This article is mentioned in:

Introduction

Beclin1 (BECN1), a coiled-coil protein, directly interacts with B-cell lymphoma 2 (Bcl-2) (1). BECN1, also known as ATG6, belongs to the autophagy-related (Atg) family, key molecules in regulating autophagy (2,3). BECN1 acts downstream of Ulk1 and protein kinase B (Akt) to initiate phagophore formation (4,5).

BECN1 is monoallelically deleted in 40–75% of breast, ovarian and prostate cancer cases (6) and is most likely a haplo-insufficient tumor suppressor (7–9). BECN1 has the potential to predict a favorable prognosis in gastric cancer, breast cancer, and lymphoma (10). However, the exact role of BECN1 in breast cancer is not fully understood. Monoallelic loss of Becn1 may promote breast cancer development in Wnt1-driven tumorigenesis, suggesting a tumor suppressing role of BECN1 (11). By contrast, monoallelic deletion of Becn1 promotes the formation of spontaneous lung cancer, liver cancer and lymphomas, but only led to mammary hyperplasia in C57BL/6J mice (8) and does not affect ERBB2- and PyMT-driven mammary tumorigenesis in immortalized mouse mammary epithelial cells (iMMECs) (12). Furthermore, monoallelic Becn1 loss inhibits Palb2-associated mammary tumorigenesis in a Trp53-wild-type background (13). Gong et al (14) also demonstrated that BECN1 promotes tumorigenicity in breast cancer stem-like cells. These seemingly paradoxical roles of BECN1 in breast cancer progression may be explained by various cellular contexts resulting in different consequences. In addition, bi-allelic knockout of Becn1 leads to embryolethality in a mouse model, hindering further investigation (9). To further investigate the function of BECN1 in breast cancer, the present study used the CRISPR/Cas9 system to disrupt the BECN1 gene in the human triple-negative breast cancer (TNBC) MDA-MB-231 cell line. Since being improved to edit mammalian genes (15), CRISPR/Cas9 has been widely used to edit genes in numerous species (16–18).

In the present study, BECN1 was successfully disrupted in MDA-MB-231 cells and three stable monoclonal BECN1-knockout cell lines were screened for the first time. The MDA-MB-231 cells with BECN1-knockout exhibited markedly decreased proliferation, colony formation, migration and invasion accompanied by G0/G1 cell cycle arrest and a partial epithelial-mesenchymal transition (EMT) signal reversal in vitro. On the other hand, it was demonstrated that BECN1 expression was increased in TNBC samples. Therefore, the results of the present study provide solid evidence for the oncogenic role of BECN1 in TNBC growth, migration and invasion.

Materials and methods

Cell culture

The human TNBC MDA-MB-231 cell line, human epithelial breast cancer BT-474 cell line and human embryonic kidney 293T and 293A cell lines were purchased from the American Type Culture Collection (Manassas, VA, USA), and were cultured in Dulbecco's modified Eagle's medium (DMEM), supplemented with 10% fetal bovine serum (FBS; both Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C in a humidified 5% CO2 atmosphere.

Construction of plasmids

Three G(N19)NGG sequences downstream from the BECN1 TSS were selected as potential targeting sites. N indicates any nucleotide (A, T, G or C). The three targeting sites were as follows: B432, GTCCAACAACAGCACCATGCAGG; B497, GGACACGAGTTTCAAGATCCTGG; and B525, GTCACCATCCAGGAACTCACAGG. To construct B432, B497 and B525 sgRNA lentiviral plasmids, respective primer pairs were used as a template for CRIF and CRIR PCR amplification in separate reactions (Table I). The PCR product was inserted into the pLKO.1 plasmid (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) using Gibson master mix (New England Biolabs, Inc., Ipswich, MA, USA). The flag-tagged Cas9 gene was cloned into the pShuttle-CMV plasmid (a gift from Dr Pu-Min Zhang) at the BglII and XhoI restriction sites. Following linearizing with PmeI, pShuttle-CMV-Cas9 was co-transformed with the pAdEasy-1 plasmid (a gift from Dr Pu-Min Zhang) into BJ5183 cells (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA), according to the manufacturer's protocol. Following incubation overnight at 37°C, positive clones selected on LB plates containing 50 µg/ml kanamycin (Sigma-Aldrich; Merck KGaA) were identified by digesting with PacI.

Table I Oligonucleotides used in the present study.

Table I

Oligonucleotides used in the present study.

