Open Access

IGJ suppresses breast cancer growth and metastasis by inhibiting EMT via the NF‑κB signaling pathway

  • Authors:
    • Mengxue Wang
    • Yushen Wu
    • Xunjia Li
    • Meng Dai
    • Shengwei Li
  • View Affiliations

  • Published online on: July 31, 2023     https://doi.org/10.3892/ijo.2023.5553
  • Article Number: 105
  • Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Breast cancer metastasis is the primary cause of mortality of patients with breast cancer. The present study aimed to explore the role and underlying mechanisms of IGJ in the invasion and metastasis of breast cancer. The Cancer Genome Atlas database was utilized to analyze the differential gene expression profiles in patients with breast cancer with or without metastasis; the target gene, joining chain of multimeric IgA and IgM (JCHAIN, also known as IGJ, as referred to herein), with significant expression and with prognostic value was screened. The expression levels of IGJ in human breast cancer paired tissues and cell lines were detected using reverse transcription‑quantitative PCR and western blot analysis. IGJ differential expression was detected in paired human breast cancer tissues using immunohistochemistry. The role of IGJ in breast cancer was verified using CCK‑8, invasion and migration assays, and scratch tests in vivo and in vitro. Further exploration of the role and mechanism of IGJ in breast cancer was conducted through Gene Set Enrichment Analysis, Kyoto Encyclopedia of Genes and Genomes analysis, western blot analysis and immunofluorescence experiments. Through the analysis of gene expression profiles, it was found that IGJ was poorly expressed in patients with breast cancer with metastasis compared to patients with non‑metastatic breast cancer. The overexpression of IGJ was associated with an improved distant metastasis‑free survival and overall survival (OS). COX multivariate regression analysis demonstrated that IGJ was an independent prognostic factor for the OS and relapse‑free survival of patients with breast cancer. In comparison to healthy breast cancer adjacent tissues and cell lines, IGJ was poorly expressed in breast cancer tissues and cell lines (P<0.05). Further analyses indicated that the overexpression of IGJ suppressed the proliferation, invasion and metastasis of breast cancer cells in vivo and in vitro by inhibiting the occurrence of epithelial‑to‑mesenchymal transition (EMT) and suppressing the nuclear translocation of p65. Finally, rescue experiments indicated that IGJ restricted the proliferation and metastasis of breast cancer cells by regulating the NF‑κB signaling pathway. On the whole, the present study demonstrates that IGJ suppresses the invasion and metastasis of breast cancer by inhibiting both the occurrence of EMT and the NF‑κB signaling pathway. These findings may provide novel biomarkers and potential therapeutic targets for the treatment of metastatic breast cancer.

Introduction

Breast cancer is the most prevalent malignancy affecting women worldwide, also ranking as the primary cause of cancer-related mortality among them (1). In spite of standardized comprehensive treatment for patients with early-stage breast cancer, ~20-30% of patients experience fatal distant recurrence and metastasis (2). The vast majority (~90%) of breast cancer-related deaths are due to distant metastasis (3). Therefore, breast cancer metastasis is the main reason affecting the prognosis of patients with breast cancer and the major challenge of breast cancer treatment. In primary tumors, epithelial-to-mesenchymal transition (EMT) plays a critical role in tumor cell invasion of the vascular system and the induction of proteases that degrade the extracellular matrix (4). EMT results in changes in cell surface structure, and leads to an increased invasive ability and a weakened adhesive ability. With EMT, the expression of the epithelial marker, E-cadherin, decreases, while that of the markers of interstitial cell phenotypes, N-cadherin and Vimentin, increases (5,6). Moreover, cells become spindle-shaped, intercellular adhesion weakens, and the movement and mobility of the cells are enhanced. Subsequently, the cells travel via the bloodstream to distant organs, gradually revert back to their original shape, and proliferate to form metastatic tumors (7).

The joining chain of multimeric IgA and IgM (JCHAIN, also known as IGJ, as referred to herein) gene is located on 4q13.3 and the translated protein is J chain (8). IGJ protein is composed of 159 amino acid residues with a molecular weight of ~15 kDa. Previous research has indicated that the J chain is involved in the formation of dimer IgA and multimer IgM, promoting their binding to secretory components and regulating the transport process of secretory immunoglobulins (dimer IgA and pentamer IgM) to realize exocytosis (9). The expression of the IGJ gene is accompanied by the differentiation and development of B- and T-lymphocytes, particularly after B cells differentiate into plasma cells, and the J chain is highly expressed with the production of immunoglobulin (10). In addition, IGJ protein can also be detected in dendritic cells, intestinal epithelial cells, endometrial cells and mammary epithelial cells (10). Given that the IGJ gene is expressed not only in immunoglobulin-secreting cells, but also in some non-immunoglobulin-secreting cells, the biological function of the J chain may extend beyond polymerized immunoglobulins (8,10). The expression of the IGJ gene is known to vary across various pathological conditions, with significant transcription changes in certain infectious diseases, autoimmune diseases and hematological tumors (11-13). In patients with acute B lymphoblastic leukemia, a high expression of IGJ indicates a poor disease-free survival and overall survival (OS) (13). The transcription level of IGJ in lung squamous cell carcinoma, adenocarcinoma tissues and gastric cancer has been found to be markedly lower than that in normal tissues (14,15). Some breast cancer prognostic prediction studies have found that IGJ exhibits a high accuracy in distinguishing breast cancer tissue from normal breast tissue, and that high levels of IGJ are associated with an improvised prognosis of patients with breast cancer, suggesting that IGJ may be utilized as a biomarker for breast cancer (16-19).

However, research on IGJ remains limited to a superficial level in malignant tumors, and its potential biological function and mechanisms underlying its involvement in malignant tumor occurrence and development remain unclear.

The present study aimed to identify novel therapeutic targets that can potentially inhibit breast cancer metastasis and increase the survival rates of patients. Through the investigation of genes that can promote or hinder tumor metastasis in breast cancer, the present study attempted to identify IGJ as the main target gene. It was hypothesized that IGJ may be an independent prognostic factor in breast cancer by inhibiting tumor metastasis and the EMT process. Verification assays were conducted to examine this hypothesis at the cellular level and to investigate whether the overexpression of IGJ is effective in suppressing the proliferation, migration, invasion and EMT process of breast cancer cell lines. Further experiments were conducted using nude mice to verify whether IGJ can inhibit breast cancer tumor growth.

Materials and methods

The Cancer Genome Atlas (TCGA) Chip data and Kaplan-Meier survival analysis

The TCGA high-throughput sequencing data for breast cancer were downloaded from the UCSC database (version 2015-02-24; available at https://genome.ucsc.edu/). To investigate the clinical relevance of IGJ, 991 patients with breast cancer from the TCGA database were included, whose RNA-seq data and clinical information were complete. The information included age, tumor size, lymph node metastasis, tumor size, tumor stage (TNM), estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2) and follow-up information. Kaplan-Meier analysis (http://kmplot.com/analysis/) was applied to analyze the association between IGJ expression and the prognosis of patients with breast cancer using the dataset from the study by Győrffy (20).

Differential gene screening

Differential gene analysis was performed for bone and lung metastasis. Statistical analyses were performed using R software 3.5.1 and DEseq, an R language package. An adjusted P-value <0.05 and a fold change >2 were considered to indicate statistically significant differences, and the difference in gene expression was regarded as significant between the experimental and the control groups.

