serum-free medium, while the lower chamber was filled with 600 µl of 10% FBS-supplemented DMEM/F12. After 6, 12, 24, 48 and 72 h of infection, cells on the upper side were removed and those under the surface were fixed and stained with crystal violet. The cell number was counted using a microscope at five magnification fields. All assays were performed in triplicates.

Reverse transcription (RT)-PCR and real-time PCR (quantitative PCR)

RNA was extracted using TRIzol (Sigma-Aldrich) and 2 µg of RNA from each sample was used for the synthesis of the complementary DNA (cDNA). Reverse transcription was carried out in a reaction containing 2 µl of 10X RT buffer, 2 µl of 10X RT random primers, 0.8 µl of 100 mM dNTP mix, 1 µl of MultiScribe™ reverse transcriptase, 1 µl of RNase inhibitor (ABI, USA), and diethyl pyrocarbonate (DEPC)-treated water (total volume of 10 µl). Following reaction, 2 µg of total RNA in a total volume of 10 µl was added to the master mix. The reverse transcription condition was as follows: 25°C for 10 min and 37°C for 120 min, heat inactivation at 85°C for 5 min, and cooling on ice. The cDNA synthesized was stored at −20°C until its use for PCR. Real-time PCR reaction was performed by mixing 12.5 µl 2X SYBR master mix (ABI), 2 µl cDNA, 0.25 µl primer pair mix (0.1 µM/µl each primer), and 23 µl water with the PCR reaction. The PCR cycle was as follows: 1 cycle at 50°C for 2 min, 1 cycle at 95°C for 10 min, 40 cycles of 95°C for 15 sec, 60°C for 30 sec, 72°C for 30 sec, and a final extension at 72°C for 10 min. Real-time PCR was performed in CFX Connect™ Real-Time Detection System (Bio-Rad, USA) and the results were analyzed with the CFX Manager™ Software (Bio-Rad). Gene expression level was normalized with that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and the fold change was calculated as 2−ΔΔCt, which is the normalized gene expression 2−ΔCt in the infected sample divided by the normalized gene expression 2−ΔCt in the non-infected sample.

For RT-PCR, the PCR mixture was prepared in a total volume of 25 µl and included 2X Taq PLUS PCR Smart mix 1 (SolGent™, Korea) and the forward and reverse primers at a concentration of 0.3 µM each. The volume was adjusted with DEPC-treated water. PCR was performed with an initial denaturation at 94°C for 2 min, followed by 35 cycles of 94°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec, and a final elongation step for 4 min at 72°C. The primers used in this study are summarized in Table I.

Table I

The primers used for RT-PCR and real-time PCR.

Table I

The primers used for RT-PCR and real-time PCR.

GeneForward (5′–3′)Reverse (5′–3′)
RT-PCR
 IE1 CGACGTTCCTGCAGACTATG TCCTCGGTCACTTGTTCAAA
 US28 GTGAACCGCTCATATAGACC GAAACAGGCAGTGAGTAACG
 β 2.7 kb AAGATGTTGCGATGCGGTTG CGGTCAGCAGCCAAACAATC
 GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA
qPCR
 IE1 AAGCGGCCTCTGATAACCAAG GAGCAGACTCTCAGAGGATCG
 US28 GTACCACAGCATGAGCTTTTC GTATAATTTGTGAGACGCGACA
 β 2.7 kb AAGATGTTGCGATGCGGTTG CGGTCAGCAGCCAAACAATC
 Wnt 11 GACACAAGACAGGCAGTG GTCCTTGAGCAGAGTCCT
 FZD7 AAGACTTGCAGGACGATGCT TGTATCTCCCACTCGCCTTC
 CTNNB GTGCTATCTGTCTGCTCT CATCCCTTCCTGTTTAGTTG
 GSK3β AAGTTAGCAGAGACAAGGA CGCAATCGGACTATGTTAC
 GAPDH CTGCCCCCTCTGCTGATG TCCACGATACCAAAGTTGTCATG
Analysis of epithelial to mesenchymal transition (EMT) pathways

HCMV AD169 was used to infect 106 HT29 stem-like cells at MOI of 5. Cells were harvested and total RNA extracted with TRIzol. The extracted total RNA was sent to Genomics, Taiwan, for human epithelial to mesenchymal transition (EMT) RT™ Profiler™ PCR Array (SABiosciences/Qiagen, Germany) analysis. Briefly, the total RNA was reverse-transcribed and the resulting cDNA analyzed with a 96-well plate quantitative PCR array. The array includes 84 key genes of EMT signal pathways. Gene expression levels were quantified and analyzed with the vendor's web-based software module. Data were collected and normalized based on the mean Ct value from five housekeeping genes in the arrays (ACTB, B2M, GAPDH, HPRT1 and RPLP0) and further normalized to the untreated control sample. For fold-change comparisons in cells, non-infected cells were used as the control sample. The fold-change of gene expression was calculated as 2−ΔΔCt, which is the normalized gene expression 2−ΔCt in the infected sample divided by the normalized gene expression 2−ΔCt in the non-infected sample.

Statistical analyses

Data shown represent results of two independent experiments, with each reaction performed in triplicates. Statistical analyses were carried out by the two-way analysis of variance (ANOVA) and Tukey's multiple comparisons test using GraphPad Prism software to compare between groups. We used the Student's t-test to evaluate two independent experimental groups. A value of p<0.05 was considered as statistically significant.