Oligonucleotide	Sequence
B432_F	5′-GAAAGGACGAAACACCGTC CAACAACAGCACCATGCGTTTTAGAGCTAGAAAT-3′
B432_R	5′-ATTTCTAGCTCTAAAACGCA TGGTGCTGTTGTTGGACGGTGTTTCGTCCTTTC-3′
B497_F	5′-GAAAGGACGAAACACCGGAC ACGAGTTTCAAGATCCGTTTTAGAGCTAGAAAT-3′
B497_R	5′-ATTTCTAGCTCTAAAACGGAT CTTGAAACTCGTGTCCGGTGTTTCGTCCTTTC-3′
B525_F	5′-GAAAGGACGAAACACCGTC ACCATCCAGGAACTCACGTTTTAGAGCTAGAAAT-3′
B525_R	5′-ATTTCTAGCTCTAAAACGTGAG TTCCTGGATGGTGACGGTGTTTCGTCCTTTC-3′
CRI_F	5′-GTATTTCGATTTCTTGGCTTTATA TATCTTGTGGAAAGGACGAAACACCG-3′
CRI_R	5′-GTTGATAACGGACTAGCCTTATT TTAACTTGCTATTTCTAGCTCTAAAAC-3′
B371_F	5′-GGCGTCGCTTCTCCCTAATGTTG-3′
B793_R	5′-GCCCGCCTCGGTCTCCCAAAATGC-3′
N-cadherin_F	5′-AGCCAACCTTAACTGAGGAGT-3′
N-cadherin_R	5′-GGCAAGTTGATTGGAGGGATG-3′
Vimentin _F	5′-CGAAAACACCCTGCAATCTT-3′
Vimentin _R	5′-CTGGATTTCCTCTTCGTGGA-3′
Claudin-1_F	5′-GTCATTGGGGGTGCGATA-3′
Claudin-1_R	5′-GGTGTTGGGTAAGAGGTTGTTT-3′
Snail_F	5′-CCTGCGTCTGCGGAACCT-3′
Snail_R	5′-CCTGGCACTGGTACTTCTTGACA-3′
GAPDH_F	5′-ACGGATTTGGTCGTATTGGG-3′
GAPDH_R	5′-TGATTTTGGAGGGATCTCGC-3′
E-cadherin_F	5′-GCCTCCTGAAAAGAGAGTGGAAG-3′
E-cadherin_R	5′-TGGCAGTGTCTCTCCAAATCCG-3′

CRISPR efficiency evaluation

The UCA™ CRISPR efficiency evaluation kit was purchased from Beijing Biocytogen Co., Ltd. (Beijing, China). Briefly, the targeting sequence of BECN1 amplified with the primer set B371_F and B793_R (Table I) was cloned into a precut pUCA plasmid (UCA-BECN1; Beijing Biocytogen Co., Ltd.). The UCA-BECN1, sgRNA and Flag-Cas9 plasmids were co-transfected into 293T cells using Lipofectamine™ 3000 (Thermo Fisher Scientific, Inc.). Approximately 48 h after transfection, cells were lysed and luciferase activity was measured using the dual-luciferase reporter assay (Promega Corporation, Madison, WI, USA) with a Lumat LB 9501 Luminometer (Berthold Technologies GmbH & Co., Bad Wildbad, Germany). CRISPR efficiency was calculated as the ratio of firefly luciferase to Renilla luciferase activity.

Lentivirus and adenovirus packaging and infection

To package the sgRNA lentivirus, the sgRNA plasmid and packaging plasmids, pMD and SPA were co-transfected into 293T cells as described earlier. The supernatant was harvested 48 h after transfection and used to infect MDA-MB-231 cells. The recombinant Ad plasmid was linearized with PacI and transfected into 293A cells using Lipofectamine™ 3000 (Thermo Fisher Scientific, Inc.) to produce Cas9 adenovirus. Infected MDA-MB-231 cells were screened for sgRNA-positive cells by adding 2 µg/ml puromycin (Sigma-Aldrich; Merck KGaA) for one week. Puromycin-resistant cells were further infected with Cas9 adenovirus for 12 h. After 4 days of culture, the cells were well prepared for the subsequent experiments.

Cell genomic DNA extraction and target sequence amplification

The genomic DNA of MDA-MB-231 cells was extracted using a Qiagen Genomic kit (Qiagen GmbH, Hilden, Germany). Next, the genomic region surrounding the CRISPR/Cas9 target site was amplified by PCR using the primer set, B371_F and B793_R (Table I). PCR was performed using GoTaq® Green Master mix (Promega Corporation) in an ABI 2720 Thermal cycler (Applied Biosystems; Thermo Fisher Scientific, Inc.) as follows: 95°C for 2 min; 33 cycles at 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec; and 72°C for 5 min. The 423-bp PCR product was verified using 1.5% agarose gel electrophoresis and then purified using the QIAquick® gel extraction kit (Qiagen GmbH).