Propensity score matching (PSM)

To eliminate the difference in clinical baseline characteristics and selection bias between the metastatic group and the non-metastatic group, PSM was conducted for eight variables: Sex, age, tumor size, lymph node metastasis, ER, PR, HER2 and histological type. SPSS 25.0 software (IBM Corp.) was used to calculate individual PSM, randomly matching at a 1:1 ratio with a caliper value set to 0.05.

Clinical tissue samples

A total of 32 pairs of breast cancer tissues and adjacent normal tissues were collected from patients that underwent breast cancer resection at the First Affiliated Hospital of Chongqing Medical University (Chongqing, China) between 2014 and 2016. Moreover, 28 pairs of breast cancer tissues and normal tissues were collected from patients with breast cancer metastasis at follow-up. The collected tissues were used for reverse transcription-quantitative PCR (RT-qPCR) and immunohistochemistry (IHC), which were performed as described below. All specimens collected were preserved in liquid nitrogen. The collection and use of the tissues were approved by the Institutional Ethics Committee of the First Affiliated Hospital of Chongqing Medical University (approval no. 2017-012) and written informed consent was signed by the patients.

Cell lines

Healthy mammary epithelial cells (MCF-10A) and human breast cancer cells (T47D, YCC-B1, MDA-MB-231, MCF-7, SK-BR-3, ZR-75-1 and BT-549) were used in the present study. The YCC-B1 cell line was kindly provided as a gift from Professor Qian Tao at The Chinese University of Hong Kong (Hong Kong, SAR, China) and authenticated using short tandem repeat profiling. All other cell lines were obtained from the American Type Culture Collection (ATCC) cell bank (MCF-10A: cat. no. CRL-10317; TC7D: cat. no. HTB-133; MDA-MB-231: cat. no. HTB-26; MFC-7: cat. no. HTB-22; SK-BR-3: cat. no. HTB-30; ZR-75-1: cat. no. CRL-1500; BT-549: cat. no. HTB-122). The breast cancer cell lines were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin. MCF-10A cells were cultured in DMEM/F12 (Gibco; Thermo Fisher Scientific, Inc.) containing 20 ng/ml EGF (Beijing Solarbio Science & Technology Co., Ltd.), 0.5 µg/ml hydro-cortisone, 10 µg/ml insulin, and 1% penicillin-streptomycin. All cells were in a cell incubator at 37°C with 5% CO2.

Cell transfection

The control plasmids (vector) and IGJ overexpression plasmids were obtained from Hanbio Biotechnology Co., Ltd. Lipofectamine 2000® (Invitrogen; Thermo Fisher Scientific, Inc.) was used to transfect the MDA-MB-231 and YCC-B1 cells. Subsequently, lipopolysaccharide (LPS; 10 µg/ml; cat. no. L8880, Beijing Solarbio Science & Technology Co., Ltd.) was added to the vector- and IGJ-treated cells, respectively. The cells were cultured for 48 h following transfection and then collected for use in subsequent experiments.

RNA isolation and RT-qPCR

As previously described (21), TRIzol® reagent (Thermo Fisher Scientific, Inc.) we used to extract total RNA following the manufacturer's instructions. The RT reaction was performed using the RT reagent kit (cat. no. RR047A; Takara Bio, Inc.), and the reaction conditions were 15 min at 37°C and 5 sec at 85°C. RT-qPCR (cat. no. RR820A; Takara Bio, Inc.) was performed to detect IGJ expression on 32 pairs of tissues using an ABI 7500 real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The RT-qPCR reaction conditions were set as follows: 95°C for 30 sec, 40 cycles at 95°C for 3 sec, and 60°C for 30 sec. The relative quantification of IGJ mRNA expression was normalized to the GAPDH expression level using the 2−ΔΔCq method (22). The primer pairs used in the present study are listed in Table I.

Table I

Primer sequences used in the present study.

Table I

Primer sequences used in the present study.

GeneForward sequence (5′ end to 3′ end)Reverse sequence (5′ end to 3′ end)
IGJ TCCTGGCGGTTTTTATTAAGGC AGTAATCCGGGCACACTTACAT
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

[i] IGJ, joining chain of multimeric IgA and IgM (JCHAIN).

Western blot analysis

Breast cancer cells were collected and lysed in a pre-cooled RIPA lysis buffer (Beyotime Institute of Biotechnology) for 20 min. The mixture was then centrifuged at high speed for 20 min at a minimal 17,383 × g, at 4°C. Following centrifugation, the supernatant was collected and the protein concentration was quantified using a BCA protein assay kit (Wuhan Boster Biological Technology, Ltd.), and the protein sample was boiled and denatured at 100°C. Electrophoresis separation was performed using 6 or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Beyotime Institute of Biotechnology), and the protein was then transferred to a polyvinylidene fluoride (PVDF) membrane (MilliporeSigma). The membrane was blocked using 5% skim milk for 2 h at room temperature. Subsequently, diluted primary antibodies were added for protein culture overnight at 4°C. Additionally, the membrane was washed three times using TBST, for 3 min each time. Subsequently, a diluted secondary antibody was added and the membrane was cultured at room temperature for 40 min, and the membrane was then rinsed with TBST three times, for 3 min each time. Protein bands were developed using an enhanced chemiluminescence (ECL) kit (Beyotime Institute of Biotechnology). GAPDH was used as an endogenous control. The primary antibodies used were the following: IGJ (1:1,000; cat. no. ab269855), β-actin (1:1,000; cat. no. ab8226) (both from Abcam), E-cadherin (1:1,000; cat. no. 14472), N-cadherin (1:1,000; cat. no. 13116), Vimentin (1:1,000; cat. no. 5741), Claudin-1 (1:1,000; cat. no. 13255), matrix metalloproteinase (MMP)9 (1:1,000; cat. no. 13667s), MMP7 (1:1,000; cat. no. 3801), p65 (1:1,000; cat. no. 8242), phosphorylated (p-)-p65 (Ser536; 1:1,000; cat. no. 3033), IκBα (1:1,000; cat. no. 4818), p-IκBα (Ser32; 1:1,000; cat. no. 5209), proliferating cell nuclear antigen (PCNA; 1:1,000; cat. no. 13110), and GAPDH (1:1,000; cat. no. 51332) (all from Cell Signaling Technology, Inc.). The secondary antibodies used were the following: Rabbit secondary antibody (1:4,000; cat. no. 7074) and mouse secondary antibody (1:4,000; cat. no. 7076) (both from Cell Signaling Technology, Inc.).

IHC

The procedures to conduct IHC followed the description of previous studies (21,23). The samples underwent formalin fixation and paraffin embedding before being sliced into 4-µm-thick sections and mounted onto glass slides. IHC was performed on the slides following deparaffinization and rehydration with xylene and a graded ethanol series for 0.5 h. Antigen retrieval was carried out by microwaving the samples in a sodium citrate-hydrochloric acid buffer solution at 95°C for 20 min. To block endogenous horseradish peroxidase activity, the sections were then treated with 3% hydrogen peroxide and subsequently washed with phosphate-buffered saline (PBS) three times. Normal goat serum was applied to the sections as a blocking agent at 25°C for 30 min. The anti-IGJ rabbit polyclonal antibody (1:100; cat. no. ab105229, Abcam) or Ki-67 mouse monoclonal antibody (1:1,000, cat. no. 9449, Cell Signaling Technology, Inc.) was added to the sections, followed by overnight incubation at 4°C. Another round of PBS washing preceded incubation with goat anti-rabbit HRP secondary antibody (1:100; cat. no. SPN9001, OriGene Technologies, Inc.). After washing, the sections were treated with streptavidin-biotin-conjugated horseradish peroxidase (HRP), which was followed by visualization of signals using diaminobenzidine. Hematoxylin (cat. no. G1004, Wuhan Servicebio Technology Co., Ltd.) was applied to counterstain the sections at 25°C for 1 min. A total of 28 pairs of tissues were subjected to IHC. IHC staining scores were used to indicate the intensity of staining: 0 represents no staining, 1 represents weak staining, 2 represents moderate staining, and 3 represents strong staining. The scores for determining the proportion of positive tumor cells were 0, <5%; 1, 5-25%; 2, 26-50%; 3, 51-75%; and 4, >75%. The total score was calculated by multiplying the intensity scores and the percentage scores.

