Small antibody fusion proteins with complementarity‑determining regions and lidamycin for tumor targeting therapy
- Authors:
- Published online on: January 18, 2013 https://doi.org/10.3892/ol.2013.1143
- Pages: 1183-1188
Abstract
Introduction
Gelatinases, also named type IV collagenases, include gelatinase A (MMP-2) and gelatinase B (MMP-9) (1). It is known that gelatinases are important in tumor progression and are overexpressed in different types of tumor cells, thus representing important tumor-associated antigens (2,3). Solid tumors are usually composed mainly of tumor cells and partly of stromal cells; the latter consist of endothelial cells, neutrophil cells and hemopoietic progenitor cells, which comprise the significant tumor microenvironment and are important in tumor development and drug therapy (4). It has been demonstrated that gelatinases are also overexpressed in the tumor stromal cells (4,5). Therefore, it may be promising to develop new therapeutic drugs using gelatinases as a potential target, which could kill the tumor cells as well as imbalance the tumor microenvironment homeostasis.
Lidamycin is an extremely potent antitumor antibiotic, which is composed of a highly active enediyne chromophore and a protecting apoprotein (6). The chromophore and the apoprotein may be disconnected and reconstituted under certain conditions (6). Taking advantage of the specific targeting capability of antibody fragments, different types of fusion protein, which were composed of small antibody fragments and the lidamycin apoprotein, were created. Following stimulation with enediyne, the fusion protein demonstrated antitumor efficiency in vitro and in vivo(6–10).
It is known that the heavy-chain complementarity-determining region-3 (CDR3) domain of scFv is important in antigen binding (11). Qiu et al demonstrated that the fusion of several different CDR3 domains led to a good targeting efficiency (12). Our previous studies also demonstrated that fusion proteins containing the LDP and oligopeptides specific for tumor antigens exhibited potent antitumor activities (7,13), which suggested that a fusion protein containing LDP and tumor specific oligopeptides was a promising agent for development. We suggested that the combination of the enediyne-energized fusion protein with its analog led to augmented antitumor efficiency in vivo(10); however, the high-dose intravenous administration of fusion protein may facilitate an increase in immunogenicity. The possibility that a human anti-mouse antibody (HAMA) response may be induced by the antibody of murine origin, and that the down-sized antibody may more easily penetrate the core of the solid tumor with lower immunogenicity were considered. In the present study, fusion proteins containing the lidamycin apoprotein and one or two heavy-chain CDR3 domains of anti-gelatinases scFv were created, and their biomedical characterization was investigated.
Materials and methods
Construcion of recombiant plasmids pET-CDR3-LDP and pET-CDR3-LDP-CDR3
The sequence of the heavy chain CDR3 domain of antigelatinase scFv (GenBank No. FJ037775) was TGTGCTAGAGGGGACTACTATAGGCGCTACTTTGAC. To construct the CDR3-LDP fusion protein, (GGGGS)2 was inserted betweeen the LDP and CDR3 domains as a linker (Fig. 1). Two primers was designed and the sequences used were as follows: P1: 5′-GGAATTCCATATGTGTGCTAGA GGGGACTACTATAGGCGCTACTTTGACGGTGGAGGT GGTTCAGGTGGA-3′ (the NdeI site is underlined) and P2: 5′-CCGCTCGAGGCCGAAGGTCAGAGCCACGTG-3′ (the XhoI site is underlined). Using the plasmid pET-Ec-ldp-Hr (7) as a template, and primers P1 and P2, PCR amplification was performed. The obtained fragment was NdeI/XhoI digested and was inserted into a pET30a(+) expression vector to generate the recombinant plasmid pET-CDR3-LDP. DNA sequencing analysis was conducted to verify that the gene sequence was correct (Invitrogen Life Technologies, Carlsbad, CA, USA).