T7 Endonuclease I (T7EI) digestion assay

T7EI was purchased from NEB. Prior to T7EI digestion, the PCR product amplified using the primer set, B371_F and B793_R (Table I), was denatured and annealed. In brief, the PCR product was incubated in 94°C water and cooled to room temperature naturally. The PCR product was then digested with T7EI at 37°C for 2 h and resolved with 1.5% agarose gel electrophoresis.

Sequencing analysis of a single cell colony

The genomic DNA of a single cell colony was extracted using a Qiagen Genomic kit (Qiagen GmbH) and amplified using the primer set, B371_F and B793_R (Table I). Following purification, the PCR product was ligated into the pGEM-T Easy vector (Promega Corporation). The ligation product was used to transform competent E. coli DH5α (Thermo Fisher Scientific, Inc.), and positive clones selected on LB plates containing 100 µg/ml ampicillin (Sigma-Aldrich; Merck KGaA) were sequenced using the universal T7 primer.

Western blotting

Cells were lysed using radioimmunoprecipitation assay buffer (Applygen Technologies Inc., Beijing, China) supplemented with protease and phosphatase inhibitors (Roche Diagnostics GmbH, Mannheim, Germany). The concentration of the protein was determined by Pierce™ bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.). Protein lysate (20 µg per lane) was separated by 10% SDS-PAGE gel and transferred onto nitrocellulose membranes (EMD Millipore, Billerica, MA, USA). The membranes were blocked with 5% skimmed milk (BD Biosciences, San Jose, CA, USA) in TBST for 2 h at room temperature and incubated overnight at 4°C with the following primary antibodies: BECN1 (dilution, 1:2,000; cat. no. sc-11427; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), GAPDH (dilution, 1:2,000; cat. no. sc-365062; Santa Cruz Biotechnology, Inc.), N-cadherin (dilution, 1:1,000; cat. no. 13116; Cell Signaling Technology, Inc., Danvers, MA, USA), Snail (dilution, 1:1,000; cat. no. 3879; Cell Signaling Technology, Inc.), Claudin-1 (dilution, 1:1,000; cat. no. 13255; Cell Signaling Technology, Inc.), E-cadherin (dilution, 1:1,000; cat. no. 3195; Cell Signaling Technology, Inc.) and Vimentin (dilution, 1:8,000; cat. no. ab92547; Abcam, Cambridge, UK). Next, the membranes were incubated with horseradish peroxidase-conjugated anti-rabbit or anti-mouse secondary antibodies (dilution, 1:5,000; cat. no. 7074 and 7076; Cell Signaling Technology, Inc.) for 1 h at room temperature. Bands were visualized using an enhanced chemiluminescence reagent (EMD Millipore).

Reverse transcription-quantitative polymerase chain reaction (qPCR)

Total RNA was isolated using TRIzol reagent (Thermo Fisher Scientific, Inc.). Next, reverse transcription of 2 µg total RNA was performed using Superscript™ III transcriptase (Thermo Fisher Scientific, Inc.). Regarding qPCR, cDNA was amplified using THUNDERBIRD SYBR qPCR mix (Toyobo Life Science, Osaka, Japan) in a Chromo4™ system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). PCR started with a 10-min denaturation step at 95°C, followed by 40 step cycles at 95°C for 15 sec and 60°C for 60 sec. The expression of N-cadherin, Vimentin, Claudin-1, Snail and E-cadherin was analyzed using the primers shown in Table I. GAPDH was used as an internal control for normalization. The 2−∆∆Cq method was used to calculate the relative expression levels (19).

Cell Counting kit 8 (CCK-8) and colony formation assays

For the CCK-8 assay, MDA-MB-231 cells (1,000 cells/well) were seeded into 96-well plates and incubated for 7 consecutive days. CCK-8 assays were performed in quintuplicate and proliferation of cells was measured by adding 10 µl CCK-8 reagent (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) to each well at different time-points. Plates were incubated at 37°C for 2.5 h and absorbance was evaluated using a microplate reader (Bio-Rad Laboratories, Inc.) at 450 nm.