Immunofluorescence (IF) staining

The tumor tissue sections were boiled in citrate antigen retrieval solution (P0081, Beyotime Institute of Biotechnology) for 30 min. Subsequently, 0.5% Triton X-100 (cat. no. T8200, Beijing Solarbio Science & Technology Co., Ltd.) was added to the sections, followed by a 30-min incubation at room temperature. The sections were blocked with goat serum (cat. no. 16210064, Thermo Fisher Scientific, Inc.) at 25°C for 30 min. The sections were then incubated overnight at 4°C with E-cadherin (1:200; cat. no. 14472) or Vimentin (1:100; cat. no. 5741) antibodies (both from Cell Signaling Technology, Inc.). After washing with PBS, the sections were incubated at 25°C in the dark for 1.5 h with Cy3 goat anti-rabbit IgG (1:50; cat. no. AS007) and FITC goat anti-rabbit IgG (1:50; cat. no. AS011) antibodies (both from ABclonal Technology Co., Ltd.). DAPI (cat. no. C1005, Beyotime Institute of Biotechnology) was then added to the sections and incubated in the dark for 5 min. The excess DAPI was washed away with PBS, and the sections were mounted using an anti-fade mounting medium (cat. no. P0126, Beyotime Institute of Biotechnology) to prevent fluorescence quenching. Finally, the sections were observed and photographed under an inverted fluorescent microscope [ICX41, Sunny Optical Technology (Group) Co Ltd.].

Cell Counting Kit-8 (CCK-8) assay

The cells in each group were collected in the logarithmic phase to prepare a single-cell suspension and cell density was adjusted after cell count calculation. The cells were then inoculated into 96-well plates (1×103 cells/well) and 10 µl CCK-8 reagent (Beyotime Institute of Biotechnology) was dripped into each well on days 1, 2 and 3, respectively. At 1 h following incubation at 37°C, the absorbance of each well was measured at 450 nm wavelength using a xMark™ microplate spectrometer (Bench markPlus™ system, Bio-Rad Laboratories, Inc.). After 3 days, the cell proliferation curve was plotted based on the absorbance value.

Transwell assay

A Transwell chamber (MilliporeSigma) was used for the Transwell assays. The chamber for detecting cell invasion was covered with a layer of Matrigel (MilliporeSigma) and air-dried overnight. After the cells were resuspended in a serum-free medium at 1×105 cells/ml, 200 µl of the breast cancer cell suspension were added to the upper chamber, and 600 µl medium containing 10% FBS was added to the lower chamber. Following 24 h of culture, the upper chamber was removed, and the cells were fixed with 4% paraformaldehyde at 25°C for 20 min and stained with a 0.1% crystal violet solution (cat. no. DZ0055, Leagene Biotechnology) at 25°C for 20 min. Additionally, after being washed with PBS three times, the cells remaining on the surface of the membrane were wiped off using a wet swab. The cells were subsequently counted under an inverted fluorescent microscope [ICX41, Sunny Optical Technology (Group) Co Ltd.].

Scratch test

The cells were seeded into six-well plates (5×106/well). When the plate was fully grown with cells, a straight line was marked using the tip of a sterile 200-µl pipette to create a direct scratch between the fused monolayer cells. The cells were then gently rinsed with a serum-free medium and scratched three times, and the scratches were observed and photographed under an inverted fluorescent microscope [0 h; ICX41, Sunny Optical Technology (Group) Co Ltd.]. Subsequently, the cells were cultured in a serum-free medium for 24 h, observed the scratches again, and photographed under an inverted fluorescent microscope [ICX41, Sunny Optical Technology (Group) Co Ltd.]. The healing of the scratches in each group indicated the migratory ability of the cells in each group.

Animal experiments

Healthy female BALB/c nude mice (4 weeks old, n=20) were purchased from Chongqing Ensiweier Biological Co., Ltd. The mice were raised in a pathogen-free environment with a temperature of 25°C and a humidity range of 50 to 60%, and had free access to food and water. The nude mice were randomly divided into a control group and an IGJ overexpression group (n=10 per group). The MDA-MB-231 cells were subcutaneously injected into the right inguinal region or caudal vein as the control group. The tumor volume of the right inguinal region was measured, and the mouse body weights were assessed every 3 days for 5 consecutive weeks. After 30 days, 10 nude mice that had developed tumors in the right inguinal region were administered anesthesia by the intraperitoneal injection of 100 mg/kg ketamine and 5 mg/kg valium. Once it was confirmed that the anesthesia had taken effect, the mice were euthanized by an intraperitoneal injection of an overdose of pentobarbital sodium (200 mg/kg). Tumor tissues were then collected for weight and volume measurements. On day 33, the remaining 10 nude mice with tumors in the caudal vein were anesthetized by gas inhalation (2% isoflurane at 0.4 l/min gas flow) and photographed under a real-time imager (IVIS Lumina III, PerkinElmer, Inc.). Some tumor tissue samples were fixed in 4% paraformaldehyde at 25°C for 24 h, and then stained with hematoxylin and eosin (H&E) at 25°C for 5 min, while the remaining tissues were stored at -80°C for further use. All experimental procedures were approved by the Animal Ethics Committee of Chongqing Medical University (approval no. 2022-K121).

Gene Set Enrichment Analysis (GSEA)

GSEA (http://software.broadinstitute.org/gsea) was applied to analyze the association between IGJ expression and biological processes/Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways according to the instructions of users. The microarray data set was GSE1456 and the gene set (c2 all.v6.0 symbols.gmt) for analyses was obtained from the Molecular Signatures Database (http://software.broadinstitute.org/gsea/msigdb/index.jsp). A false discovery rate (FDR) <0.25 and a P-value <0.05 were considered to indicate statistically significant differences.

Statistical analysis

All statistical analyses were performed using GraphPad Prism (version 8.0; Dotmatics) or SPSS software (Version 23.0; IBM Corp.). Cox regression analysis was used to estimate the association between IGJ expression and the prognosis [OS and distant metastasis-free survival (DMFS)] of patients with breast cancer. An unpaired Student's t-test was used to evaluate the difference between the two groups. One-way ANOVA with post hoc analysis using Tukey's test was used for comparisons between multiple groups. The Chi-squared test or Fisher's test was used to evaluate the significance between categorical data, and the non-parametric Mann-Whitney U test (Wilcoxon rank-sum test) was used to analyze the continuous data. A P-value <0.05 was considered significant to indicate a statistically significant difference.