Results

Increased HCMV infectivity in CRC derived stem-like cells

We assessed HCMV infection in CRC using parental and stem-like HT29 cells as models (Fig. 1A). The enriched HT29 stem-like cells were analyzed using the CD44 marker. Flow cytometry data showed that CD44+ cell population was significantly higher (97.31%) in the HT29 stem-like cells as compared with the parental HT29 cells (5.42%) (Fig. 1B). Both cell types were infected with the laboratory strain AD169 and the infection was confirmed by immunofluorescence staining with CMV IE and pp65 (Fig. 2A and B). Infection efficiency was defined as the number of IE-positive cells divided by the total number of nucleated cells. We observed a significantly large number of HT29 stem-like cells infected with AD169 as compared with the HT29 parental cells. To facilitate the HT29 stem-like cells count, the infected spheroid cells were dispersed by trypsinization (Fig. 2C). After 24-h infection, IE-positive cells were ~3% in HT29 parental cells as compared to 29% in HT29 stem-like cells. After 72-h infection, ~70% of HT29 stem-like cells were IE-positive as compared to only 20% IE-positive HT29 bulk cells (Fig. 2D).

Figure 1

Generation of sphere from HT29 parental. (A) HT29 parental and stem-like cells. (B) Determination of the stemness marker CD44-FITC.

Figure 2

The infection of HCMV laboratory strain AD169 in colorectal cancer-derived cells. (A) HCMV AD169 was used to infect 103 parental and stem-like HT29 and MRC-5 (control) cells at MOI of 5 on coverslips, followed by IE and (B) pp65 immunofluorescence. (C) IE-positive cells were observed after counter staining using a fluorescence microscope fitted with a camera. Five low magnification fields were counted for each condition. (D) The percentage of positive cells was calculated by dividing the number of IE-positive cells with the total number of nuclei, followed by multiplication with 100. ****p<0.0001 by two-way ANOVA and Tukey's multiple comparisons test.

HCMV gene expression

To evaluate the mechanism of HCMV infection in HT29 stem-like cells, we infected these cells with AD169 at MOI of 5 and determined the expression pattern of HCMV genes at different time post-infection using RT-PCR and qPCR. RT-PCR data showed different HCMV gene expression (Fig. 3A). Following AD169 infection, the HCMV IE1 transcript was detected at 24 h, but it decreased at 72 h and day 7. A small increase in the expression of US28 late gene and β 2.7 kb was reported at 24 h, 72 h, and day 7 after infection.

Figure 3

HCMV gene expression. (A) RT-PCR detection of IE1, US28, and β 2.7 kb transcripts in HACMV AD169-infected HT29 stem-like cells. M, 100 bp DNA ladder; P, positive control; and N, negative control. (B) Semi-quantitative SYBR Green-based RT-qPCR of IE1, US28, and β 2.7 kb at different time-points following HCMV AD169 infection of HT29 stem-like cells. ****p<0.0001 by two-way ANOVA and Tukey's multiple comparisons test. (C) Determination of HCMV AD169 long-term infection in HT29 stem-like cells (4 weeks).

We used SYBR Green real-time PCR for accurate quantification of the mRNA expression of HCMV genes. Following infection, IE1 expression surged at day 1 but decreased at day 3 and 7 (Fig. 3B), while the IE1 mRNA level decreased at all time-points. On the other hand, no significant differences in US28 and β 2.7 kb mRNA expression levels were observed after day 1, 3 or 7 of HCMV infection. In HT29 stem-like cells with 4 weeks prolonged AD169 infection, we found that the IE proteins were still expressed (Fig. 3C).

Cell proliferation and viability

We used the colorimetric WST-1 assay to evaluate the viability of HT29 and SW480 cells after AD169 infection. HT29 and SW480 parental and stem-like cells infected with AD169 at different time-points along with the non-infected control were prepared in triplicates. We observed increased cell viability in HT29 and SW480 stem-like cells infected with AD169 (Fig. 4A and B). In comparison to the non-infected cells, HT29 stem-like cells infected with AD169 showed a significant increase in cell proliferation after 12 (0.96±0.05, p=0.011), 48 (3.10±0.04, p<0.001), and 72 h (3.31±0.03, p<0.0001) of infection. Besides, we also observed a significant increase in SW480 stem-like cells infected with AD169 after 24 (1.49±0.02, p<0.0001), 48 (2.79±0.06, p<0.0001), and 72 h (3.10±0.04, p<0.0001) compared to the non-infected cells. No significant growth difference was observed between the HT29 and SW480 parental cells infected with AD169 and non-infected cells.

Figure 4

Cell viability and proliferation of AD169-infected and non-infected colorectal cancer-derived cells. HCMV AD169 was used to infect 102 parental and stem-like (A) HT29 cells and (B) SW480 cells at MOI of 5. Cells were harvested at 6, 12 24, 48 and 72 h following infection. Cells were subjected to WST-1 assays. AD169-infected cells showed significant proliferation compared to the non-infected cells. **p<0.01, **p<0.001 and ***p<0.0001 by Student's t-test. For direct cell proliferation evaluation, 104 parental and stem-like (C) HT29 cells and (D) SW480 cells were infected with AD169 at MOI of 5. Cells were harvested at 3, 6, 12 24, 48 and 72 h following infection and stained with 0.4% trypan blue. Cells were counted using the Countess Automated Cell Counter. *p<0.05, **p<0.01, and ****p<0.0001 by two-way ANOVA and Tukey's multiple comparisons test.