For the colony formation assay, MDA-MB-231 cells (1,000 cells/well) were plated into 6-well plates. Cells were cultured for up to 14 days and fresh DMEM supplemented with 10% FBS (both Thermo Fisher Scientific, Inc.) was changed every 3 days. Cells were fixed in paraformaldehyde for 10 min at room temperature and stained with crystal violet for 15 min at room temperature. Colonies with >50 cells were counted.

Flow cytometric analysis

For the apoptosis assay, cells were stained using the PE Annexin V Apoptosis Detection kit I (BD Biosciences), according to the manufacturer's protocol. In brief, cells were digested with trypsin without EDTA, washed two times with PBS and resuspended in 100 µl binding buffer, followed by simultaneous staining with 5 µl PE Annexin V and 5 µl 7-AAD for 15 min at room temperature in the dark, and then analyzed using a flow cytometer (BD Biosciences).

For cell cycle analysis, cells were harvested and fixed in cold 70% alcohol at 4°C overnight. Cells were collected by centrifugation (800 × g for 5 min at room temperature), washed twice in PBS and incubated with FxCycle™ PI/RNase Staining Solution (Thermo Fisher Scientific, Inc.) for 30 min at room temperature in the dark. Cell cycle distribution was then evaluated using a flow cytometer and CellQuest™ software (version 6.0; BD Biosciences).

Wound healing assay

For the wound healing assay, cells were seeded into 6-well plates and an artificial wound was made using a sterile 200 µl pipette tip. Following rinsing with PBS, cells were incubated in serum-free DMEM (Thermo Fisher Scientific, Inc.). Images of the scratch gap were captured at 0 and 24 h under a light microscope (magnification, ×100; Eclipse Ti-U; Nikon Corporation, Tokyo, Japan). The percentage of wound healing was evaluated as follows: [1− (width of the wound at 24 h/width of the wound at 0 h)] ×100.

Transwell migration and invasion assays

Transwell chambers (8 µm-pore size; Corning Incorporated, Corning, NY, USA) coated with or without diluted Matrigel (BD Biosciences) on the upper chamber were used for invasion or migration assays. Briefly, 5×104 MDA-MB-231 cells in serum-free DMEM (Thermo Fisher Scientific, Inc.) were seeded into the upper chamber and medium supplemented with 10% FBS was added to the lower chamber. Following culture for 8 or 24 h, cells remaining on the upper side of the filter membrane were gently wiped off using a cotton swab, while cells that migrated or invaded the lower chamber were fixed with paraformaldehyde for 10 min at room temperature and stained with crystal violet for 15 min at room temperature. Cells were counted in five different randomly selected fields under a light microscope (magnification, ×100; Nikon Corporation).

GEO database analysis

Gene expression data (accession nos., GSE81838 and GSE65194) were retrieved from the NCBI Gene Expression Omnibus (GEO) database. Details of patients and analysis of microarray data were as previously described (20,21). GSE81838 consisted of 10 paired TNBC tissues and adjacent normal stromal tissues, and GSE65194 contained 41 TNBC samples and 11 normal breast tissue samples. Expression data from GSE81838 were normalized using the Robust MultiChip Averaging (RMA) algorithm implemented in the Bioconductor package Affy and log2-transformed. Data from GSE65194 were analyzed using standard AffyCDF or Brainarray HGU133Plus2_Hs_ENTREZG version 13 custom chipset definition file and normalized using GeneChip RMA (GC-RMA).

Statistical analysis

SPSS version 19.0 software (IBM Corp., Armonk, NY, USA) was used for statistical analyses. Data are presented as the mean ± standard deviation (SD) and error bars represent SD values from three independent experiments, unless otherwise indicated. Multiple-group comparisons were performed using one-way analysis of variance, followed by the Bonferroni's post hoc test. Comparisons between two groups were calculated using the two-sample t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

Establishing BECN1-knockout MDA-MB-231 cell lines

Becn1 bi-allelic knockout mice die early in embryogenesis (9), which hampers further investigation of the functions of BECN1 in autophagy and tumorigenesis. In order to determine if cells survive following BECN1-knockout, the CRISPR/Cas9 technique was used to establish a BECN1-knockout cell line. Using the free online bioinformatical sgRNA design tool (http://crispr.mit.edu/) developed by Dr Feng Zhang, the genomic and cDNA sequences downstream of the translation start site (TSS) were analyzed. As demonstrated in Fig. 1A, three sequences with the highest scores were selected to construct sgRNA lentivirus vectors. In order to assess vector efficiency, a luciferase reporter assay was performed (Fig. 1B). Luciferase assay data indicated that sgRNA#1 had the highest efficiency, which was also confirmed by western blot analysis (Fig. 1C).