Results

Screening of genes closely related to metastasis in patients with breast cancer

Through TCGA analysis, the high-throughput RNA sequencing data were obtained and 30 patients with non-metastatic breast cancer at diagnosis who had developed confirmed bone and lung metastasis during follow-up (21 with bone metastasis and 9 with lung metastasis) were screened. Subsequently, PSM was performed on these patients with breast cancer and those with breast cancer without metastasis at diagnosis and who developed no distant metastasis during the follow-up period (>5 years) according to clinical characteristics, such as age and tumor size (Fig. 1). No significant difference in was observed in the clinical characteristics between the two groups after matching (Table II). Subsequently, the differential genes between the metastatic and non-metastatic patients were analyzed. Through differential gene analysis, there were 587 differential genes in the bone metastasis group and 439 differential genes in the lung metastasis group. When analyzing the differential genes between the metastatic and non-metastatic groups, the bone metastasis group and the lung metastasis group simultaneously included 23 downregulated genes and one upregulated gene (Fig. 2A-C). The Kaplan-Meier plotter database was employed to verify the association between the expression of these 24 genes and the prognosis of patients with breast cancer. Among the downregulated genes in the metastasis group, 13 genes (IGJ, ADAM6, POU2AF1, CD38, LAX1, SLAMF7, TNFRSF17, ZNF238, GBP4, CCR2, STAP1, MEI1 and IFNG) were associated with DMFS. Furthermore, the high expression of such genes indicated an improved OS (Table III). The high expression of IGJ was closely associated with an improved DMFS [hazard ratio (HR), 0.69; 95% confidence interval (CI), 0.59-0.81; P<0.001] and OS (HR, 0.55; 95% CI, 0.46-0.67, P<0.001) (Fig. 2D and E), and IGJ was determined as the target gene in the present study. The clinical association between IGJ and breast cancer in 991 patients with breast cancer was further analyzed in TCGA database; this revealed that IGJ expression was associated with age (P<0.001), lymph node metastasis (P<0.001) and ER status (P=0.027) (Table IV). Multivariate Cox regression analyses revealed that IGJ was an independent prognostic factor for OS (HR, 0.59; 95% CI, 0.421-0.866, P=0.007) and relapse-free survival (HR, 0.651; 95% CI, 0.461-0.837, P<0.001) in breast cancer (Table V).

Table II

Baseline characteristics of metastatic and non-metastatic patients following propensity score matching.

Table II

Baseline characteristics of metastatic and non-metastatic patients following propensity score matching.

CharacteristicsCohort 1
Cohort 2
Non-metastasisBone metastasisP-valueNon-metastasisLung metastasisP-value
Sex/female, n21210.999990.999
Age, median (range), years54 (29-85)56 (39-85)NA54 (42-62)52 (49-69)NA
Pathologic tumor size
 T1640.8002NA
 T271086
 T37611
 T41100
Pathologic lymph node status
 Negative460.72530.64
 Positive171546
ER status
 Negative16180.70560.999
 Positive5343
PR status
 Negative13150.74560.999
 Positive8643
HER2
 Negative420.66880.999
 Positive171911
Histological type
 IDC15120.61660.55
 ILD3401
 Other3532

[i] A Chi-squared test or Fisher's test was used to analyze the categorical data, and the non-parametric Mann-Whitney U rank sum test was used to analyze the continuous data. P<0.05 was considered to indicate a statistically significant difference. PMS, propensity score matching; IDC, infiltrating ductal carcinoma; ILD, infiltrating lobular carcinoma; ER, estrogen receptor; PR, progesterone receptor; HER2, human epidermal growth factor receptor 2; NA, not available.

Table III

The association between the 24 differentially expressed genes and breast cancer prognosis.\

Table III

The association between the 24 differentially expressed genes and breast cancer prognosis.\

Gene symbolProbe IDDMFS
OS
HR95% CILog-rank P-valueHR95% CILog-rank P-value
Downregulated
 IGJ212592_at0.660.54-0.81<0.0010.560.45-0.69<0.001
 LOC96610NA
 ADAM6237909_at0.580.40-0.830.0030.720.52-1.000.048
 FCRL5224406_s_at0.710.49-1.030.0720.620.44-0.870.006
 IDO1210029_at1.291.02-1.630.0360.810.65-1.000.053
 POU2AF1205267_at0.750.61-0.920.0050.720.58-0.900.004
 CD38205692_s_at0.750.60-0.950.0150.730.58-0.920.007
 LAX1207734_at0.740.60-0.900.0030.690.54-0.870.001
 C8orf80NA
 SLAMF7222838_at0.640.44-0.950.0250.530.37-0.75<0.001
 CXCL10204533_at1.341.09-1.650.0050.760.60-0.980.030
 TNFRSF17206641_at0.600.47-0.77<0.0010.670.54-0.83<0.001
 ZNF238212774_at0.660.54-0.80<0.0010.600.48-0.74<0.001
 ELOVL7227180_at1.250.89-1.770.2000.820.60-1.120.220
 GBP4235175_at0.680.48-0.970.0310.520.38-0.71<0.001
 ERAP2227462_at0.740.53-1.030.0750.670.48-0.930.017
 CCR2207794_at0.780.62-0.970.0280.640.52-0.79<0.001
 KCNA3207237_at0.80.63-1.010.0640.830.64-1.070.142
 AMPD1206121_at0.820.65-1.040.1060.800.64-0.990.040
 LOC400759NA
 STAP11554343_a_at0.670.46-0.970.0320.630.45-0.870.005
 MEI1230011_at0.660.43-0.990.0430.580.43-0.80<0.001
 IFNG210354_at0.760.63-0.930.0060.660.53-0.82<0.001
Upregulated
 DSCAML1234908_s_at1.360.97-1.900.0721.731.23-2.430.002

[i] DMFS, distant metastasis free survival; OS, overall survival; HR, hazard ratio; NA, not available. P<0.05 was considered to indicate a statistically significant difference.

Table IV

TCGA clinical correlation analysis of patients with breast cancer.

Table IV

TCGA clinical correlation analysis of patients with breast cancer.

CharacteristicNo. of casesHigh (n)Low (n)P-value
Age, years
 <50280179101<0.001
 ≥50711368343
Tumor size
 T12661591070.087
 T2577309268
 T31196851
 T4291118
Lymph node metastasis
 Negative474226248<0.001
 Positive517321196
TNM stage
 I179109700.12
 II575306269
 III22512897
 IV1248
ER
 Positive7694103590.027
 Negative22213785
PR
 Positive6723673050.592
 Negative319180139
HER2
 Positive202107950.476
 Negative789440349
Triple-negative breast cancer
 Yes166100660.152
 No825447378

[i] A Chi-squared test was used to analyze the categorical data, and the non-parametric Mann-Whitney U rank sum test was used to analyze the continuous data (tumor size and TMN stage). P<0.05 was considered to indicate a statistically significant difference. TCGA, The Cancer Genome Atlas; IGJ, joining chain of multimeric IgA and IgM (JCHAIN); ER, estrogen receptor, PR, progesterone receptor; HER2, human epidermal growth factor receptor 2.

Table V

Univariate and multivariate COX regression analysis of IGJ in the TCGA cohort.

Table V

Univariate and multivariate COX regression analysis of IGJ in the TCGA cohort.