We evaluated the proliferation of AD169-infected cells by direct cell counting. HT29 and SW480 parental and stem-like cells infected with AD169 at different time-points were harvested, stained with trypan blue, and counted using the Countess Automated Cell Counter. The results revealed that AD169 infection promoted cell growth. Both HT29 and SW480 parental and stem-like cells showed a significant increase in growth following infection (p<0.001) (Fig. 4C and D). However, the growth rate was higher for the infected HT29 or SW480 stem-like cells as compared to the infected parental cells at all time-points. In comparison to the infected parental cells, infected stem-like cells showed a 1.3, 2.1, 1.4, and 1.6-fold increase in the growth rate after 12, 24, 48 and 72 h of infection, respectively. The infected HT29 stem-like proliferated at a significantly faster rate compared either with the non-infected HT29 stem-like or HT29 infected and non-infected parental cells. We observed that SW480 infected stem-like cells also proliferated faster than the parental infected cells. The growth rates after 12, 24, 48 and 72 h of infection were 1.5, 1.4, 1.7 and 1.8-fold higher than those of the parental infected cells. These data suggest that HCMV infection may promote cell proliferation.

HCMV infection increased cell migration ability

We used Transwell migration assays to study the migration ability of HT29 and SW480 cells with or without AD169 infection. In comparison to the non-infected cells, the infected HT29 and SW480 parental and stem-like cells showed significantly higher migration ability (p<0.001). However, the number of migrated cells was more in the stem-like cells as compared with the infected parental cells (Fig. 5). In addition, the number of migrated SW480 infected stem-like cells was higher than that of HT29 infected stem-like cells. Thus, HCMV infection increased the migration ability of colorectal-derived cells.

Figure 5

Migration assay of AD169-infected and non-infected cells. Parental and stem-like (A) HT29 cells and (B) SW480 cells were treated with or without HCMV AD169 at MOI of 5. After 72 h of infection, 104 cells were translocated in a 24-Transwell chamber with non-coated membrane and incubated for 6, 12 24, 48 and 72 h. The cells under the membrane were stained with crystal violet and counted under the microscope. ***p<0.001 and ****p<0.0001 by two-way ANOVA and Tukey's multiple comparisons test.

EMT RT2 PCR analyses

To investigate the involvement of EMT in the increased migration ability of these cells, we evaluated the expression of EMT-associated genes in infected and non-infected HT29 stem-like cells using the RT2 Profiler™ PCR array. The heat map (Fig. 6A) showed that most of the EMT-related genes were upregulated after HCMV infection. After 24-h infection, 62 genes were upregulated and 27 genes, downregulated. On the other hand, 35 and 57 EMT-related genes were upregulated and 49 and 27 genes were downregulated after 72 h and 7 days of infection, respectively.

Figure 6

Human EMT RT2 Profiler PCR Array of AD169-infected and non-infected cells. (A) HT29 stem-like cells were treated with or without HCMV AD169 at MOI of 5. After different time-points, cells were harvested and the total RNA was extracted and converted to cDNA. The hierarchical clustering of gene signatures was determined using RT2 Profiler PCR Array of EMT and illustrated as heat maps (cut off value >2). (B) The expression of EMT markers and drivers gene of HT29 stem-like cells infected with AD169. (C) Expression of genes related to the WNT signaling pathway in HT29 stem-like cells infected with AD169. (D) Confirmation of WNT11/FZD7 expression in HT29 stem-like cells infected with AD169 and non-infected cells. *p<0.05, **p<0.01, and ****p<0.0001 by two-way ANOVA and Tukey's multiple comparisons test.

The array data indicated an increase in the expression of mesenchymal markers such as N-cadherin and fibronectin at all time-points. On the other hand, E-cadherin was downregulated across the infection time. In addition, the expression of EMT drivers such as SNAIL1, SNAIL2/SLUG, ZEB1, and TWIST1 was upregulated following infection (Fig. 6B). We observed an increase in the level of WNT11, frizzled-7 (FZD7), glycogen synthase kinase 3β (GSK3β), and β-catenin (CTNNB1) during HCMV infection (Fig. 6C). In the subsequent analysis, we designed a panel of primers against WNT signaling (Table I) and evaluated the expression of WNT11, FZD7, GSK3β, and β-catenin by real-time PCR. As shown in Fig. 6D, we observed that the results were compatible with the results of the array.

In comparison to the non-infected cells, those infected showed a significant increase (6-fold) in the expression of WNT11 at day 7 following infection (p<0.001). The expression of FZD7 in the infected cells was 2.2±0.94-fold higher than that in the control cells. No significant different in GSK3β expression was noted. Although there was an increase in the expression of β-catenin during infection, the difference was not statistically significant.

Discussion

In this study, we demonstrated that the HCMV strain AD169 infected HT29 stem-like cells with higher efficiency than the HT29 parental cells. The infection rate increased in a time-dependent manner. This result was consistent with a previous study, wherein the efficiency of HCMV infection was higher in 387 and 3832 GSCs as compared with the standard glioma cell line U87 and T98G (26). Fornara et al found that glioblastoma cells infected with HCMV exhibited the ability to grasp those GSC from differentiated condition, thereby enhancing the stem cell phenotype. Consequently, there was an increase in the number of GSCs (28). CSCs have been implicated in the colon carcinogenesis, however their existence had not been experimentally demonstrated until recently. Due to the complexity of their biology and technical problems, the definite identification and isolation is still under debate (29,30). The cell adhesion molecule CD44 was one of the proposed CSC markers. CD44-positive cells seem to exhibit CSC properties, such as a single cell could form a sphere and a xenograft tumor that resembled the original lesion (31). Therefore, in this study we used CD44 as the CSC marker to verify the enriched tumor sphere HT29 cells. Du et al (31) showed that the CD44 was expressed at the bottom of the crypt in colon tissues where the stem cells are distributed as reported (32). Previously, we showed that HCMV viral nucleic acids were mostly found localized at the basal layer of crypt (8) and in this study, we demonstrated that the infection rate was higher in the HT29 stem-like cells. This suggests that HCMV may favor cancer stem cell-like cells for infection.