To construct the pET-CDR3-LDP-CDR3 recombinant plasmid, three different primer were designed and the sequences used were as follows: P3: 5′-CCTTGCC GAAGATCCTCCACCTCCAGATCCTCCCCCGCCGCCG AAGGTCAGACCAC-3′; P4: 5′-CCGCTCGAGATCGAAAT ATCGTCTGATAATCTCCCCTTGCCGAAGATCCTCC-3′; P5: 5′-GGAATTCCATATGTGTGCT-3′. Using the pETEc-ldp-Hr as a template, and primers P1 and P3, PCR amplification was conducted. The amplified product was used as the next template, and P4 and P5 as the primers in the second PCR amplification. The final product was NdeI/XhoI digested and inserted into to the pET30a(+) plasmid to generate the recombinant plasmid pET-cdr3-ldp-cdr3. Additionally, the sequence analysis of pET-cdr3-ldp-cdr3 was verified (Invitrogen Life Technologies).
Expression and purification of CDR3-LDP and CDR3-LDP- CDR3
The sequence-verified plasmids pET-CDR3-LDP and pET-CDR3-LDP-CDR3 were transformed into the E.coli BL21 (DE3) expression strain (Novagen/MerckKGaA, Darmstadt, Germany) to produce the recombinant protein. Expression, purification of CDR3-LDP and CDR3-LDP-CDR3 fusion protein was carried out according to the manufacturer’s protocol (Novagen). The purified protein was analyzed by SDS-PAGE and the protein concentration was determined by the BCA kit (Pierce Biotechnology, Inc., Rockford, IL, USA).
Binding with gelatinases
Gelatinases were coated in a 96-well plate overnight, and a serial dilution of purified fusion proteins CDR3-LDP and CDR3-LDP-CDR3 was added. The detailed procedure was described previously (14), and the final affintiy constant was determined by Graphpad Prism 5 software (San Diego, CA, USA).
Binding activities of fusion protein CDR3-LDP with tumor cells
Binding with tumor cells was determined by ELISA assay. Human Bel-7402 and HepG2 hepatoma cell lines were seeded in 96-well plate at a density of 1×104cells/well and cultivated overnight at 37°C. The following procedure was performed according to that of our previous study (14).
To further identify the binding affinity of fusion protein to target tumor cells, we used a fluorescence-activated cell sorting (FACS)-based analysis assay. Protein bovine serum albumin (BSA), LDP and CDR3-LDP were FITC labeled for 16 h in a carbonate buffer solution (100 mmol/l NaHCO3; 10 mmol/l Na2CO3, pH 9.0) at 4°C. Labeled protein was separated from unbound FITC using the Sephadex G-25 column (GE Healthcare, Waukesha, WI, USA). Each FITC-labeled protein, BSA, LDP and CDR3-LDP, were incubated with 5×105 Bel-7402 and HepG2 cells in a 100-μl volume of FACS buffer (PBS with 2% fetal bovine serum) for 2 h at room temperature. Following three washes with 500 μl of FACS buffer, cells were analyzed with a BD FACSCalibur (BD Biosciences San Jose, CA, USA).
Additionally, the binding specificity of CDR3-LDP with cancer cells was assessed by immunofluorescence. HepG2 cells (1×105) were grown on coverslides overnight, fixed with ice-cold 70% methanol, blocked with 5% BSA, then incubated with CDR3-LDP fusion protein (100 μg/ml) for 2 h at 37°C. After washing with PBS, cells were incubated with mouse anti-His tag monoclonal antibody (dilution 1:200; Novagen) for 1 h, followed with FITC-conjugated goat anti-mouse antibody (dilution 1:500; Zhongshan Golden Bridge Biotechnology, Beijing, China). The images were observed under a fluorescence microscope and collected by fluorescence microscopy (Nikon TE 2000u, Tokyo, Japan).
Preparation of enediyne-energized fusion protein CDR3-LDP-AE
To establish the potent antitumor activity of fusion protein CDR3-LDP, assembly of the fusion protein with the enediyne chromophore was performed. The detailed procedures and the HPLC analysis were all performed according to our previous study (10).