VariantOS
RFS
Univariate analysis
Multivariate analysis
Univariate analysis
Multivariate analysis
HR95% CIP-valueHR95% CIP-valueHR95% CIP-valueHR95% CIP-value
Age, years (<50 vs. ≥50)0.6750.463-0.9240.0310.5540.269-0.9040.0270.7830.442-0.9130.0440.7580.422-1.5110.21
Tumor size (T1/T2 vs. T3/T4)0.9140.593-1.3800.4640.8640.322-1.3480.232
Lymph node (N0 vs. N1/N2/N3)0.4760.345-0.8630.0010.6730.414-1.0310.8730.6980.343-1.3210.317
TNM stage (I/II vs. III/IV)0.6820.311-0.1.1320.0650.5480.332-0.8040.0010.54970.347-0.8430.011
ER (negative vs. positive)1.2740.883-1.6140.1741.1260.532-1.8950.743
PR (negative vs. positive)1.1630.715-1.3310.7630.9940.416-1.7690.897
HER2 (negative vs. positive)1.480.945-2.3170.0861.2030.678-2.8750.512
IGJ (high vs. low)0.620.423-0.9060.0140.590.421-0.8660.0070.6340.412-0.8580.0210.6510.461-0.8370.001

[i] P<0.05 was considered to indicate a statistically significant difference. TCGA, The Cancer Genome Atlas; IGJ, joining chain of multimeric IgA and IgM (JCHAIN); ER, estrogen receptor; PR, progesterone receptor; HER2, human epidermal growth factor receptor 2; OS, overall survival; RFS, relapse-free survival; HR, hazard ratio; CI, confidence interval.

Expression of IGJ in breast cancer

The present study first analyzed the expression of IGJ in breast cancer patients in TCGA database, which indicated that IGJ had the highest expression in adjacent tissues, but the lowest in metastatic breast cancer (Fig. 3A). In 114 cases of breast cancer in TCGA, the expression of IGJ in normal tissues was markedly higher than that in cancer tissues (Fig. 3B). Moreover, through the expression analyses of 32 pairs of normal breast tissues and paired cancer tissues collected from patients for the present study, the expression of IGJ in normal tissues was markedly higher than that in cancer tissues (Fig. 3C). IGJ mRNA and protein expression in the normal breast epithelial cell line, MCF-10A, was markedly higher than that in breast cancer cells (Fig. 3D and E). Furthermore, the pathological section analysis of 28 pairs of breast cancer using IHC revealed that IGJ had the highest expression in normal tissues, whereas it had the lowest expression in breast cancer (Fig. 3F), suggesting that IGJ functions as a tumor suppressor gene in breast cancer.

Overexpression of IGJ inhibits the invasion and metastasis of breast cancer in vitro and in vivo

To explore the biological function of IGJ in breast cancer cells, the MDA-MB-231 and YCC-B1 cells were transfected with synthesized IGJ lentivirus or empty lentivirus vector and verification was conducted (Fig. S1). CCK-8 cell proliferation assay revealed that IGJ overexpression markedly inhibited the proliferation of breast cancer cells (Fig. 4A and C). In addition, Transwell assays revealed that the number of invasive or migratory breast cancer cells following the overexpression of IGJ was markedly reduced compared with the control group (Fig. 4B and D). The wound scratch tests also demonstrated that IGJ evidently inhibited the migration of breast cancer cells (Fig. 4E and F). Through subcutaneous tumorigenesis experiments in nude mice, it was found that compared with the vector group, the tumor size of the stable overexpression IGJ group was markedly smaller (Fig. 5A-D). The IHC detection of the expression of Ki-67 was conducted in the two groups with tumors (Fig. 5E). The in vivo imaging results revealed that the lung metastatic nodules of the nude mice in the IGJ overexpression group were markedly lower in number than those in the control group (Fig. 5F-H). These results indicated that IGJ inhibited the proliferation, invasion and metastasis of breast cancer cells in vivo.

IGJ inhibits EMT in breast cancer

Following GSEA analysis, it was found that the expression of IGJ in breast cancer was negatively associated with the occurrence of EMT (normalized enrichment score, -2.31; Fig. 6A). Since GSEA analysis revealed that IGJ may be associated with EMT, the expression levels of the EMT markers, E-cadherin, N-cadherin, Clautin-1 and vimentin, were detected using western blot analysis. The results obtained confirmed that the overexpression of IGJ increased the expression of E-cadherin and claudin-1, while it decreased that of vimentin, N-cadherin, MMP9 and MMP7, thereby reversing EMT in breast cancer cells (Fig. 6B). Furthermore, additional evidence supporting the inhibitory effects of IGJ on EMT was provided by demonstrating that the overexpression of IGJ reversed EMT in breast cancer cells using IF staining (Fig. 6C).

IGJ regulates the NF-κB signaling pathway

IGJ was verified to be poorly expressed in breast cancer tissues and cells, and it inhibited the growth, invasion and metastasis of breast cancer, as well as the occurrence of EMT in breast cancer. These results suggested that IGJ functions as a tumor suppressor gene in breast cancer; however, the underlying mechanisms remained unclear. Therefore, the mechanisms of IGJ in regulating breast cancer metastasis were further explored. To identify the possible IGJ-related pathways, KEGG analysis was conducted, indicating that the NF-κB signaling pathway may be one of the major enrichment pathways associated with IGJ (Fig. 7A). To determine the role of IGJ in the NF-κB pathway, the expression of the NF-κB pathway-related proteins, p65 and p-p65, were detected using western blot analysis. The overexpression of IGJ decreased the expression of p-p65 and p-IκBα, whereas it increased the expression of IκBα. However, the protein level of p65 was not markedly altered (Fig. 7B). To further reveal the mechanisms underlying the effects of IGJ on the NF-κB signaling pathway, nuclear and cytoplasmic proteins were extracted from IGJ-overexpressing and control cells to detect the expression of p65 using western blot analysis. The results indicated that the overexpression of IGJ markedly inhibited the nuclear accumulation of p65 in the MDA-MB-231 and YCC-B1 cells (Fig. 7C and D). Taken together, these findings indicate that IGJ inhibits the NF-κB signaling pathway by preventing the translocation of p65 into the nucleus.

IGJ inhibits the invasion and metastasis of breast cancer through the NF-κB signaling pathway

The present study demonstrated that IGJ inhibited the proliferation, invasion and metastasis of breast cancer cells, and IGJ was also found to inhibit the activation of the NF-κB signaling pathway. Since the NF-κB signaling pathway has been reported to be essential for the occurrence and development of tumors, it was hypothesized that IGJ inhibited the proliferation, invasion and metastasis of breast cancer cells by mediating the NF-κB pathway. Therefore, the NF-κB pathway agonist, LPS, we applied to conduct rescue experiments. It was found that the overexpression of IGJ markedly inhibited breast cancer cell proliferation following exposure to LPS; however, without LPS, cell proliferation was more markedly inhibited by IGJ overexpression; thus, LPS reduced the suppressive ability of IGJ on breast cancer (Fig. 8B and C). Similarly, Transwell assays revealed that LPS also reduced the ability of IGJ overexpression to inhibit the invasion and metastasis of breast cancer cells (Fig. 8A). These results suggested that IGJ played a role in breast cancer by regulating the NF-κB signaling pathway. Subsequently, the expression of various markers of EMT and protein molecules of the NF-κB signaling pathway was detected (Fig. 8D and E). These results indicated that the activation of the NF-κB signaling pathway was closely related to IGJ gene expression.

Discussion

Tumor metastasis is a complex, multi-step process involving several genes and biomolecules (24). At present, the understanding of the mechanisms underlying breast cancer metastasis is incomplete. A deeper insight into this process is crucial for improving the treatment efficacy in and prognosis of patients with clinical breast cancer. Current strategies for the treatment of breast cancer involve gene-specific, tissue-specific and genome-wide approaches to identify specific genes associated with specific breast cancer types, which can be applied to optimize the treatment of tumors for specific patients (25).

