Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-February 2011 Volume 2 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-February 2011 Volume 2 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Detection of fecal interferon-induced transmembrane protein messenger RNA for colorectal cancer screening

  • Authors:
    • Chie Miyamoto
    • Nobuki Miyamoto
    • Hiroyuki Yamamoto
    • Kohzoh Imai
    • Yasuhisa Shinomura
  • View Affiliations / Copyright

    Affiliations: First Department of Internal Medicine, Sapporo Medical University, Sapporo 060-8543, Japan, The Institute of Medical Science, The University of Tokyo, Tokyo 108-8639, Japan
  • Pages: 95-100
    |
    Published online on: October 19, 2010
       https://doi.org/10.3892/ol.2010.197
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Interferon-induced transmembrane protein (IFITM) is reported to be frequently overexpressed in colorectal tumors. This study aimed to determine the usefulness of detecting fecal IFITM messenger RNA (mRNA) by real-time reverse-transcription polymerase chain reaction (RT-PCR) for colorectal cancer (CRC) screening. This pilot study included 21 patients with CRC and 23 healthy controls. Total RNA was isolated from the feces of the patients, and the expression levels of the mRNA of IFITM1, IFITM2 and IFITM3 were measured by real-time RT-PCR to detect CRC. Receiver operating characteristic curves of respective genes were generated, and the area under the curve (AUC), sensitivity and specificity were determined. When the 44 patients were analyzed, the AUCs of fecal IFITM1, IFITM2 and IFITM3 expression analysis were 0.82, 0.80 and 0.65, respectively. The sensitivities were 67% [14/21; 95% confidence interval (CI) 43-85%], 67% (14/21; 95% CI 43-85%) and 71% (15/21; 95% CI 48-89%), respectively; and the specificities were 96% (1/23; 95% CI 78-100%), 96% (1/23; 95% CI 78-100%) and 61% (9/23; 95% CI 39-80%), respectively. When IFITM1 and IFITM2 were combined, the sensitivity was 86% (18/21; 95% CI 64-97%) and the specificity was 96% (1/23; 95% CI 78-100%). The fecal expression analysis of IFITM1 and IFITM2 mRNA by real-time RT-PCR for CRC screening exhibited high specificities, and the sensitivity was further improved by combining IFITM1 and IFITM2.

Introduction

Colorectal cancer (CRC) is one of the most common types of cancer. Approximately 1 million new cases are diagnosed and approximately 529,000 patients succumb to this type of cancer worldwide each year (1). When this cancer is diagnosed with localized disease, the five-year survival rate following curative surgery is approximately 90% (2). However, the prognosis worsens with advancing stage, and only 5% of patients diagnosed with distant metastasis survive for five years. Detection of CRC in the early stage is therefore a key factor for reducing CRC mortality rates.

Among the various screening tests for CRC, fecal occult blood testing (FOBT) is considered to be the most effective non-invasive screening test. FOBT is convenient and relatively cost-effective (3–6). Guaiac-based FOBT reduces incidence and mortality (3,7,8), but does not exhibit high sensitivity (9–11). Immunochemical FOBT was reported to have a sensitivity of 65.8% and a specificity of 95% for detecting CRC (12). Immunochemical FOBT exhibits a higher sensitivity than that of guaiac-based FOBT. However, improvement in the sensitivity of the fecal test for CRC screening is required to reduce mortality rates from this type of cancer.

Numerous screening methods for CRC using fecal DNA are available. Methods using fecal DNA allow for the detection of mutated (13–16), methylated (17–22) or long DNA (21,23,24). Results from various studies on fecal RNA-based analysis by reverse-transcription polymerase chain reaction (RT-PCR) for CRC screening have been reported (25–31). Altered messenger RNA (mRNA) expression of numerous genes has been noted in CRC, but only a few genes have been studied to investigate the usefulness of fecal RNA analysis in CRC detection.