In the present study, we observed that the patterns of HCMV IE and pp65 localization in HT29 stem-like cells were different from the permissive cell MRC-5. In MRC-5 infected cells, IE and pp65 were expressed in the nucleus while in HT29 stem-like cells they were detected in both nucleus and cytoplasm, but mostly in the cytoplasm. In previous study, the β2.7 kb RNA was detected in both intranuclear and cytoplasmic human fibroblasts, but in non-permissive cells, the early transcript is only present within the nucleus (33). In this case, the HT29 stem-like cells might behave as fibroblasts, permissive cells. As showed in this study, HT29 stem-like cells infected with HCMV upregulated TWIST and SNAIL expression and enhanced EMT by downregulating E-cadherin and upregulating the N-cadherin, fibronectin and vimentin (34,35). As anticipated, the resulting cells may acquire fibroblast-like properties. Further study should be carried out to clarify this topographic pattern. We observed a different trend in gene expression at all time-points (Fig. 3A and B). The expression of IE1 gene decreased over time, while expression of US28 and β 2.7 kb transcripts showed fluctuations, which may be attributed to the different stages in the virus life cycle. HCMV has an organized genome expression. Its replication starts with the immediate early gene expression, followed by the expression of early and late genes. IE1, expressed in the initial phase, regulated the expression of other viral genes such as US28 and β 2.7 kb. The fluctuation in gene expression reported at certain time-points may be a signaling change in the virus replication (36–38).

In this study, we used two CRC-derived cell lines, HT29 and SW480 cells to verify the proliferation after AD169 infection. We found that either HT29 or SW480 infected stem-like cells proliferated more than the non-infected cells or the infected parental and non-infected parental cells. In line with our finding, Fiallos et al, showed that a long-term infection of HCMV in GSC also promoted cell proliferation (26). At the same time, Fornara et al, claimed that the HCMV IE expression induced GBM cells to display stem-like phenotypes and promoted the growth of glioma cancer stem cells (GCSCs) (28). Significant proliferation was shown in the stem-like cells. This is consistent with previous clinical finding in our group where the presence of HCMV in CRC patients with stage II, III and IV had a poor outcome (9,39). The tumoral presence of HCMV was associated with a decreased disease-free survival and this might due to the recurrence of CRC. The dysregulation of cell growth signaling in cancerous cells sustains chronic proliferation. Phosphatidylinositol-3-kinase/protein kinase (PI3K/AKT) and mitogen-activated protein kinase (MAPK) activation as well as phosphatase and tensin homologue (PTEN) mutation is known to promote tumorigenesis, as these signaling events stimulate growth, proliferation, and survival of cancer cells (40–43). It had been reported that HCMV gB induced activation of platelet-derived growth factor receptor α (PDGFRα) and PI3K/AKT, which increased growth and promoted survival and motility in cancer cells (44). HCMV IE proteins have been shown to induce expression of nuclear factor κB (NF-κB) subsequently activating the cell survival pathways in tumor cells (45). HCMV IE1 and IE2 were shown to interact with p53 suppressor to prevent the infected cells from undergoing cell growth arrest and apoptosis (46). In addition, HCMV encoded the protein pUL38, which mimics the mammalian target of rapamycin complex-1 by blocking the function of tuberous sclerosis protein 2 (TSC2). Inhibition of TSC2 by pUL38 dysregulates the mTOR pathway and induces survival signal in infected cells (47). Furthermore, Reeves et al, showed that β 2.7 kb interacts with the mitochondrial respiratory chain complex I in neuronal U373 cells and prevents cell death (23).

Accumulated evidence indicates that the HCMV protein US28 is one of the potential proteins that play an important role in tumor progression. US28 was found to induce an invasive and angiogenic phenotype in GBM. US28 has the ability to promote cell growth and induce progression of cell cycle and expression of vascular endothelial growth factor, a proangiogenic factor in NIH3T3. In intestinal cells, US28 was shown to activate β-catenin by inhibiting GSK3β. At the same time, it dysregulated the WNT signaling target genes such as cyclin D, survivin and c-myc, which are important for controlling cell proliferation (48–53). Furthermore, US28 promotes cell migration through the chemokines RANTES and monocyte chemoattractant protein 1 (MCP-1) (48). Another study showed that the interaction of integrin ανβ3 and PDGFRα with glioma cells resulted in an increase in the cell migratory ability (54). This explains the phenomenon observed in our study, wherein the infected colorectal cells showed greater migration ability.

Studies have proposed that the EMT pathway drives the progression of cancer to an aggressive metastatic stage. During the metastatic stage, tumor cells lose their adhesiveness with the adjacent cells, become more invasive, and develop cancer stemness properties. Several signaling pathways such as WNT/β-catenin, Notch, TGF-β, hedgehog, and EGFR are involved in the EMT process (55–60). In our study, we found that the expression of mesenchymal markers in EMT such as N-cadherin and fibronectin were increased upon infection with HCMV. On the other hand, E-cadherin was suppressed during HCMV infection. E-cadherin functions as a mediator during cell-cell adhesion and the loss of E-cadherin is known to induce EMT. β-catenin is thought to be secluded in E-cadherin adherent junction. APC malfunction in CRC may result in GSK3β inhibition by the WNT signaling pathway, leading to the accumulation of β-catenin in the cell cytoplasm. This will induce the expression of target genes such as c-myc and cyclin D by the TCF/LEF-1 family transcription factors. Activation of these genes usually stimulates tumor progression (61–64).