Given that the bone and lungs are the most common metastatic sites for breast cancer, the present study first collected data of breast cancer patients from TCGA database who initially reported no metastasis at diagnosis, but experienced it during follow-up. Moreover, non-metastatic breast cancer patients were matched with a series of clinical features similar to this group of patients. Through differential gene screening, a total of 24 genes with notable changes in expression were identified and IGJ was finally determined as the target gene of the present study via survival analysis. Further analysis revealed that IGJ was poorly expressed in breast cancer tissues and cells. The expression of IGJ was linked to age, lymph node metastasis and ER status. Multivariate COX regression analysis revealed that IGJ functioned as an independent prognostic factor for patients with breast cancer.

The present study also focused on the exploration of the biological role of IGJ in breast cancer. IGJ was revealed to inhibit the proliferation, invasion and metastasis of breast cancer in vitro and in vivo. Furthermore, a negative association was found between IGJ and EMT. A key change in promoting the migration and invasion of breast cancer cells has been recognized as the epithelial-EMT process (24,26). Over the past decade, multiple studies have reported the role of EMT in the invasion and metastasis of breast cancer (27-29). Epithelial cells are characterized by a complete intercellular interaction through adhesion molecules within tight junctions, adhesion junctions, desmosomes and gap junctions (30,31). However, due to various extracellular and tissue-specific EMT-induced signal stimuli, epithelial cells can upregulate EMT-induced transcription factors to coordinate all morphological, cellular and molecular changes during EMT, thereby promoting tumor metastasis (32). The tumor microenvironment plays a crucial role in determining the phenotype of epithelial cancer cells through a series of heterotypic cell signaling molecules. The Wnt, TGF-β and Notch signaling pathways have been identified as important components of the process of EMT (33). As research on the role of EMT in tumors continues to progress, its occurrence process and mechanisms have been gradually elucidated. In addition to the previously described classical pathways, certain growth factors, including epidermal growth factor, insulin growth factor, hepatocyte growth factor, fibroblast growth factor and platelet-derived growth factor have also been found to trigger the EMT program (33-35). Moreover, it has been indicated that hypoxia-inducible factor 1α, inflammatory signals (NF-κB) and cytokines (IL-1β), and TNFα also induce the occurrence of EMT (36). Such pathways and cytokines act together in the occurrence of EMT in tumors. The occurrence and development of EMT in cancer cells may be regulated by numerous factors. Breast cancer cells may respond differently to signals from different pathways that cause EMT depending on their phenotypic status (35). Studies have indicated that triple-negative breast cancer cells can respond quickly to signals that induce EMT, particularly those transmitted by TGF-β (37,38). However, epithelial cancer cells of luminal breast cancer do not respond to the same EMT-induced signal and maintain the same state. The successful induction of EMT requires appropriate signaling and responsive target cells (39). Conversely, this suggests that the response of tumor cells to EMT-induced signals is applicable for the prediction of the future biological behavior of tumor cells at early stages of carcinogenesis (39,40). MMP is a type of protease, which has a number of biological functions in the development and progression of cancer (41). MMP9, also known as gelatinase B, plays a crucial role in extracellular matrix remodeling and protein cleavage, involving tumor invasion, metastasis, and the regulation of the tumor microenvironment (42). MMP9 is capable of breaking down collagen, and promoting migration, invasion and metastasis in basement membrane degradation (43). MMP7 is a secreted zinc and calcium dependent endopeptidase that is one of the most important downstream target genes of the Wnt/β-catenin signaling transduction. Its expression is associated with the poor prognosis of patients with breast cancer (43,44).

The present study discovered that IGJ was closely related to the NF-κB pathway and the expression of proteins p65 and p-p65 related to the NF-κB pathway was determined using western blot analysis. The results revealed that the overexpression of IGJ decreased the expression of p-p65 and p-IκBα, whereas it increased the expression of IκBα. The overexpression of IGJ markedly inhibited the nuclear accumulation of p65 in the MDA-MB-231 and YCC-B1 cells. NF-κB is one of the most complex transcription factors, consisting of five subunits (p50, p52, RelA, RelB and c-Rel), NF-κB inhibitor family (IκBs) and upstream activated kinase complex (IKKα, IKKβ and IKKγ)/NEMO (45,46). Normally, NF-κB forms heterodimers or homodimers isolated by IκB in the cytoplasm during the quiescent phase. Upon stimulation, IκB is phosphorylated by upstream kinases and is degraded through the ubiquitination-proteasome pathway, thereby releasing the active NF-κB dimer to regulate gene transcription inside the nucleus (47,48). Among several key factors in the progression of EMT, the NF-κB signaling pathway is a crucial factor in mediating the inflammatory process, and manipulating the occurrence and development of breast cancer (33). In this process, NF-κB may induce transcription factors SNAIL, TWIST and ZEB2 to enhance the occurrence of EMT and tumor metastasis (48-50). Several factors such as TGF-β1, ROS and TNF-α and hypoxia can also induce EMT in vitro and in vivo. EMT plays a role in AKT/GSK or NF-κB-mediated Snail expression, and promotes invasion and migration in various types of cancer, including breast, kidney and colon cancer (51,52). The loss of E-cadherin, a known adhesive cell surface protein expressed in epithelial cells, is the major feature of EMT (53). The key transcription factors, Snail and Slug, downregulate E-cadherin expression by binding to the E-box in the E-cadherin promoter, leading to the upregulation of MMP9 expression and the promotion of cell invasion (54).

Taken together, the present study demonstrated that IGJ suppressed the invasion and metastasis of breast cancer by inhibiting the occurrence of EMT and the NF-κB signaling pathway. These findings may provide novel biomarkers and therapeutic targets for the treatment of metastatic breast cancer.

While the present study provides valuable insight into breast cancer metastasis and the tole of IGJ, it is important to acknowledge certain limitations. Firstly, the present study was primarily based on bioinformatics analyses and in vitro experiments, which may not fully reflect the complex biological processes that occur in the human body. To confirm the therapeutic potential of IGJ as a target for breast cancer treatment, further in vivo experiments and clinical trials are warranted. Secondly, the sample size of the study was relatively small, and the tissue samples were all collected from a single center. The replication of these findings in larger and more diverse cohorts is crucial to ensure the generalizability of the results and their applicability to a broader population.

Supplementary Data

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

MW and SL conceptualized the study. MW, YW, XL and MD carried out the formal analysis and investigations. MW wrote the original draft of the manuscript. MW, YW, and SL wrote, reviewed and edited the manuscript. MW, YW and SL confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The collection and use of the tissues in the present study were approved by the Institutional Ethics Committee of the First Affiliated Hospital of Chongqing Medical University and written informed consent was signed by the patients (approval no. 2017-012) and was bound by the Declaration of Helsinki. All experimental procedures were approved by the Animal Ethics Committee of Chongqing Medical University (approval no. 2022-K121).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

The authors would like to express their sincere gratitude to Professor Qian Tao at The Chinese University of Hong Kong (Hong Kong, SAR, China) for generously providing the YCC-B1 cell line used in the present study.

Funding

No funding was received.