MTT assay
The MTT assay was used for measuring in vitro cytotoxicity of stimulated CDR3-LDP-AE fusion protein as described previously (10). Cells were seeded at 3,000 cells/well in 96-well plates and incubated in 37°C for overnight. Subsequently, cells were exposed to different concentrations of lidamycin and stimulated CDR3-LDP-AE fusion protein for 48 h. MTT (Sigma, St. Louis, MO, USA) solution (5 mg/ml, 20 μl) was added to each well and incubated for a further 4 h at 37°C. The supernatant was removed and 150 μl DMSO was added to each well. The absorbance at 570 nm was measured using an ELISA reader (Thermo Fisher Scientific). Growth inhibition was calculated as a percentage of the nontreated controls.
In vivo antitumor activity
The in vivo experiment was performed with 7-week-old female Kunming mice (KM), which were purchased from the Institute of Animal Research, Chinese Academy of Medical Science. The study protocols were according to the regulations of the Good Laboratory Practice for non-clinical laboratory studies of drugs issued by the National Scientific and Technologic Committee of People’s Republic of China.
Hepatoma 22 (H22) cells suspended in sterile saline were inoculated subcutaneously (at day 0) in the right axilla of mice, at a density of 2.0×106 cells/0.2 ml/mouse. The mice were divided into seven groups, with 10 mice in each group. At 24 h of H22 cell transplantation (day 1), CDR3-LDP-AE was administered at doses of 0.25 and 0.5 mg/kg of body weight. lidamycin and CDR3-LDP fusion proteins were administered at doses of 0.06 and 10 mg/kg, respectively. The combination of CDR3-LDP (10 mg/kg) fusion protein with CDR3-LDP-AE (0.25 and 0.5 mg/kg) was also administered. All treatments were administered by intravenous injection into the tail vein in 200 ml of sterile saline solution. The experiment was terminated at day 11, and the tumors were excised and weighed. The mean tumor weight was calculated and the results were expressed as the mean ± standard deviation. The tumor inhibition rate was calculated by: 1 - Tumor weight (treated) / tumor weight (control) × 100.
Statistical methods
Results of quantitative data in this study were presented as the mean ± standard deviation. Significant differences between two values were determined using the Student’s t-test. P<0.05 was considered to indicate a statistically significant difference.
Results
Expression and purification of CDR3-LDP and CDR3-LDP-CDR3 fusion proteins
As shown in Fig. 1, the recombinant plasmids pET-CDR3-LDP and pET-CDR3-LDPCDR3 were constructed. The plasmid were transferred to E.coli BL21 (DE3) for expression. Following cultivation for 4 h at 30°C and induction by 0.2 mM IPTG for an additional 3 h, the cultures were collected and washed with Tris-HCl buffer. Cultures were then treated with ultrasound to break down the cells. The supernatant was collected and loaded onto an Ni-affinity column for purification. SDS-PAGE was used to analyze the purified CDR3-LDP and CDR3-LDP-CDR3 fusion proteins. As shown in Fig. 2, the CDR3-LDP fusion protein migrated at a molecular weight of 15000 Da, while that of CDR3-LDP-CDR3 was 18,000 Da. These findings were in accordance with the theoretical prediction. Western blot analysis using anti-His tag antibody confirmed that the (His)6 tag was introduced into the fusion protein successfully.
Affinity assay
ELISA was used to determine the binding of the CDR3-LDP and CDR3-LDP-CDR3 fusion proteins with antigen gelatinases. As shown in Fig. 3, no difference in affinity activity between fusion proteins CDR3-LDP and CDR3-LDP-CDR3 with gelatinases was observed; their affinity constant Kd values were 5.78×10−6 and 6.563×10−6 M, respectively. By contrast, the binding affinity of the CDR3-LDP fusion protein with gelatinases was relatively higher compared with that of the CDR3-LDP-CDR3 protein. The reason for this may be that the two CDR3 domains did not have a synergistic effect on binding with gelatinases, and the fused (His)6 tag may also have had a negative impact on antigen binding, thus resulting in that the binding activity of CDR3-LDP-CDR3 did not exhibit a higher affinity compared with that of CDR3-LDP. As the volu-metric productivity of the CDR3-LDP-CDR3 fusion protein expressed in E.coli in a soluble form was lower compared with that of CDR3-LDP and did not demonstrate enhanced binding activity with gelatinases, the CDR3-LDP fusion protein was chosen for the following investigation.