The array data show that the expression of WNT11 was high during the infection time course. Therefore, we repeated the experiment by evaluating the expression of related genes such as WNT11, FZD7, GSK3β, and β-catenin. It was confirmed that the expression of these genes was higher in the infected cells as compared with the non-infected cells. Previous studies (65,66) revealed that either the canonical or non-canonical WNT signaling was implicated during the dynamic and reversible EMT and mesenchymal-epithelial transition during CRC progression. The high expression of WNT11 and its ligand FZD7 is reported to enhance proliferation and migration/invasion activities in the colon cancer cells (67,68). These findings explain the phenotypic changes observed in our study, wherein HCMV infection enhanced the proliferation and migratory ability of cells. This study successfully established a CRC culture model with high HCMV infectivity to facilitate investigation of the underlying mechanisms. Further studies are needed to identify the HCMV genes involved in these phenotypic changes.

Acknowledgments

This study was supported by the grants from the Ministry of Science and Technology (MOST 105-2314-B-075-055-MY2-1 to Y-J.C. and MOST 104-2320-B-010-017 to J.C.H.). We also thank Dr Hui-Yu Chuang for her experimental assistance.

Abbreviations:

CRC

colorectal cancer

HNPCC

hereditary non-polyposis colorectal cancer

APC

adenomatous polyposis coli

TGF-β

transforming growth factor β

HCMV

human cytomegalovirus

IE-1

immediate early 1

PCR

polymerase chain reaction

ORF

open reading frame

GBM

glioblastoma multiforme

GSC

glioma stem cell

ATCC

American Type Culture Collection

MEM

minimal essential medium

FBS

fetal bovine serum

CPE

cytopathic effect

MOI

multiplicity of infection

EGF

epidermal growth factor

bFGF

basic fibroblast growth factor

IE

immediate early

PBS

phosphate-buffered saline

EMT

epithelial to mesenchymal transition

RT-PCR

reverse transcription polymerase chain reaction

cDNA

complementary DNA

DEPC

diethyl pyrocarbonate

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

ANOVA

analysis of variance

FZD7

frizzled-7

GSK3β

glycogen synthase kinase 3β

PI3K/AKT

phosphatidylinositol-3-kinase/protein kinase

MAPK

mitogen-activated protein kinase

PTEN

phosphatase and tensin homologue

PDGFRα

platelet-derived growth factor receptor α

TSC2

tuberous sclerosis protein 2

References

1 

World Health Organization fact sheet Cancer. February. 2017, http://www.who.int/mediacentre/factsheets/fs297/en/.

2 

Tanaka T: Colorectal carcinogenesis: Review of human and experimental animal studies. J Carcinog. 8:52009. View Article : Google Scholar : PubMed/NCBI

3 

Moore HG, Baxter NN and Guillem JG: Colorectal cancer: Epidemiology, etiology, and molecular basis. The ASCRS Textbook of Colon and Rectal Surgery. 2nd edition. Beck D: Springer Science, Business Media; pp. 669–690. 2011, View Article : Google Scholar

4 

Colussi D, Brandi G, Bazzoli F and Ricciardiello L: Molecular pathways involved in colorectal cancer: Implications for disease behavior and prevention. Int J Mol Sci. 14:16365–16385. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Markowitz SD and Bertagnolli MM: Molecular origins of cancer: Molecular basis of colorectal cancer. N Engl J Med. 361:2449–2460. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Harkins L, Volk AL, Samanta M, Mikolaenko I, Britt WJ, Bland KI and Cobbs CS: Specific localisation of human cytomegalovirus nucleic acids and proteins in human colorectal cancer. Lancet. 360:1557–1563. 2002. View Article : Google Scholar : PubMed/NCBI

8 

Chen HP, Jiang JK, Chen CY, Chou TY, Chen YC, Chang YT, Lin SF, Chan CH, Yang CY, Lin CH, et al: Human cytomegalovirus preferentially infects the neoplastic epithelium of colorectal cancer: A quantitative and histological analysis. J Clin Virol. 54:240–244. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Chen HP, Jiang JK, Lai PY, Chen CY, Chou TY, Chen YC, Chan CH, Lin SF, Yang CY, Chen CY, et al: Tumoral presence of human cytomegalovirus is associated with shorter disease-free survival in elderly patients with colorectal cancer and higher levels of intratumoral interleukin-17. Clin Microbiol Infect. 20:664–671. 2014. View Article : Google Scholar

10 

Dimberg J, Hong TT, Skarstedt M, Löfgren S, Zar N and Matussek A: Detection of cytomegalovirus DNA in colorectal tissue from Swedish and Vietnamese patients with colorectal cancer. Anticancer Res. 33:4947–4950. 2013.PubMed/NCBI

11 

Bai B, Wang X, Chen E and Zhu H: Human cytomegalovirus infection and colorectal cancer risk: A meta-analysis. Oncotarget. 7:76735–76742. 2016.PubMed/NCBI