Interferon-induced transmembrane protein (IFITM) mRNA has been found to be overexpressed in CRC tissues compared with expression levels in normal tissues by cDNA microarrays (32). Three homologues (IFITM1, IFITM2 and IFITM3) of the human IFITM gene exist. Frequent up- regulation of the IFITM gene expression has been reported to be highly specific to human colorectal carcinogenesis (33).

Quantification by real-time PCR is considered to be useful for determining the optimal cut-off point for discriminating between patients with and without CRC. However, the usefulness of detecting fecal mRNA by real-time RT-PCR for CRC screening has yet to be studied sufficiently (29). The usefulness of detecting the fecal mRNA of IFITM1, IFITM2 and IFITM3 by real-time RT-PCR for CRC screening was therefore examined.

Materials and methods

Study design

This study consisted of 21 CRC and 23 control patients (Table I), all of whom underwent colonoscopy. The reasons for performing colonoscopy in the CRC and control patients included positive results of a FOBT test, abdominal pain, anemia, constipation and CRC screening. Stool samples of CRC patients diagnosed with both colonoscopy and histologically were collected prior to surgical resection. The median age of the patients with CRC was 74 years (range 56–94). There were 14 male and 7 female CRC patients. The primary tumor sites were: rectum, 5 patients; sigmoid colon, 7 patients; descending colon, 0 patients; transverse colon, 2 patients; ascending colon, 4 patients; and cecum, 3 patients. The median size of the primary tumors of 14 patients with CRC was 34 mm (range 10–70) and the size of the tumors of the remaining 7 patients with CRC was unknown. The tumors were classified according to Dukes’ staging, yielding stage A (n=9), and stages B (n=3), C (n=7) and D (n=2) (Table II). A total of 23 control patients (14 male and 9 female) who did not exhibit neoplastic lesions colonoscopically were also included in this study. The median age of the control patients was 61 years (range 40–80). This study was approved by the ethics committees at the institutions in which fecal samples were collected. Oral and written informed consent was obtained from the patients.

Table I

The characteristics of the CRC and control patients.

Table I

The characteristics of the CRC and control patients.

CRC patientsControl patients
No.2123
Gender (male/female)14/714/9
Median age (range)74 (56–94)61 (40–80)

Table II

The characteristics of the CRC patients.

Table II

The characteristics of the CRC patients.

Patient no.Age (years)Gender (male/female)LocationSize (cm)Dukes’ stage
163MRunC
294MRunB
357MS3.3B
474FCeunD
575MR5.5A
656MSunA
771MR4.0C
860MR7.0A
970FS1.3A
1085MTunC
1175MCeunC
1285MAunC
1386MCe1.0A
1482FS1.5A
1581MA4.0A
1670MS1.5A
1770MS2.0A
1865FA4.0C
1972FT2.5C
2088FS3.5B
2180FA4.0D

[i] Ce, cecum; A, ascending; T, transverse; D, descending; S, sigmoid; R, rectum; un, unknown.

Fecal sample collection and RNA isolation

Fecal samples were initially preserved at −80°C within 24 h following evacuation. Total RNA was extracted from 500 mg of feces without isolating colonocytes using a combination of Isogene (Nippon Gene, Toyama, Japan) and RNeasy kit (Qiagen, Tokyo, Japan) as previously described (26).

cDNA synthesis

The concentration of isolated RNA was measured by NanoDrop 1000 (Thermo Fisher Scientific, Yokohama, Japan). cDNA was synthesized using SuperScript III RNase H− reverse transcriptase (Invitrogen, Tokyo, Japan) with 1000 ng fecal total RNA and 150 ng random primers in a total reaction volume of 18 μl according to the manufacturer’s instructions.

Real-time polymerase chain reaction

Amplification and detection were performed by real-time PCR with a Taq Man probe. The expression levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin (ACTB), IFITM1, IFITM2 and IFITM3 were measured. The sequences of the PCR primers and probes are listed in Table III. cDNA (2 μl) was used as templates in each reaction. The reaction mixture consisted of templates, 10 μl of QuantiTect Multiplex PCR kit (Qiagen, Tokyo, Japan), 0.40 μM of forward and reverse primers and 0.20 μM of the probe in a total reaction volume of 20 μl. The real-time PCR reaction was performed with precycling heat activation at 95°C for 10 min, followed by 50 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 60 sec in an Applied Biosystems 7500 sequence detection system (Life Technologies, Tokyo, Japan).