Figure 1 sgRNA-directed BECN1 gene editing efficiency assay. (A) A schematic representation of three different sgRNAs targeting EXON2 of BECN1. TSS, translation start site; black shading block, exon; black line, intron. (B) Luciferase reporter assay. The DNA fragment comprising the sgRNA targeting site with no mutation was cloned into the pUCA-LUC reporter plasmid (UCA-BECN1). The UCA-BECN1, sgRNA and Flag-Cas9 plasmids were co-transfected into 293T cells, and luciferase activities were measured 48 h post-transfection. NC, negative control; PC, positive control. ***P<0.001 vs. NC. (C) Western blot analysis of BECN1 in MDA-MB-231 cells following sgRNA lentivirus and Cas9 adenovirus infection. GAPDH was used as an internal control. BECN1, Beclin1.

Based on the aforementioned results, sgRNA#1 was selected to package the lentivirus that was used to infect MDA-MB-231 cells. Puromycin-resistant cells were further infected with Cas9 adenovirus. Following serial dilution and culturing for up to two weeks, >20 single cell colonies were subjected to T7 Endonuclease I (T7EI) digestion. Five clones were subjected to a second round of T7EI digestion (Fig. 2A). Clones A, B and D (renamed KO#1, KO#2 and KO#3, respectively) were selected for western blotting and sequencing verification. Western blotting verified that BECN1 was not expressed in these three clones (Fig. 2B). Sequencing indicated that the loss of BECN1 expression was due to multiple InDels occurring at the BECN1 locus, all of which led to frame shifts and subsequent gene knockout (Fig. 2C). Taken together, the results indicated that stable cell lines that could survive following BECN1-knockout were successfully constructed.

Figure 2 Analysis of BECN1 using a T7EI digestion assay and sequence analysis following BECN1 disruption in MDA-MB-231 cells. (A) T7EI digestion assay. Genomic DNA was extracted from five representative cell clones derived from monoclonal colonies. The editing site was amplified with primer set, B371_F and B793_R, and then subjected to T7EI digestion. The black arrow indicates the wild-type band and the grey arrows indicate mutant bands. Ctrl, wild-type MDA-MB-231 cells. (B) Western blot analysis of BECN1 in wild-type MDA-MB-231 cells (Ctrl) and the selected monoclonal cells, which were named #1, #2 and #3. Actin served as the internal control. (C) Sequencing analysis of the BECN1 gene in the selected clones (#1, #2 and #3). The bracketed number is the PCR clones with a specific edit over the total PCR clones tested. TSS, translation start site. BECN1, Beclin1; T7EI, T7 Endonuclease I.

BECN1-knockout inhibits proliferation and colony formation of MDA-MB-231 cells via inducing cell cycle arrest, not apoptosis

Since MDA-MB-231 cells with BECN1-knockout were able to survive, the effect of BECN1-knockout on cell growth was analyzed by comparing the viability of BECN1-knockout and wild-type (WT) MDA-MB-231 cells between 24 and 168 h after inoculation. As demonstrated in Fig. 3A, no significant difference in the viability of BECN1-knockout MDA-MB-231 cells was observed when compared with WT cells at 24 h. However, when compared with WT MDA-MB-231 cells, BECN1 KO#1 cells exhibited markedly decreased proliferation after 72 h, and the proliferation of BECN1 KO#2 and KO#3 cells was significantly inhibited after 48 h in culture (P<0.001). The colony formation assay is an in vitro approach to evaluate the ability of a single cell to grow into a colony and essentially tests every cell within a population for its ability to undergo 'unlimited ' division (22). It was also determined that BECN1-knockout inhibited the colony formation capacity of MDA-MB-231 cells (P<0.001; Fig. 3B). Therefore, BECN1-knockout MDA-MB-231 cells retained growth capability but exhibited an attenuated proliferation rate.

Figure 3 BECN1-knockout suppresses MDA-MB-231 cell growth in vitro. (A) Growth curves of MDA-MB-231 cells following BECN1-knockout. Cellular proliferation was measured using the CCK-8 assay at different time-points. (B) Colony formation of MDA-MB-231 cells following BECN1-knockout. BECN1 WT or KO MDA-MB-231 cells were cultured for up to 2 weeks. Colonies were stained using crystal violet and counted. Quantitative data of colony formation is presented in a histogram (bottom) and the percentage was normalized to WT cells. NS, not significant (P>0.05). ***P<0.001 vs. WT cells. BECN1, Beclin1; WT, wild-type; KO, knockout.