12 

Crough T and Khanna R: Immunobiology of human cytomegalovirus: From bench to bedside. Clin Microbiol Rev. 22:76–98. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Murphy E, Yu D, Grimwood J, Schmutz J, Dickson M, Jarvis MA, Hahn G, Nelson JA, Myers RM and Shenk TE: Coding potential of laboratory and clinical strains of human cytomegalovirus. Proc Natl Acad Sci USA. 100:14976–14981. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Harkins LE, Matlaf LA, Soroceanu L, Klemm K, Britt WJ, Wang W, Bland KI and Cobbs CS: Detection of human cytomegalovirus in normal and neoplastic breast epithelium. Herpesviridae. 1:82010. View Article : Google Scholar : PubMed/NCBI

15 

Samanta M, Harkins L, Klemm K, Britt WJ and Cobbs CS: High prevalence of human cytomegalovirus in prostatic intraepithelial neoplasia and prostatic carcinoma. J Urol. 170:998–1002. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Melnick M, Sedghizadeh PP, Allen CM and Jaskoll T: Human cytomegalovirus and mucoepidermoid carcinoma of salivary glands: Cell-specific localization of active viral and oncogenic signaling proteins is confirmatory of a causal relationship. Exp Mol Pathol. 92:118–125. 2012. View Article : Google Scholar

17 

Cobbs CS, Harkins L, Samanta M, Gillespie GY, Bharara S, King PH, Nabors LB, Cobbs CG and Britt WJ: Human cytomegalovirus infection and expression in human malignant glioma. Cancer Res. 62:3347–3350. 2002.PubMed/NCBI

18 

Rahbar A, Orrego A, Peredo I, Dzabic M, Wolmer-Solberg N, Strååt K, Stragliotto G and Söderberg-Nauclér C: Human cytomegalovirus infection levels in glioblastoma multiforme are of prognostic value for survival. J Clin Virol. 57:36–42. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Stragliotto G, Rahbar A, Solberg NW, Lilja A, Taher C, Orrego A, Bjurman B, Tammik C, Skarman P, Peredo I, et al: Effects of valganciclovir as an add-on therapy in patients with cytomegalovirus-positive glioblastoma: A randomized, double-blind, hypothesis-generating study. Int J Cancer. 133:1204–1213. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Wolmer-Solberg N, Baryawno N, Rahbar A, Fuchs D, Odeberg J, Taher C, Wilhelmi V, Milosevic J, Mohammad AA, Martinsson T, et al: Frequent detection of human cytomegalovirus in neuroblastoma: A novel therapeutic target? Int J Cancer. 133:2351–2361. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Michaelis M, Doerr HW and Cinatl J Jr: The story of human cytomegalovirus and cancer: Increasing evidence and open questions. Neoplasia. 11:1–9. 2009. View Article : Google Scholar

22 

Söderberg-Nauclér C and Nelson JY: Human cytomegalovirus latency and reactivation - a delicate balance between the virus and its host's immune system. Intervirology. 42:314–321. 1999. View Article : Google Scholar

23 

Reeves MB, Davies AA, McSharry BP, Wilkinson GW and Sinclair JH: Complex I binding by a virally encoded RNA regulates mitochondria-induced cell death. Science. 316:1345–1348. 2007. View Article : Google Scholar : PubMed/NCBI

24 

Cobbs CS, Soroceanu L, Denham S, Zhang W, Britt WJ, Pieper R and Kraus MH: Human cytomegalovirus induces cellular tyrosine kinase signaling and promotes glioma cell invasiveness. J Neurooncol. 85:271–280. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Cobbs CS, Soroceanu L, Denham S, Zhang W and Kraus MH: Modulation of oncogenic phenotype in human glioma cells by cytomegalovirus IE1-mediated mitogenicity. Cancer Res. 68:724–730. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Fiallos E, Judkins J, Matlaf L, Prichard M, Dittmer D, Cobbs C and Soroceanu L: Human cytomegalovirus gene expression in long-term infected glioma stem cells. PLoS One. 9:e1161782014. View Article : Google Scholar : PubMed/NCBI

27 

Soroceanu L, Matlaf L, Khan S, Akhavan A, Singer E, Bezrookove V, Decker S, Ghanny S, Hadaczek P, Bengtsson H, et al: Cytomegalovirus immediate-early proteins promote stemness properties in glioblastoma. Cancer Res. 75:3065–3076. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Fornara O, Bartek J Jr, Rahbar A, Odeberg J, Khan Z, Peredo I, Hamerlik P, Bartek J, Stragliotto G, Landázuri N, et al: Cytomegalovirus infection induces a stem cell phenotype in human primary glioblastoma cells: Prognostic significance and biological impact. Cell Death Differ. 23:261–269. 2016. View Article : Google Scholar :

29 

Abdul Khalek FJ, Gallicano GI and Mishra L: Colon cancer stem cells. Gastrointest Cancer Res. (Suppl 1): S16–S23. 2010.

30 

Papailiou J, Bramis KJ, Gazouli M and Theodoropoulos G: Stem cells in colon cancer. A new era in cancer theory begins. Int J Colorectal Dis. 26:1–11. 2011. View Article : Google Scholar

31 

Du L, Wang H, He L, Zhang J, Ni B, Wang X, Jin H, Cahuzac N, Mehrpour M, Lu Y, et al: CD44 is of functional importance for colorectal cancer stem cells. Clin Cancer Res. 14:6751–6760. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Gorham H, Sugino T, Woodman AC and Tarin D: Cellular distribution of CD44 gene transcripts in colorectal carcinomas and in normal colonic mucosa. J Clin Pathol. 49:482–488. 1996. View Article : Google Scholar : PubMed/NCBI

33 

Wu TC, Lee WA, Pizzorno MC, Au WC, Chan YJ, Hruban RH, Hutchins GM and Hayward GS: Localization of the human cytomegalovirus 2.7-kb major early beta-gene transcripts by RNA in situ hybridization in permissive and nonpermissive infections. Am J Pathol. 141:1247–1254. 1992.PubMed/NCBI