Table III

The primer and probe oligo sequences.

Table III

The primer and probe oligo sequences.

Gene
GAPDHForward: GAACGGGAAGCTTGTCATCA
GAPDHReverse: ATCGCCCCACTTGATTTTG
GAPDHProbe: FAM-CCCATCACCATCTTCCAGGAGCGAGA-TAMRA
ACTBForward: CCTCGCCTTTGCCGATCC
ACTBReverse: CATGCCGGAGCCGTTGTC
ACTBProbe: FAM-CGTCCACACCCGCCGCCAGC-TAMRA
IFITM1Forward: TCGCCTACTCCGTGAAGTCT
IFITM1Reverse: TGTCACAGAGCCGAATACCA
IFITM1Probe: FAM-ATGCCTCCACCGCCAAGTGCCT-TAMRA
IFITM2Forward: TGTATCCCACGTACTCTATCTTCC
IFITM2Reverse: GGACAGGGCGAGGAATGG
IFITM2Probe: FAM-TGGAGTAAGTGGAATACAGGTCAAGGGCAG-TAMRA
IFITM3Forward: CTGAGAACCATCCCAGTAACCC
IFITM3Reverse: ACTGTTGACAGGAGAGAAGAAGG
IFITM3Probe: FAM-CATGGTGTCCAGCGAAGACCAGCGG-TAMRA

[i] GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ACTB, β-actin; IFITM, interferon-induced transmembrane protein; FAM, carboxy-fluorescein-aminohexyl amidite; TAMRA, tetramethylrhodamine.

Statistical analysis

In the fecal RNA analysis used for detecting CRC, when an amplification curve crossed the threshold line within the end of definite cycles, the expression of the gene was interpreted as positive, and multiple pairs of sensitivities and specificities were determined for each gene. The receiver operating characteristic (ROC) curve was created from pairs of sensitivities and specificities, and the area under the curve (AUC) was calculated (34). The optimal sensitivity and specificity were determined using the Youden index: (Youden index) = maximum (sensitivity + specificity − 1). The sensitivities and specificities were estimated relative to the results of the colonoscopy in the usual manner; 95% confidence interval (CI) for each of the estimated parameters was based on the exact binominal distribution. P<0.05 was considered to be statistically significant. The reported P-values were evaluated by a two-sided test.

Results

RNA concentration

The mean concentrations of RNA extracted from the feces of the 21 CRC and 23 control patients were 876 ng/μl (range 105–3,333) and 1,044 ng/μl (range 105–2,000), respectively. No significant difference was found between RNA concentrations in the group of CRC patients and the group of control patients (P=0.40).

Detection of GAPDH and ACTB mRNA

The detection rates of GAPDH were 91% (19/21) in the CRC patients and 100% (23/23) in the control patients. No significant difference was noted between the detection rates of GAPDH in the CRC and control patients (P=0.2). The cycle threshold (Ct) values of GAPDH in the CRC patients were significantly smaller than those in the control patients (P=0.02). The detection rates of ACTB were 76% (16/21) in the CRC patients and 91% (21/23) in the control patients. No significant difference was found between the detection rates of ACTB in the CRC and control patients (P=0.23). The Ct values of ACTB in CRC patients were significantly smaller than those in the control patients (P=0.003).

Sensitivities and specificities of the gene expression analysis

When the 44 cases were analyzed, the AUCs of fecal IFITM1, IFITM2 and IFITM3 expression analysis for CRC were 0.82, 0.80 and 0.65, respectively (Fig. 1). The sensitivities were 67% (14/21; 95% CI 43–85%), 67% (14/21; 95% CI 43–85%) and 71% (15/21; 95% CI 48–89%), respectively. The specificities were 96% (1/23; 95% CI 78–100%), 96% (1/23; 95% CI 78–100%) and 61% (9/23; 95% CI 39–80%), respectively. The Youden index values were 0.62, 0.62 and 0.32, respectively (Table IV).