Immunofluorescence assay
Immunofluorescence was used to investigate the binding specifity of the CDR3-LDP fusion protein with HepG2 cells in vitro. As shown in Fig. 4, the CDR3-LDP fusion protein was able to bind well with HepG2 cells, indicating their gelatinases were abundantly expressed around the cell membrane.
Flow cytometry analysis of CDR3-LDP with tumor cells
Flow cytometry was conducted to further testify that the attachment of the CDR3-LDP domain was capable of improving the binding of LDP with tumor cells. As shown in Fig. 5, compared with the FITC-labeled BSA and LDP protein, the FITC-labeled CDR3-LDP was able to enhance the binding intensity with tumor cells; the attachment of a single CDR3 domain increased the binding of LDP with tumor cells.
The assembly of CDR3-LDP fusion protein with lidamycin AE
To establish the potent antitumor activity of CDR3-LDP, the assembly procedure was performed. As shown in Fig. 6A, the RP-HPLC chromatogram indicated that the purity of purified CDR3-LDP was >90%, which satisfied the requirements of the experiment. Following AE assembly, the enediyne-energized CDR3-LDP-AE fusion protein was obtained. As shown in Fig. 6B, an additional peak was evident in the chromatogram and the retention time was ∼7.3 min, which was similar to that of our previous study (10).
MTT assay
The MTT assay was used to determined enediyneenergized CDR3-LDP-AE fusion protein cytotoxicity to Bel-7402 and HepG2 cells. As shown in Fig. 7, CDR3-LDP demonstrated extremely potent cytotoxicity to tumor cells; the IC50 values for Bel-7402 and HepG2 cells were 1.05×10−11 and 6.6×10−14 M, respectively. By contrast, the IC50 values of lidamycin to Bel-7402 and HepG2 cells were 5.6×10−10 and 4.2×10−11 M, respectively. The enhancement in cytotoxicity of CDR3-LDP-AE may be related to the increased binding capability with tumor cells compared with that of lidamycin.
In vivo animal experiment
To evaluate the antitumor efficiency of CDR3-LDP-AE in vivo and to further demonstrate that the combined therapy of fusion protein with enediyne-energized fusion protein augmented the antitumor effect in vivo as observed in our previous study (10), the H22 cell xenografts in mice were used to evaluate the antitumor efficiency of fusion proteins CDR3-LDP and CDR3-LDP-AE, both alone and in combination.
As shown in Table I, 10 mg/kg CDR3-LDP had an inhibition rate of 50%, which indicated that the fusion protein alone exerted certain antitumor effects. Following assembly with AE, 0.25 and 0.5 mg/kg enediyne-energized CDR3-LDP-AE fusion protein demonstrated tumor inhibition rates of 78.8 and 87.1%, respectively (P<0.05 compared with those of CDR3-LDP and lidamycin). This indicated that the assembly of AE improved the antitumor efficacy of the CDR3-LDP fusion protein, and also suggested that the attachment of CDR3 domain increased the accumulation of lidamycin at the tumor site. The combination of CDR3-LDP (10 mg/kg) and CDR3-LDP-AE (0.25 and 0.5 mg/kg) further augmented the tumor inhibitory efficiency; the tumor inhibition rates were increased to 85.2 and 92.7%, respectively (P<0.05 compared with CDR3-LDP-AE). The increase in antitumor efficacy was not accompanied with a loss of body weight, which indicated that the combined therapy was effective and further improved the antitumor efficacy.