References

1 

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394–424. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Early Breast Cancer Trialists' Collaborative Group (EBCTCG): Effects of chemotherapy and hormonal therapy for early breast cancer on recurrence and 15-year survival: An overview of the randomised trials. Lancet. 365:1687–1717. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Xie J, Ying YY, Xu B, Li Y, Zhang X and Li C: Metastasis pattern and prognosis of male breast cancer patients in US: A population-based study from SEER database. Ther Adv Med Oncol. 11:17588359198890032019. View Article : Google Scholar : PubMed/NCBI

4 

Kim MY: Breast cancer metastasis. Adv Exp Med Biol. 1187:183–204. 2021. View Article : Google Scholar : PubMed/NCBI

5 

Das V, Bhattacharya S, Chikkaputtaiah C, Hazra S and Pal M: The basics of epithelial-mesenchymal transition (EMT): A study from a structure, dynamics, and functional perspective. J Cell Physiol. 234:14535–14555. 2019. View Article : Google Scholar : PubMed/NCBI

6 

Thiery JP, Acloque H, Huang RY and Nieto MA: Epithelial-mesenchymal transitions in development and disease. Cell. 139:871–890. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Nieto MA: Epithelial-mesenchymal transitions in development and disease: Old views and new perspectives. Int J Dev Biol. 53:1541–1547. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Johansen FE, Braathen R and Brandtzaeg P: Role of J chain in secretory immunoglobulin formation. Scand J Immunol. 52:240–248. 2000. View Article : Google Scholar : PubMed/NCBI

9 

Johansen FE, Braathen R and Brandtzaeg P: The J chain is essential for polymeric Ig receptor-mediated epithelial transport of IgA. J Immunol. 167:5185–5192. 2001. View Article : Google Scholar : PubMed/NCBI

10 

Bertrand FE III, Billips LG, Gartland GL, Kubagawa H and Schroeder HW Jr: The J chain gene is transcribed during B and T lymphopoiesis in humans. J Immunol. 156:4240–4244. 1996. View Article : Google Scholar : PubMed/NCBI

11 

Bjercke S and Brandtzaeg P: Glandular distribution of immunoglobulins, J chain, secretory component, and HLA-DR in the human endometrium throughout the menstrual cycle. Hum Reprod. 8:1420–1425. 1993. View Article : Google Scholar : PubMed/NCBI

12 

Gui S, O'Neill WQ, Teknos TN and Pan Q: Plasma cell marker, immunoglobulin J polypeptide, predicts early disease-specific mortality in HPV+ HNSCC. J Immunother Cancer. 9:e0012592021. View Article : Google Scholar : PubMed/NCBI

13 

Cruz-Rodriguez N, Combita AL, Enciso LJ, Quijano SM, Pinzon PL, Lozano OC, Castillo JS, Li L, Bareño J, Cardozo C, et al: High expression of ID family and IGJ genes signature as predictor of low induction treatment response and worst survival in adult Hispanic patients with B-acute lymphoblastic leukemia. J Exp Clin Cancer Res. 35:642016. View Article : Google Scholar : PubMed/NCBI

14 

Slizhikova DK, Zinov'eva MV, Kuz'min DV, Snezhkov EB, Shakhparonov MI, Dmitriev RI, Antipova NV, Zavalova LL and Sverdlov ED: Decrease in expression of human J-chain in lung squamous cell cancer and adenocarcinoma. Mol Biol (Mosk). 41:659–665. 2007.In Russian. View Article : Google Scholar : PubMed/NCBI

15 

Jiang B, Li S, Jiang Z and Shao P: Gastric cancer associated genes identified by an integrative analysis of gene expression data. Biomed Res Int. 2017:72590972017. View Article : Google Scholar : PubMed/NCBI

16 

Larsson C, Ehinger A, Winslow S, Leandersson K, Klintman M, Dahl L, Vallon-Christersson J, Häkkinen J, Hegardt C, Manjer J, et al: Prognostic implications of the expression levels of different immunoglobulin heavy chain-encoding RNAs in early breast cancer. NPJ Breast Cancer. 6:282020. View Article : Google Scholar : PubMed/NCBI

17 

Zhong Z, Jiang W, Zhang J, Li Z and Fan F: Identification and validation of a novel 16-gene prognostic signature for patients with breast cancer. Sci Rep. 12:123492022. View Article : Google Scholar : PubMed/NCBI

18 

Junjun S, Yangyanqiu W, Jing Z, Jie P, Jian C, Yuefen P and Shuwen H: Prognostic model based on six PD-1 expression and immune infiltration-associated genes predicts survival in breast cancer. Breast Cancer. 29:666–676. 2022. View Article : Google Scholar : PubMed/NCBI

19 

Wang Y, Zhu M, Guo F, Song Y, Fan X and Qin G: Identification of tumor microenvironment-related prognostic biomarkers in luminal breast cancer. Front Genet. 11:5558652020. View Article : Google Scholar : PubMed/NCBI

20 

Győrffy B: Survival analysis across the entire transcriptome identifies biomarkers with the highest prognostic power in breast cancer. Comput Struct Biotechnol J. 19:4101–4109. 2021. View Article : Google Scholar

21 

Wang M, Dai M, Wu YS, Yi Z, Li Y and Ren G: Immunoglobulin superfamily member 10 is a novel prognostic biomarker for breast cancer. PeerJ. 8:e101282020. View Article : Google Scholar : PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

23 

Li Y, Huang J, Zeng B, Yang D, Sun J, Yin X, Lu M, Qiu Z, Peng W, Xiang T, et al: PSMD2 regulates breast cancer cell proliferation and cell cycle progression by modulating p21 and p27 proteasomal degradation. Cancer Lett. 430:109–122. 2018. View Article : Google Scholar : PubMed/NCBI

24 

Kozłowski J, Kozłowska A and Kocki J: Breast cancer metastasis-insight into selected molecular mechanisms of the phenomenon. Postepy Hig Med Dosw (Online). 69:447–451. 2015. View Article : Google Scholar

25 

Stark AM, Tongers K, Maass N, Mehdorn HM and Held-Feindt J: Reduced metastasis-suppressor gene mRNA-expression in breast cancer brain metastases. J Cancer Res Clin Oncol. 131:191–198. 2005. View Article : Google Scholar

26 

Chakrabarti R, Hwang J, Blanco MA, Wei Y, Lukačišin M, Romano RA, Smalley K, Liu S, Yang Q, Ibrahim T, et al: Elf5 inhibits the epithelial-mesenchymal transition in mammary gland development and breast cancer metastasis by transcriptionally repressing Snail2. Nat Cell Biol. 14:1212–1222. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Li CJ, Chu PY, Yiang GT and Wu MY: The molecular mechanism of epithelial-mesenchymal transition for breast carcinogenesis. Biomolecules. 9:4762019. View Article : Google Scholar : PubMed/NCBI

28 

Yeung KT and Yang J: Epithelial-mesenchymal transition in tumor metastasis. Mol Oncol. 11:28–39. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Park M, Kim D, Ko S, Kim A, Mo K and Yoon H: Breast cancer metastasis: Mechanisms and therapeutic implications. Int J Mol Sci. 23:68062022. View Article : Google Scholar : PubMed/NCBI

30 

Karamanou K, Franchi M, Vynios D and Brézillon S: Epithelial-to-mesenchymal transition and invadopodia markers in breast cancer: Lumican a key regulator. Semin Cancer Biol. 62:125–133. 2020. View Article : Google Scholar

31 

Wang H, Guo S, Kim SJ, Shao F, Ho JWK, Wong KU, Miao Z, Hao D, Zhao M, Xu J, et al: Cisplatin prevents breast cancer metastasis through blocking early EMT and retards cancer growth together with paclitaxel. Theranostics. 11:2442–2459. 2021. View Article : Google Scholar : PubMed/NCBI

32 

Lüönd F, Sugiyama N, Bill R, Bornes L, Hager C, Tang F, Santacroce N, Beisel C, Ivanek R, Bürglin T, et al: Distinct contributions of partial and full EMT to breast cancer malignancy. Dev Cell. 56:3203–3221.e11. 2021. View Article : Google Scholar : PubMed/NCBI