Figure 1

ROC curves and AUC of fecal RNA expression analysis. The markers were determined in all 44 cases (21 CRC and 23 control patients), in the cases whose fecal mRNA expression of GAPDH was positive (19 CRC and 23 control patients) and in the cases whose fecal mRNA expression of ACTB was positive (16 CRC and 21 control patients). ALL, all 44 cases.

Table IV

The sensitivities and specificities of fecal RNA expression analysis.

Table IV

The sensitivities and specificities of fecal RNA expression analysis.

ExpressionGeneSensitivitySpecificityThreshold (cycles)Youden index
No.% (95% CI)No.% (95% CI)
ALL
IFITM114/2167 (43–85)1/2396 (78–100)450.62
IFITM214/2167 (43–85)1/2396 (78–100)390.62
IFITM315/2171 (48–89)9/2361 (39–80)380.32
IFITM1+218/2186 (64–97)1/2396 (78–100)IFITM1:45
IFITM2:35
0.81
GAPDH (+)
IFITM114/1974 (49–91)1/2396 (78–100)450.69
IFITM214/1974 (49–91)1/2396 (78–100)390.69
IFITM315/1979 (54–94)9/2361 (39–80)380.40
IFITM1+218/1995 (74–100)1/2396 (78–100)IFITM1:45
IFITM2:35
0.90
ACTB (+)
IFITM112/1675 (48–93)1/2195 (76–100)440.70
IFITM214/1688 (62–99)1/2195 (76–100)390.83
IFITM314/1688 (62–99)7/2167 (43–85)380.54
IFITM1+216/16100 (79–100)0/21100 (84–100)IFITM1:44
IFITM2:35
1.00

[i] No., the number of positive/total; +, positive gene expression. ALL, all 44 cases.

When 42 cases were analyzed in which GAPDH mRNA was detected, the AUCs of fecal IFITM1, IFITM2 and IFITM3 expression analysis for CRC were 0.87, 0.86 and 0.69, respectively (Fig. 1). The sensitivities were 74% (14/19; 95% CI 49–91%), 74% (14/19; 95% CI 49–91%) and 79% (15/19; 95% CI 54–94%), respectively. The specificities were 96% (1/23; 95% CI 78–100%), 96% (1/23; 95% CI 78–100%) and 61% (9/23; 95% CI 39–80%), respectively, and the Youden index values were 0.69, 0.69 and 0.40, respectively (Table IV).

When 37 cases were analyzed in which ACTB mRNA was detected, the AUCs of fecal IFITM1, IFITM2 and IFITM3 expression analysis for CRC were 0.88, 0.97 and 0.76, respectively (Fig. 1). The sensitivities were 75% (12/16; 95% CI 48–93%), 88% (14/16; 95% CI 62–99%) and 88% (14/16; 95% CI 62–99%), respectively. The specificities were 95% (1/21; 95% CI 76–100%), 95% (1/21; 95% CI 76–100%) and 67% (7/21; 95% CI 43–85%), respectively, and the Youden index values were 0.70, 0.83 and 0.54, respectively (Table IV).

The sensitivities of fecal IFITM1, IFITM2 and IFITM3 expression analysis of the patients with Dukes’ A+B were 58% (7/12; 95% CI 30–87%), 67% (8/12; 95% CI 38–95%) and 67% (8/12; 95% CI 38–95%), respectively, and the patients with Dukes’ C+D exhibited 78% (7/9; 95% CI 45–100%), 67% (6/9; 95% CI 34–99%) and 78% (7/9; 95% CI 45–100%), respectively. Therefore, no significant difference was found in the sensitivities between the two groups. There was also no significant difference in the sensitivities of fecal IFITM1, IFITM2 and IFITM3 expression analysis regarding gender, tumor location, tumor size, RNA concentration or GAPDH expression. The sensitivities of fecal IFITM2 and IFITM3 expression analysis of the group in which ACTB expression was positive were significantly higher than those of the group in which ACTB expression was negative (P=0.001 and P=0.01, respectively), although no significant difference was found in the sensitivity of fecal IFITM1 expression analysis between the two groups.