34 

Cano A, Pérez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F and Nieto MA: The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol. 2:76–83. 2000. View Article : Google Scholar : PubMed/NCBI

35 

Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, Savagner P, Gitelman I, Richardson A and Weinberg RA: Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell. 117:927–939. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Mocarski E and Shenk T: Cytomegaloviruses. Fields Virology. 5th edition. Knipe D and Howley P: Lippincott Williams and Wilkins; Philadelphia, PA: pp. 2701–2772. 2007

37 

Fortunato EA and Spector DH: Regulation of human cytomegalovirus gene expression. Adv Virus Res. 54:61–128. 1999. View Article : Google Scholar : PubMed/NCBI

38 

Landolfo S, Gariglio M, Gribaudo G and Lembo D: The human cytomegalovirus. Pharmacol Ther. 98:269–297. 2003. View Article : Google Scholar : PubMed/NCBI

39 

Chen HP, Jiang JK, Chan CH, Teo WH, Yang CY, Chen YC, Chou TY, Lin CH and Chan YJ: Genetic polymorphisms of the human cytomegalovirus UL144 gene in colorectal cancer and its association with clinical outcome. J Gen Virol. 96:3613–3623. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Jiang BH and Liu LZ: PI3K/PTEN signaling in angiogenesis and tumorigenesis. Adv Cancer Res. 102:19–65. 2009. View Article : Google Scholar : PubMed/NCBI

41 

Suman S, Kurisetty V, Das TP, Vadodkar A, Ramos G, Lakshmanaswamy R and Damodaran C: Activation of AKT signaling promotes epithelial-mesenchymal transition and tumor growth in colorectal cancer cells. Mol Carcinog. 53(Suppl 1): E151–E160. 2014. View Article : Google Scholar

42 

Porta C, Paglino C and Mosca A: Targeting PI3K/Akt/mTOR signaling in cancer. Front Oncol. 4:642014. View Article : Google Scholar : PubMed/NCBI

43 

Mayer IA and Arteaga CL: The PI3K/AKT pathway as a target for cancer treatment. Annu Rev Med. 67:11–28. 2016. View Article : Google Scholar

44 

Cobbs C, Khan S, Matlaf L, McAllister S, Zider A, Yount G, Rahlin K, Harkins L, Bezrookove V, Singer E, et al: HCMV glycoprotein B is expressed in primary glioblastomas and enhances growth and invasiveness via PDGFR-alpha activation. Oncotarget. 5:1091–1100. 2014. View Article : Google Scholar : PubMed/NCBI

45 

Yurochko AD, Kowalik TF, Huong SM and Huang ES: Human cytomegalovirus upregulates NF-kappa B activity by transactivating the NF-kappa B p105/p50 and p65 promoters. J Virol. 69:5391–5400. 1995.PubMed/NCBI

46 

Castillo JP, Yurochko AD and Kowalik TF: Role of human cytomegalovirus immediate-early proteins in cell growth control. J Virol. 74:8028–8037. 2000. View Article : Google Scholar : PubMed/NCBI

47 

Moorman NJ, Cristea IM, Terhune SS, Rout MP, Chait BT and Shenk T: Human cytomegalovirus protein UL38 inhibits host cell stress responses by antagonizing the tuberous sclerosis protein complex. Cell Host Microbe. 3:253–262. 2008. View Article : Google Scholar : PubMed/NCBI

48 

Streblow DN, Soderberg-Naucler C, Vieira J, Smith P, Wakabayashi E, Ruchti F, Mattison K, Altschuler Y and Nelson JA: The human cytomegalovirus chemokine receptor US28 mediates vascular smooth muscle cell migration. Cell. 99:511–520. 1999. View Article : Google Scholar : PubMed/NCBI

49 

Maussang D, Verzijl D, van Walsum M, Leurs R, Holl J, Pleskoff O, Michel D, van Dongen GA and Smit MJ: Human cytomegalovirus-encoded chemokine receptor US28 promotes tumorigenesis. Proc Natl Acad Sci USA. 103:13068–13073. 2006. View Article : Google Scholar : PubMed/NCBI

50 

Maussang D, Langemeijer E, Fitzsimons CP, Stigter-van Walsum M, Dijkman R, Borg MK, Slinger E, Schreiber A, Michel D, Tensen CP, et al: The human cytomegalovirus-encoded chemokine receptor US28 promotes angiogenesis and tumor formation via cyclooxygenase-2. Cancer Res. 69:2861–2869. 2009. View Article : Google Scholar : PubMed/NCBI

51 

Slinger E, Maussang D, Schreiber A, Siderius M, Rahbar A, Fraile-Ramos A, Lira SA, Söderberg-Nauclér C and Smit MJ: HCMV-encoded chemokine receptor US28 mediates proliferative signaling through the IL-6-STAT3 axis. Sci Signal. 3:ra582010. View Article : Google Scholar : PubMed/NCBI

52 

Bongers G, Maussang D, Muniz LR, Noriega VM, Fraile-Ramos A, Barker N, Marchesi F, Thirunarayanan N, Vischer HF, Qin L, et al: The cytomegalovirus-encoded chemokine receptor US28 promotes intestinal neoplasia in transgenic mice. J Clin Invest. 120:3969–3978. 2010. View Article : Google Scholar : PubMed/NCBI