Table IThe tumor growth inhibition effects of fusion protein CDR3-LDP, CDR3-LDP-AE and their combination on hepatoma 22 cells in mice. |
Discussion
Lidamycin is a potent antitumor antibiotic, which consisted of a protecting apoprotein and a highly active enediyne chromophore. The apoprotein and the chromophore may be detached and reassembled under certain conditions (6,15). Taking advantage of the targeting property of antibodies or antibody fragments, types of chimeric fusion proteins, composed of antibody fragments and apoprotein, were created and then reassembled with the detached chromophore (6–9). In the present study, two fusion proteins CDR3-LDP and CDR3-LDP-CDR3, composed of a heavy-chain CDR3 domain fused with the lidamycin apoprotein, were designed. The aim of the study was to develop a targeting fusion protein with a lowered immunogenicity. As observed, both CDR3-LDP and CDR3-LDP-CDR3 were easily expressed in E.coli, and mainly existed in the soluble form. However, the volumetric productivity of CDR3-LDP-CDR3 was relatively lower compared with that of CDR3-LDP, and was easy to deposit, which may have been due to the addition of a further CDR3 domain and thus the increase in hydrophobicity. The results of the ELISA suggested that there was no significant difference in the binding activity between CDR3-LDP and CDR3-LDP-CDR3 fusion proteins. The addition of a further CDR3 domain failed to increase the binding activities. Therefore, for the development of this type of lidamycin fusion protein, it is necessary to consider the negative influences of steric hindrance or the existence of His tag on the affinity property of oligopeptide. However, the ELISA is relatively accurate approach to determine the affinity activity, which may be determined by surface plasmon resonance (SPR) or other more accurate equipment (16,17). As the CDR3-LDP-CDR3 fusion protein did not demonstrate improved binding activity, the CDR3-LDP fusion protein was chosen to perform the following investigations.
The results of ELISA and immunofluorescence demonstrated that the CDR3-LDP fusion protein could bind well with the tumor cells, and the results of FACS further confirmed that the CDR3 domain increased the binding of LDP with tumor cells. Following AE assembly, the enediyne-energized CDR3-LDP-AE fusion protein displayed more potent cytotoxicity activity to tumor cells compared with lidamycin, this may have been due to the increased binding capability of CDR3-LDP-AE with tumor cells, as the protein was fused with a tumor-binding oligopeptide CDR3 domain. Notably, in the mouse model for the transplantation of H22 cells, 10 mg/kg CDR3-LDP fusion protein alone had moderate antitumor efficiency, and this was similar to the in vivo result of apoprotein produced by genetic engineering (18). The lidamycin apoprotein does not merely act as a carrier of chromophore; its antitumor mechanism requires further elucidation. Following the assembly of the chromophore with CDR3-LDP, the assembly product CDR3-LDP-AE demonstrated enhanced antitumor efficiency. Additionally, the combination of a large concentration of fusion protein CDR3-LDP and a small concentration of enediyne-energized CDR3-LDP-AE fusion protein further augmented the antitumor effect, indicating that the combined therapeutic strategy was effective and has further potential for the development of fusion protein containing lidamycin apoprotein. This strategy would enhance the antitumor effect without being accompanied with an increase in side effects. As the molecular weight of CDR3-LDP was ∼15000 Da, the immunogenicity of CDR3-LDP may be greatly lower compared with that of dFv-LDP-AE as demonstrated previously (10). However, the binding activity of CDR3-LDP was ∼100-fold lower compared with that of dFv-LDP. Although the higher affinity does not negate superior tumor targeting capability (12), it has been demonstrated that the higher the affinity, the lower the tumor penetrating ability (19,20). Therefore, in the development of a lidamycin fusion protein, our long-term aim was to design a tumor-targeting peptide or antibody fragment, and select the fusion protein with lower immunogenicity, and stronger tumor targeting and penetrating properties for further development. Our efforts should also be directed toward the development of a novel administrative approach or the humanization of antibodies.
Acknowledgements
This study was supported by the National Natural Science Foundation of China (Grant Nos. 81201765 and 40901125).