Combination of IFITM1 and IFITM2

The AUCs of IFITM1 and IFITM2 were larger than that of IFITM3. Therefore, we calculated the sensitivities and specificities for the combination of IFITM1 and IFITM2 (fecal IFITM1+2 expression analysis). When analyzed for all 44 cases, the sensitivity and specificity of fecal IFITM1+2 expression analysis were found to be 86% (18/21; 95% CI 64–97%) and 96% (1/23; 95% CI 78–100%). When analyzed for cases in which GAPDH mRNA was detected, the sensitivity and specificity were 95% (18/19; 95% CI 74–100%) and 96% (1/23; 95% CI 78–100%). When analyzed for cases in which ACTB mRNA was detected, the sensitivity and specificity were 100% (16/16; 95% CI 79–100%) and 100% (0/21; 95% CI 84–100%) (Table IV).

The sensitivity of fecal IFITM1+2 analysis of patients with Dukes’ A+B and that of patients with Dukes’ C+D were 83% (10/12; 95% CI 55–100%) and 89% (8/9; 95% CI 56–100%), respectively, and no significant difference was noted in the sensitivities between the two groups. There was also no significant difference in the sensitivities of fecal IFITM1+2 expression analysis with regards to gender, tumor location, tumor size or RNA concentration. The sensitivity of fecal IFITM1+2 expression analysis of the group in which GAPDH expression was positive was significantly higher than that of the group in which GAPDH expression was negative (P=0.01), and the sensitivity of the group in which ACTB expression was positive was significantly higher than that of the group in which ACTB expression was negative (P=0.01).

Discussion

Results of numerous studies on fecal DNA-based analysis for CRC screening have been reported. A fecal DNA panel consisting of 21 mutations exhibited 51.6% sensitivity and 94.4% specificity (11). Since CRC cells undergo diverse genetic changes, it is difficult to detect CRC with a high sensitivity by using only fecal DNA-based mutational analysis.

Fecal methylation analysis of the vimentin gene provided sensitivity and specificity of 72.5 and 86.9%, respectively, and the combination of vimentin methylation plus a DNA integrity assay resulted in 87.5% sensitivity and 82% specificity (21). In another study, a fecal SFRP2 methylation assay for CRC screening exhibited 77–90% sensitivity and 77% specificity (20). In the fecal methylation analysis, it is crucial to decrease the effect of methylation with aging to improve the specificity.

The number of studies on fecal RNA-based analysis for CRC screening that are currently available are fewer than those on fecal DNA-based analysis. The fecal RNA expression analysis of PTGS2 by semi-quantitative RT-PCR was reported to have sensitivities of 50–90% and specificities of 93–100% in previous studies (22,26,30). Semi-quantitative RT-PCR was used in the majority of previous studies on fecal RNA expression analysis for CRC screening, while real-time RT-PCR was used in only a few studies (29). Real-time PCR has a number of advantages over semi-quantitative PCR, including high speed, reduction of contamination and a high level of reproducibility, from the viewpoint of a laboratory test. In the present study, the sensitivity and specificity of fecal IFITM1+2 expression analysis determined in all 44 cases were 86 and 96%, respectively. We showed that CRC is potentially detected with a high sensitivity and specificity by fecal RNA expression analysis using real-time RT-PCR.

The quantitation of templates by real-time RT-PCR allowed us to generate ROC curves for the fecal mRNA expression analysis, compare the AUCs, and determine the cut-off points at which optimal sensitivities and specificities are achieved. Real-time RT-PCR is considered to be effective in determining the optimal cut-off points efficiently when studying the usefulness of fecal mRNA expression analysis by RT-PCR for CRC screening.