53 

Cai ZZ, Xu JG, Zhou YH, Zheng JH, Lin KZ, Zheng SZ, Ye MS, He Y, Liu CB and Xue ZX: Human cytomegalovirus-encoded US28 may act as a tumor promoter in colorectal cancer. World J Gastroenterol. 22:2789–2798. 2016. View Article : Google Scholar : PubMed/NCBI

54 

Ding Q, Stewart J Jr, Olman MA, Klobe MR and Gladson CL: The pattern of enhancement of Src kinase activity on platelet-derived growth factor stimulation of glioblastoma cells is affected by the integrin engaged. J Biol Chem. 278:39882–39891. 2003. View Article : Google Scholar : PubMed/NCBI

55 

Zhang J, Tian X-J and Xing J: Signal transduction pathways of EMT induced by TGF-β, SHH, and WNT and their crosstalks. J Clin Med. 5:412016. View Article : Google Scholar

56 

Derynck R, Muthusamy BP and Saeteurn KY: Signaling pathway cooperation in TGF-β-induced epithelial-mesenchymal transition. Curr Opin Cell Biol. 31:56–66. 2014. View Article : Google Scholar : PubMed/NCBI

57 

Takebe N, Harris PJ, Warren RQ and Ivy SP: Targeting cancer stem cells by inhibiting Wnt, Notch, and Hedgehog pathways. Nat Rev Clin Oncol. 8:97–106. 2011. View Article : Google Scholar

58 

Takebe N, Miele L, Harris PJ, Jeong W, Bando H, Kahn M, Yang SX and Ivy SP: Targeting Notch, Hedgehog, and Wnt pathways in cancer stem cells: Clinical update. Nat Rev Clin Oncol. 12:445–464. 2015. View Article : Google Scholar : PubMed/NCBI

59 

Gonzalez DM and Medici D: Signaling mechanisms of the epithelial-mesenchymal transition. Sci Signal. 7:re82014. View Article : Google Scholar : PubMed/NCBI

60 

Jin D, Fang Y, Li Z, Chen Z and Xiang J: Epithelial-mesenchymal transition-associated microRNAs in colorectal cancer and drug-targeted therapies (Review). Oncol Rep. 33:515–525. 2015. View Article : Google Scholar

61 

Bienz M and Clevers H: Linking colorectal cancer to Wnt signaling. Cell. 103:311–320. 2000. View Article : Google Scholar : PubMed/NCBI

62 

Polakis P: Wnt signaling and cancer. Genes Dev. 14:1837–1851. 2000.PubMed/NCBI

63 

Novellas de Munt L, Antas P and Li VS: Targeting Wnt signaling in colorectal cancer. A review in the theme: Cell signaling: proteins, pathways and mechanisms. Am J Physiol Cell Physiol. 309:C511–C521. 2015. View Article : Google Scholar

64 

Basu S, Haase G and X Ben-Ze'ev A: Wnt signaling in cancer stem cells and colon cancer metastasis. F1000Res 5: F1000 Faculty Rev. 699:2016.

65 

Brabletz T, Jung A, Reu S, Porzner M, Hlubek F, Kunz-Schughart LA, Knuechel R and Kirchner T: Variable beta-catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci USA. 98:10356–10361. 2001. View Article : Google Scholar : PubMed/NCBI

66 

Howard S, Deroo T, Fujita Y and Itasaki N: A positive role of cadherin in Wnt/β-catenin signalling during epithelial-mesenchymal transition. PLoS One. 6:e238992011. View Article : Google Scholar

67 

Ueno K, Hazama S, Mitomori S, Nishioka M, Suehiro Y, Hirata H, Oka M, Imai K, Dahiya R and Hinoda Y: Down-regulation of frizzled-7 expression decreases survival, invasion and metastatic capabilities of colon cancer cells. Br J Cancer. 101:1374–1381. 2009. View Article : Google Scholar : PubMed/NCBI

68 

Nishioka M, Ueno K, Hazama S, Okada T, Sakai K, Suehiro Y, Okayama N, Hirata H, Oka M, Imai K, et al: Possible involvement of Wnt11 in colorectal cancer progression. Mol Carcinog. 52:207–217. 2013. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Teo WH, Chen H, Huang JC and Chan Y: Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells. Int J Oncol 51: 1415-1426, 2017.
APA
Teo, W.H., Chen, H., Huang, J.C., & Chan, Y. (2017). Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells. International Journal of Oncology, 51, 1415-1426. https://doi.org/10.3892/ijo.2017.4135
MLA
Teo, W. H., Chen, H., Huang, J. C., Chan, Y."Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells". International Journal of Oncology 51.5 (2017): 1415-1426.
Chicago
Teo, W. H., Chen, H., Huang, J. C., Chan, Y."Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells". International Journal of Oncology 51, no. 5 (2017): 1415-1426. https://doi.org/10.3892/ijo.2017.4135
Copy and paste a formatted citation
x
Spandidos Publications style
Teo WH, Chen H, Huang JC and Chan Y: Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells. Int J Oncol 51: 1415-1426, 2017.
APA
Teo, W.H., Chen, H., Huang, J.C., & Chan, Y. (2017). Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells. International Journal of Oncology, 51, 1415-1426. https://doi.org/10.3892/ijo.2017.4135
MLA
Teo, W. H., Chen, H., Huang, J. C., Chan, Y."Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells". International Journal of Oncology 51.5 (2017): 1415-1426.
Chicago
Teo, W. H., Chen, H., Huang, J. C., Chan, Y."Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells". International Journal of Oncology 51, no. 5 (2017): 1415-1426. https://doi.org/10.3892/ijo.2017.4135
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team