33 

Chaffer CL, Juan BP, Lim E and Weinberg RA: EMT, cell plasticity and metastasis. Cancer Metastasis Rev. 35:645–654. 2016. View Article : Google Scholar : PubMed/NCBI

34 

Lamouille S, Xu J and Derynck R: Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 15:178–196. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Ho GY, Kyran EL, Bedo J, Wakefield MJ, Ennis DP, Mirza HB, Vandenberg CJ, Lieschke E, Farrell A, Hadla A, et al: Epithelial-to-mesenchymal transition supports ovarian carcinosarcoma tumorigenesis and confers sensitivity to microtubule-targeting with eribulin. Cancer Res. 83:4457–4473. 2022. View Article : Google Scholar

36 

Hasmim M, Xiao M, Van Moer K, Kumar A, Oniga A, Mittelbronn M, Duhem C, Chammout A, Berchem G, Thiery JP, et al: SNAI1-dependent upregulation of CD73 increases extracellular adenosine release to mediate immune suppression in TNBC. Front Immunol. 13:9828212022. View Article : Google Scholar : PubMed/NCBI

37 

Smith BN and Bhowmick NA: Role of EMT in metastasis and therapy resistance. J Clin Med. 5:172016. View Article : Google Scholar : PubMed/NCBI

38 

Huang Y, Hong W and Wei X: The molecular mechanisms and therapeutic strategies of EMT in tumor progression and metastasis. J Hematol Oncol. 15:1292022. View Article : Google Scholar : PubMed/NCBI

39 

Chaffer CL, Marjanovic ND, Lee T, Bell G, Kleer CG, Reinhardt F, D'Alessio AC, Young RA and Weinberg RA: Poised chromatin at the ZEB1 promoter enables breast cancer cell plasticity and enhances tumorigenicity. Cell. 154:61–74. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Hashemi M, Moosavi MS, Abed HM, Dehghani M, Aalipour M, Ali Heydari E, Behroozaghdam M, Entezari M, Salimimoghadam S, Gunduz ES, et al: Long non-coding RNA (lncRNA) H19 in human cancer: From proliferation and metastasis to therapy. Pharmacol Res. 184:1064182022. View Article : Google Scholar : PubMed/NCBI

41 

Gialeli C, Theocharis AD and Karamanos NK: Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. FEBS J. 278:16–27. 2011. View Article : Google Scholar

42 

Mehner C, Hockla A, Miller E, Ran S, Radisky DS and Radisky ES: Tumor cell-produced matrix metalloproteinase 9 (MMP-9) drives malignant progression and metastasis of basal-like triple negative breast cancer. Oncotarget. 5:2736–2749. 2014. View Article : Google Scholar : PubMed/NCBI

43 

Nagase H, Visse R and Murphy G: Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc Res. 69:562–573. 2006. View Article : Google Scholar : PubMed/NCBI

44 

Jabłońska-Trypuć A, Matejczyk M and Rosochacki S: Matrix metalloproteinases (MMPs), the main extracellular matrix (ECM) enzymes in collagen degradation, as a target for anticancer drugs. J Enzyme Inhib Med Chem. 31(sup1): S177–S183. 2016. View Article : Google Scholar

45 

Vallabhapurapu S and Karin M: Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27:693–733. 2009. View Article : Google Scholar : PubMed/NCBI

46 

Muaddi H, Majumder M, Peidis P, Papadakis AI, Holcik M, Scheuner D, Kaufman RJ, Hatzoglou M and Koromilas AE: Phosphorylation of eIF2α at serine 51 is an important determinant of cell survival and adaptation to glucose deficiency. Mol Biol Cell. 21:3220–3231. 2010. View Article : Google Scholar : PubMed/NCBI

47 

Pal S, Bhattacharjee A, Ali A, Mandal NC, Mandal SC and Pal M: Chronic inflammation and cancer: potential chemoprevention through nuclear factor kappa B and p53 mutual antagonism. J Inflamm (Lond). 11:232014. View Article : Google Scholar : PubMed/NCBI

48 

Julien S, Puig I, Caretti E, Bonaventure J, Nelles L, van Roy F, Dargemont C, de Herreros AG, Bellacosa A and Larue L: Activation of NF-kappaB by Akt upregulates Snail expression and induces epithelium mesenchyme transition. Oncogene. 26:7445–7456. 2007. View Article : Google Scholar : PubMed/NCBI

49 

Tsubaki M, Komai M, Fujimoto SI, Itoh T, Imano M, Sakamoto K, Shimaoka H, Takeda T, Ogawa N, Mashimo K, et al: Activation of NF-κB by the RANKL/RANK system up-regulates snail and twist expressions and induces epithelial-to-mesenchymal transition in mammary tumor cell lines. J Exp Clin Cancer Res. 32:622013. View Article : Google Scholar

50 

Katoh M and Katoh M: Integrative genomic analyses of ZEB2: Transcriptional regulation of ZEB2 based on SMADs, ETS1, HIF1alpha, POU/OCT, and NF-kappaB. Int J Oncol. 34:1737–1742. 2009. View Article : Google Scholar : PubMed/NCBI

51 

Li CW, Xia W, Huo L, Lim SO, Wu Y, Hsu JL, Chao CH, Yamaguchi H, Yang NK, Ding Q, et al: Epithelial-mesenchymal transition induced by TNF-α requires NF-κB-mediated transcriptional upregulation of Twist1. Cancer Res. 72:1290–1300. 2012. View Article : Google Scholar : PubMed/NCBI

52 

Wu Y, Deng J, Rychahou PG, Qiu S, Evers BM and Zhou BP: Stabilization of snail by NF-kappaB is required for inflammation-induced cell migration and invasion. Cancer Cell. 15:416–428. 2009. View Article : Google Scholar : PubMed/NCBI

53 

Wang H, Wang HS, Zhou BH, Li CL, Zhang F, Wang XF, Zhang G, Bu XZ, Cai SH and Du J: Epithelial-mesenchymal transition (EMT) induced by TNF-α requires AKT/GSK-3β-mediated stabilization of snail in colorectal cancer. PLoS One. 8:e566642013. View Article : Google Scholar

54 

Dongre A and Weinberg RA: New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nat Rev Mol Cell Biol. 20:69–84. 2019. View Article : Google Scholar

Related Articles

Journal Cover

September-2023
Volume 63 Issue 3

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Wang M, Wu Y, Li X, Dai M and Li S: IGJ suppresses breast cancer growth and metastasis by inhibiting EMT via the NF‑κB signaling pathway. Int J Oncol 63: 105, 2023.
APA
Wang, M., Wu, Y., Li, X., Dai, M., & Li, S. (2023). IGJ suppresses breast cancer growth and metastasis by inhibiting EMT via the NF‑κB signaling pathway. International Journal of Oncology, 63, 105. https://doi.org/10.3892/ijo.2023.5553
MLA
Wang, M., Wu, Y., Li, X., Dai, M., Li, S."IGJ suppresses breast cancer growth and metastasis by inhibiting EMT via the NF‑κB signaling pathway". International Journal of Oncology 63.3 (2023): 105.
Chicago
Wang, M., Wu, Y., Li, X., Dai, M., Li, S."IGJ suppresses breast cancer growth and metastasis by inhibiting EMT via the NF‑κB signaling pathway". International Journal of Oncology 63, no. 3 (2023): 105. https://doi.org/10.3892/ijo.2023.5553
a