Up-regulation of the IFITM gene was considered to be an early event in β-catenin intestinal tumorigenesis (33). No significant difference was noted in the sensitivities of fecal IFITM1, IFITM2, IFITM3 and IFITM1+2 expression analysis between the group of CRC patients without metastasis (Dukes’ A+B) and the group of CRC patients with metastasis (Dukes’ C+D). Therefore, the fecal IFITM expression analysis appears to be useful in the early detection of CRC.

No significant difference was found in sensitivities regarding tumor size and location. However, the sensitivity for tumors of less than 34 mm in diameter were lower than that for tumors of more than 34 mm in diameter. The sensitivity for tumors located on the right side of the colon were lower than that for tumors located on the left side of the colon. A larger study is therefore required to clarify the differences in sensitivities of fecal mRNA expression analysis for CRC with regards to tumor size and/or location.

When analyzed for cases in which the mRNA of the housekeeping gene was detected, AUCs were found to be larger than AUCs when analyzed for all 44 cases. Moreover, the sensitivity of fecal IFITM1+2 expression analysis in the group in which the mRNA of the housekeeping gene was not detected was significantly lower than that in the group in which the mRNA of the housekeeping gene was detected. Fecal IFITM mRNA-negative CRC cases appear to include not only cases in which IFITM mRNA was not expressed in their tumors but also ones in which human RNA as templates of RT-PCR was insufficient in their fecal samples.

In conclusion, detection of fecal mRNA of IFITM1 and IFITM2 had larger AUCs than that of IFITM3, and the sensitivity was improved by combining IFITM1 and IFITM2. Since the number of cases analyzed in the present study was limited, a larger study is imperative in order to assess sensitivity and specificity. However, the results of the present study suggest the usefulness of detecting the fecal mRNA of IFITM1 and IFITM2 by real-time RT-PCR for CRC screening.

Acknowledgements

Support by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (to H.Y., K.I. and Y.S.)

Abbreviations:

ACTB

β-actin

AUC

area under the curve

CI

confidence interval

CRC

colorectal cancer

Ct

cycle threshold

FOBT

fecal occult blood testing

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

IFITM

interferon-induced transmembrane protein

mRNA

messenger RNA

PCR

polymerase chain reaction

ROC

receiver operating characteristic

RT

reverse transcription

References

1 

Parkin DM, Bray F, Ferlay J and Pisani P: Global cancer statistics, 2002. CA Cancer J Clin. 55:74–108. 2005. View Article : Google Scholar

2 

Pfister DG, Benson AB III and Somerfield MR: Clinical practice. Surveillance strategies after curative treatment of colorectal cancer. N Engl J Med. 350:2375–2382. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Mandel JS, Church TR, Bond JH, et al: The effect of fecal occult-blood screening on the incidence of colorectal cancer. N Engl J Med. 343:1603–1607. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Winawer S, Fletcher R, Rex D, et al: Colorectal cancer screening and surveillance: clinical guidelines and rationale-update based on new evidence. Gastroenterology. 124:544–560. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Smith A, Young GP, Cole SR and Bampton P: Comparison of a brush-sampling fecal immunochemical test for hemoglobin with a sensitive guaiac-based fecal occult blood test in detection of colorectal neoplasia. Cancer. 107:2152–2159. 2006. View Article : Google Scholar

6 

Levi Z, Rozen P, Hazazi R, et al: A quantitative immunochemical fecal occult blood test for colorectal neoplasia. Ann Intern Med. 146:244–255. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Kronborg O, Fenger C, Olsen J, Jørgensen OD and Søndergaard O: Randomised study of screening for colorectal cancer with faecal-occult-blood test. Lancet. 348:1467–1471. 1996. View Article : Google Scholar : PubMed/NCBI

8 

Hardcastle JD, Chamberlain JO, Robinson MH, et al: Randomised controlled trial of faecal-occult-blood screening for colorectal cancer. Lancet. 348:1472–1477. 1996. View Article : Google Scholar : PubMed/NCBI

9 

Lieberman DA and Weiss DG: One-time screening for colorectal cancer with combined fecal occult-blood testing and examination of the distal colon. N Engl J Med. 345:555–560. 2001. View Article : Google Scholar : PubMed/NCBI