Next, flow cytometry was performed to investigate whether the anti-proliferative effect of BECN1-knockout was due to apoptosis or cell cycle arrest. There was no significant difference in apoptosis in the BECN1-knockout MDA-MB-231 cells compared with WT (Fig. 4A and C). However, all three BECN1-knockout cell lines accumulated at the G0/G1 phase with decreased cell proportions in the S and G2/M phases compared with WT (Fig. 4B and D). The percentage of G0/G1 cells significantly increased from 31.7±1.6% (WT) to 42.5±1.3% (KO#1; P<0.001), 44.1±1.2% (KO#2; P<0.001) and 39.9±1.3% (KO#3; P<0.01). These results suggested that BECN1-mediated autophagy or other pathways serve an important role in cancer cell proliferation via regulation of cell cycle progression.

Figure 4 BECN1-knockout induces cell cycle arrest, not apoptosis, in MDA-MB-231 cells. (A) Effect of BECN1-knockout on apoptosis in MDA-MB-231 cells. The apoptotic rate was analyzed by Annexin V staining and flow cytometry. The right lower quadrant represents early apoptotic cells, whereas the right upper quadrant contains late apoptotic cells. (B) Effect of BECN1-knockout on cell cycle distribution of MDA-MB-231 cells. Cell cycles were measured by flow cytometry. (C) Quantification of the data shown in A. NS, not significant (P>0.05 vs. WT cells). (D) Quantification of the data shown in B. **P<0.01; ***P<0.001 vs. WT cells. BECN1, Beclin1; WT, wild-type; KO, knockout.

BECN1-knockout suppresses MDA-MB-231 cell migratory and invasive potential by partially attenuating EMT signals

Subsequently, whether BECN1 affects the tumor metastasis characteristics of migratory and invasive ability in MDA-MB-231 cells was investigated. The wound healing assay revealed that MDA-MB-231 cells with BECN1-knockout exhibited a notably slower scratch closure rate than WT cells (Fig. 5A), which suggested mobility inhibition. The Transwell migration assay further confirmed that BECN1-knockout markedly reduced the migratory ability of MDA-MB-231 cells (Fig. 5B). Furthermore, the invasive potential of BECN1-knockout MDA-MB-231 cells was significantly decreased (Fig. 5C), which was confirmed by the Transwell invasion assay. In brief, the results of the present study demonstrated that BECN1-knockout markedly decreased the migratory and invasive potential of MDA-MB-231 cells in vitro.

Figure 5 BECN1-knockout inhibits the migratory and invasive ability of MDA-MB-231 cells. (A) Representative images of the wound healing assay (magnification, ×100). Right panel, quantitative results. Representative images of the Transwell (B) migration and (C) invasion assays. BECN1 WT or KO MDA-MB-231 cells migrated or invaded to the bottom side of the filter membrane are shown (magnification, ×100). Right panel, quantitative results are presented as a histogram. The percentage was normalized to WT cells. Cells were counted in five different randomly selected fields. **P<0.01; ***P<0.001 vs. WT cells. BECN1, Beclin1; WT, wild-type; KO, knockout.

To test whether the effect of BECN1-knockout on migration and invasion is associated with EMT, the present study assessed the cell morphology under a phase contrast microscope. As demonstrated in Fig. 6A, BECN1-knockout changed the mesenchymal morphology of MDA-MB-231 cells into a partial epithelial-like morphology with decreased cell scattering and increased cell-cell adhesion. Consistent with the morphology changes, expression of mesenchymal markers, including N-cadherin, Vimentin and Snail decreased, while expression of the epithelial marker Claudin-1, but not E-cadherin, increased following BECN1-knockout (Fig. 6B–D), suggesting a partial reversal of EMT. Taken together, the results of the present study demonstrated that BECN1 regulates breast cancer cell migration and invasion via partial modulation of the EMT signaling pathway.

Figure 6 BECN1 partially modulates EMT phenotype in MDA-MB-231 cells. (A) Phase contrast images of BECN1 WT and KO MDA-MB-231 cells (magnification, ×100). (B) Protein levels of tumor EMT markers (N-cadherin, Vimentin, Claudin-1 and Snail) in BECN1 WT and KO MDA-MB-231 cells were detected using western blotting with respective antibodies. Actin served as the internal control. (C) RNA levels of N-cadherin, Vimentin, Claudin-1 and Snail in BECN1 WT and KO MDA-MB-231 cells were determined using qPCR. The relative mRNA levels were normalized to GAPDH. (D) BECN1-knockout does not affect the expression of E-cadherin in MDA-MB-231 cells. E-cadherin protein was detected using western blotting (left panel) and RNA expression was determined using qPCR (right panel). E-cadherin expression in the epithelial breast cancer BT-474 cell line was used as a positive control. NS, not significant (P>0.05); **P<0.01; ***P<0.001 vs. WT MDA-MB-231 cells. qPCR, quantitative polymerase chain reaction; BECN1, Beclin1; EMT, epithelial-mesenchymal transition; WT, wild-type; KO, knockout.

BECN1 expression is increased in TNBC tissue samples

To determine whether the expression of BECN1 is altered in TNBC tissues, a GEO dataset (GSE81838) containing ten patients with TNBC was analyzed (20). The results demonstrated that BECN1 was significantly upregulated in half of the TNBC tissues compared with adjacent normal stromal tissues (Fig. 7A; P<0.05). Meanwhile, another GEO dataset (GSE65194) containing 41 TNBC samples and 11 normal breast tissue samples was analyzed (21). BECN1 expression was significantly increased in tumor tissues compared with healthy breast tissues (Fig. 7B; P<0.001). The results suggested that BECN1 may serve as an oncogene in TNBC.

Figure 7 The mRNA expression of BECN1 is upregulated in TNBC tissues. (A) The publicly available GEO dataset, GSE81838, was analyzed to determine BECN1 expression in TNBC tissues relative to adjacent normal stromal tissues. (B) Analysis of the level of BECN1 in patients with TNBC using the GEO dataset, GSE65194. ***P<0.001 vs. normal breast sample from mammoplasty surgery. TNBC, triple-negative breast cancer; GEO, Gene Expression Omnibus; BECN1, Beclin1.

Discussion

A large volume of data has implied the important role of BECN1 in autophagy and tumorigenesis. Unfortunately, the embryolethality of Becn1 bi-allelic knockout has largely affected further investigation of BECN1 function (9). The function of BECN1 in tumorigenesis remains controversial, and may be tissue- and context-dependent. While mammary tumor development was either inhibited or unaffected following loss of Palb2, or overexpression of PyMT and ERBB2, monoallelic Becn1 loss accelerates mammary tumorigenesis following parity and Wnt1-activation (11–13). Fortunately, CRISPR/Cas9-mediated gene disruption at the single cell level shed light on this problem. Using the CRISPR/Cas9 technique, BECN1 was successfully disrupted in human TNBC MDA-MB-231 cells and screened three monoclonal cells with BECN1-knockout. In a previous study, Aita et al (6) demonstrated that MDA-MB-231 cells have three BECN1 loci. The present study revealed that cell clone #2 and #3 harbored three disruptions in BECN1. Clone #1 only had two versions, which may be due to two loci of BECN1 being the same. In brief, these BECN1-knockout cell lines provided an ideal cellular model for the investigation into BECN1 function and demonstrated that BECN1-knockout is not lethal in vitro.

BECN1 was first identified as a mammalian tumor suppressor by Liang et al (7). BECN1 expression is decreased in human breast epithelial carcinoma cell lines and tissues at the protein level, and induction of BECN1 into MCF-7 cells suppresses proliferation, colony formation in vitro and tumor formation in nude mice (7). However, Gong et al (14) demonstrated that BECN1 is critical for the maintenance of cancer stem-like cells and tumor development in nude mice. Maycotte et al (23) also discovered that knockdown of BECN1 by shRNA inhibits clonogenic proliferation of MDA-MB-231 cells. The present study demonstrated that BECN1 promoted cell proliferation and colony formation in MDA-MB-231 cells. These results and those of previous studies suggested that BECN1 could function as an oncogene and a tumor suppressor under distinct cellular contexts.