10 

Sung JJ, Chan FK, Leung WK, et al: Screening for colorectal cancer in Chinese: comparison of fecal occult blood test, flexible sigmoidoscopy, and colonoscopy. Gastroenterology. 124:608–614. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Imperiale TF, Ransohoff DF, Itzkowitz SH, Turnbull BA and Ross ME: Fecal DNA versus fecal occult blood for colorectal-cancer screening in an average-risk population. N Engl J Med. 351:2704–2714. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Morikawa T, Kato J, Yamaji Y, Wada R, Mitsushima T and Shiratori Y: A comparison of the immunochemical fecal occult blood test and total colonoscopy in the asymptomatic population. Gastroenterology. 129:422–428. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Ahlquist DA, Skoletsky JE, Boynton KA, et al: Colorectal cancer screening by detection of altered human DNA in stool: feasibility of a multitarget assay panel. Gastroenterology. 119:1219–1227. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Dong SM, Traverso G, Johnson C, et al: Detecting colorectal cancer in stool with the use of multiple genetic targets. J Natl Cancer Inst. 93:858–865. 2001. View Article : Google Scholar : PubMed/NCBI

15 

Traverso G, Shuber A, Levin B, et al: Detection of APC mutations in fecal DNA from patients with colorectal tumors. N Engl J Med. 346:311–320. 2002. View Article : Google Scholar : PubMed/NCBI

16 

Diehl F, Schmidt K, Durkee KH, et al: Analysis of mutations in DNA isolated from plasma and stool of colorectal cancer patients. Gastroenterology. 135:489–498. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Lenhard K, Bommer GT, Asutay S, et al: Analysis of promoter methylation in stool: a novel method for the detection of colorectal cancer. Clin Gastroenterol Hepatol. 3:142–149. 2005. View Article : Google Scholar : PubMed/NCBI

18 

Chen WD, Han ZJ, Skoletsky J, et al: Detection in fecal DNA of colon cancer-specific methylation of the nonexpressed vimentin gene. J Natl Cancer Inst. 97:1124–1132. 2005. View Article : Google Scholar : PubMed/NCBI

19 

Zou H, Harrington J, Rego RL and Ahlquist DA: A novel method to capture methylated human DNA from stool: implications for colorectal cancer screening. Clin Chem. 53:1646–1651. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Müller HM, Oberwalder M, Fiegl H, et al: Methylation changes in faecal DNA: a marker for colorectal cancer screening? Lancet. 363:1283–1285. 2004.PubMed/NCBI

21 

Itzkowitz SH, Jandorf L, Brand R, et al: Improved fecal DNA test for colorectal cancer screening. Clin Gastroenterol Hepatol. 5:111–117. 2007. View Article : Google Scholar : PubMed/NCBI

22 

Leung WK, To KF, Man EP, et al: Detection of hypermethylated DNA or cyclooxygenase-2 messenger RNA in fecal samples of patients with colorectal cancer or polyps. Am J Gastroenterol. 102:1070–1076. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Boynton KA, Summerhayes IC, Ahlquist DA and Shuber AP: DNA integrity as a potential marker for stool-based detection of colorectal cancer. Clin Chem. 49:1058–1065. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Zou H, Harrington JJ, Klatt KK and Ahlquist DA: A sensitive method to quantify human long DNA in stool: relevance to colorectal cancer screening. Cancer Epidemiol Biomarkers Prev. 15:1115–1119. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Yamao T, Matsumura Y, Shimada Y, et al: Abnormal expression of CD44 variants in the exfoliated cells in the feces of patients with colorectal cancer. Gastroenterology. 114:1196–1205. 1998. View Article : Google Scholar : PubMed/NCBI

26 

Kanaoka S, Yoshida K, Miura N, Sugimura H and Kajimura M: Potential usefulness of detecting cyclooxygenase 2 messenger RNA in feces for colorectal cancer screening. Gastroenterology. 127:422–427. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Lagerholm S, Lagerholm S, Dutta S and Nair P: Non-invasive detection of c-myc p64, c-myc p67 and c-erbb-2 in colorectal cancer. Scand J Gastroenterol. 40:1343–1350. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Yajima S, Ishii M, Matsushita H, et al: Expression profiling of fecal colonocytes for RNA-based screening of colorectal cancer. Int J Oncol. 31:1029–1037. 2007.PubMed/NCBI