Tumor growth is usually associated with apoptosis and/or cell cycle alterations. Apoptosis is characterized by clear morphological changes, including nuclear condensation and fragmentation, as well as blebbing of the plasma membrane leading to the formation of apoptotic bodies (24). Ectopic overexpression of BECN1 does not affect apoptosis under normal culture conditions but inhibits apoptosis induced by starvation, hypoxia and doxorubicin in TNBC cells in vitro (25). Additionally, suppression of BECN1 promotes apoptosis induced by epirubicin (26), tamoxifen (27,28) and lapatinib (29) in breast cancer cells. In the present study, there was no change in the apoptosis of MDA-MB-231 cells following BECN1-knockout. By contrast, BECN1-knockout induced a significant G0/G1 phase arrest and decreased the proportion of cells in the S and G2/M phases. As a control for cell growth and proliferation, when facing unfavorable conditions or external stress, cells block the cell cycle transiently or irreversibly, which prevents spread of damaged and potentially harmful cells (30,31). A previous study has demonstrated that mRNA and protein expression levels of BECN1 are upregulated when released from synchronization at the G1/S boundary by a double thymidine block in HeLa cells (32). BECN1 is essential for chromosome congression and outer kinetochore assembly (33). Inhibition of BECN1 leads to centrosome amplification (34), which usually causes abnormal cell division and genome instability. These results indicated that BECN1 could affect cancer cell growth by regulating the cell cycle and/or apoptosis depending on the external environment.

Another hallmark of cancer is invasion and metastasis (35). High levels of BECN1 expression are associated with more lymph node and distant metastasis in patients with TNBC, and overexpression of BECN1 promotes EMT under starvation conditions in TNBC cells (25). The present study demonstrated that BECN1-knockout inhibited the migration and invasion of MDA-MB-231 cells. Furthermore, the decreased migratory and invasive ability was associated with a morphological switch in mesenchymal phenotype to a partial epithelial-like phenotype following BECN1-knockout. Upon undergoing EMT, cancer cells convert from a non-invasive epithelial phenotype to an invasive mesenchymal phenotype to obtain migratory and invasive ability, allowing degradation of the extracellular matrix and migration to distant organs (36). Cadherin is a transmembrane adhesion glycoprotein (37) and the switch from E-cadherin to N-cadherin is a remarkable change during EMT (38). In the present study, E-cadherin was not expressed in WT MDA-MB-231 cells, which is consistent with the results of previous studies (39,40); and was not increased following BECN1-knockout, but there was a significant decrease in N-cadherin expression following BECN1-knockout. Another mesenchymal marker is Vimentin, which is associated with cancer invasion and a poor prognosis in various types of cancer (41). In accordance with the change in N-cadherin expression, Vimentin expression was also downregulated following BECN1-knockout. Claudin-1 belongs to the transmembrane protein family, is regarded as the backbone of tight junctions and is associated with tumor metastasis (42). However, the definitive role of Claudin-1 in TNBC is controversial. In patients with TNBC, the Claudin1-negative phenotype predicts a high risk of recurrence and death, which suggested an antitumor function of Claudin-1 (43). However, silencing Claudin-1 expression using shRNA inhibits the migration and invasion of MDA-MB-231 cells (44). In the present study, Claudin-1 expression increased following BECN1-knockout in MDA-MB-231 cells, which may be associated with inhibition of Snail and subsequent transcriptional repression of Claudin-1 (45). Therefore, the decreased migration and invasion capability following BECN1-knockout could be explained by a partial EMT reversal of MDA-MB-231 cells.

Although previous reports indicated that breast cancer harbors frequent allelic deletions and decreased expression of BECN1 (6,7,46,47), Laddha et al (48) reported that there were no changes in the RNA level of BECN1 in invasive breast carcinoma tissues, compared with normal tissues. The present study demonstrated that BECN1 was upregulated in TNBC tissue samples, compared with adjacent normal stromal tissues and normal breast tissues. Similar expression patterns have been reported in ovarian cancer (49–51), gastric cancer (52–54) and hepatocellular carcinoma (55,56). Correa et al (49) demonstrated that even with prevalent single-copy loss, BECN1 protein expression remained similar in high-grade serous ovarian cancer. BECN1 expression is increased in ovarian cancer compared with benign tumor and normal ovary tissues (50). However, Shen et al (51) observed that expression of BECN1 is reduced in ovarian cancer, compared with benign and borderline ovarian tumors. In addition, Fei et al (54) reported that BECN1 expression in early-stage gastric cancer is significantly higher, while in late-stage cases levels were lower than in adjacent normal tissues (54). These seemingly controversial results may be explained by tumor heterogeneity and the biphasic function of BECN1 in cancer development.

In conclusion, BECN1-knockout TNBC cell lines were established using the CRISPR/Cas9 system. The results indicated that increased BECN1 activates numerous properties that are associated with the malignant potential in TNBC cells, including proliferation, colony formation, cell cycle progression, migration, invasion and a partial EMT.

Abbreviations:

Acknowledgments

The authors would like to thank Dr Pu-Min Zhang (Beijing Proteome Research Center, Beijing, China) for providing the CRISPR/Cas9 plasmid.

References