29 

Koga Y, Yasunaga M, Moriya Y, et al: Detection of colorectal cancer cells from feces using quantitative real-time RT-PCR for colorectal cancer diagnosis. Cancer Sci. 99:1977–1983. 2008.PubMed/NCBI

30 

Takai T, Kanaoka S, Yoshida K, et al: Fecal cyclooxygenase 2 plus matrix metalloproteinase 7 mRNA assay as a marker for colorectal cancer screening. Cancer Epidemiol Biomarkers Prev. 18:1888–1893. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Yu YJ, Majumdar AP, Nechvatal JM, et al: Exfoliated cells in stool: a source for reverse transcription-PCR-based analysis of biomarkers of gastrointestinal cancer. Cancer Epidemiol Biomarkers Prev. 17:455–458. 2008.PubMed/NCBI

32 

Kitahara O, Furukawa Y, Tanaka T, et al: Alterations of gene expression during colorectal carcinogenesis revealed by cDNA microarrays after laser-capture microdissection of tumor tissues and normal epithelia. Cancer Res. 61:3544–3549. 2001.

33 

Andreu P, Colnot S, Godard C, et al: Identification of the IFITM family as a new molecular marker in human colorectal tumors. Cancer Res. 66:1949–1955. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Akobeng AK: Understanding diagnostic tests 3: receiver operating characteristic curves. Acta Pediatrica. 96:644–647. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Miyamoto C, Miyamoto N, Yamamoto H, Imai K and Shinomura Y: Detection of fecal interferon-induced transmembrane protein messenger RNA for colorectal cancer screening. Oncol Lett 2: 95-100, 2011.
APA
Miyamoto, C., Miyamoto, N., Yamamoto, H., Imai, K., & Shinomura, Y. (2011). Detection of fecal interferon-induced transmembrane protein messenger RNA for colorectal cancer screening. Oncology Letters, 2, 95-100. https://doi.org/10.3892/ol.2010.197
MLA
Miyamoto, C., Miyamoto, N., Yamamoto, H., Imai, K., Shinomura, Y."Detection of fecal interferon-induced transmembrane protein messenger RNA for colorectal cancer screening". Oncology Letters 2.1 (2011): 95-100.
Chicago
Miyamoto, C., Miyamoto, N., Yamamoto, H., Imai, K., Shinomura, Y."Detection of fecal interferon-induced transmembrane protein messenger RNA for colorectal cancer screening". Oncology Letters 2, no. 1 (2011): 95-100. https://doi.org/10.3892/ol.2010.197
Copy and paste a formatted citation
x
Spandidos Publications style
Miyamoto C, Miyamoto N, Yamamoto H, Imai K and Shinomura Y: Detection of fecal interferon-induced transmembrane protein messenger RNA for colorectal cancer screening. Oncol Lett 2: 95-100, 2011.
APA
Miyamoto, C., Miyamoto, N., Yamamoto, H., Imai, K., & Shinomura, Y. (2011). Detection of fecal interferon-induced transmembrane protein messenger RNA for colorectal cancer screening. Oncology Letters, 2, 95-100. https://doi.org/10.3892/ol.2010.197
MLA
Miyamoto, C., Miyamoto, N., Yamamoto, H., Imai, K., Shinomura, Y."Detection of fecal interferon-induced transmembrane protein messenger RNA for colorectal cancer screening". Oncology Letters 2.1 (2011): 95-100.
Chicago
Miyamoto, C., Miyamoto, N., Yamamoto, H., Imai, K., Shinomura, Y."Detection of fecal interferon-induced transmembrane protein messenger RNA for colorectal cancer screening". Oncology Letters 2, no. 1 (2011): 95-100. https://doi.org/10.3892/ol.2010.197
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team