References
Björklund M and Koivunen E: Gelatinase-mediated migration and invasion of cancer cells. Biochim Biophys Acta. 1755:37–69. 2005.PubMed/NCBI | |
Kallakury BV, Karikehalli S, Haholu A, Sheehan CE, Azumi N and Ross JS: Increased expression of matrix metalloproteinases 2 and 9 and tissue inhibitors of metalloproteinases 1 and 2 correlate with poor prognostic variables in renal cell carcinoma. Clin Cancer Res. 7:3113–3119. 2001. | |
Svagzdys S, Lesauskaite V, Pangonyte D, Saladzinskas Z, Tamelis A and Pavalkis D: Matrix metalloproteinase-9 is prognostic marker to predict survival of patients who underwent surgery due to rectal carcinoma. Tohoku J Exp Med. 223:67–73. 2011. View Article : Google Scholar : PubMed/NCBI | |
Kessenbrock K, Plaks V and Werb Z: Matrix metalloproteinases: regulators of the tumor microenvironment. Cell. 141:52–67. 2010. View Article : Google Scholar | |
Escaff S, Fernández JM, González LO, et al: Comparative study of stromal metalloproteases expression in patients with benign hyperplasia and prostate cancer. J Cancer Res Clin Oncol. 137:551–555. 2011. View Article : Google Scholar : PubMed/NCBI | |
Shao RG and Zhen YS: Enediyne anticancer antibiotic lidamycin: chemistry, biology and pharmacology. Anticancer Agents Med Chem. 8:121–131. 2008. | |
Guo XF, Zhu XF, Shang Y, Zhang SH and Zhen YS: A bispecific enediyne-energized fusion protein containing ligand-based and antibody-based oligopeptides against epidermal growth factor receptor and human epidermal growth factor receptor 2 shows potent antitumor activity. Clin Cancer Res. 16:2085–2094. 2010. View Article : Google Scholar | |
Xin C, Ye S, Ming Y, et al: Efficient inhibition of B-cell lymphoma xenografts with a novel recombinant fusion protein: anti-CD20Fab-LDM. Gene Ther. 17:1234–1243. 2010. View Article : Google Scholar : PubMed/NCBI | |
Zhong GS, Wu MN, Guo XF, Zhang SH, Miao QF and Zhen YS: Antitumor activities of dFv-LDP-AE: An enediyne-energized fusion protein targeting tumor-associated antigen gelatinases. Oncol Rep. 28:1193–1199. 2012. | |
Zhong G, Zhang S, Li Y, Liu X, Gao R, Miao Q and Zhen Y: A tandem scFv-based fusion protein and its enediyne-energized analogue show intensified therapeutic efficacy against lung carcinoma xenograft in athymic mice. Cancer Lett. 295:124–133. 2010. View Article : Google Scholar | |
Lowe DC, Gerhardt S, Ward A, et al: Engineering a high-affinity anti-IL-15 antibody: crystal structure reveals an α-helix in VH CDR3 as key component of paratope. J Mol Biol. 406:160–175. 2011.PubMed/NCBI | |
Qiu XQ, Wang H, Cai B, Wang LL and Yue ST: Small antibody mimetics comprising two complementarity-determining regions and a framework region for tumor targeting. Nat Biotechnol. 25:921–929. 2007. View Article : Google Scholar : PubMed/NCBI | |
Guo XF, Zhong GS, Miao QF and Zhen YS: Construction of energized fusion protein consisting of epidermal growth factor receptor oligopeptide ligand and lidamycin and its antitumor activity. Ai Zheng. 28:561–568. 2009.(In Chinese). | |
Miao QF, Shang B, Ouyang Z, Liu X and Zhen Y: Generation and antitumor effects of an engineered and energized fusion protein VL-LDP-AE composed of single-domain antibody and lidamycin. Sci China C Life Sci. 50:447–456. 2007. View Article : Google Scholar : PubMed/NCBI | |
Shao RG and Zhen YS: Relationship between the molecular composition of C1027, a new macromolecular antibiotic with enediyne chromophore, and its antitumor activity. Yao Xue Xue Bao. 30:336–342. 1995.(In Chinese). | |
Ashish B and Murthy GS: Analysis of human chorionic gonadotropin-monoclonal antibody interaction in BIAcore. J Biosci. 29:57–66. 2004. View Article : Google Scholar : PubMed/NCBI | |
Quinn JG and O’Kennedy R: Biosensor-based estimation of kinetic and equilibrium constants. Anal Biochem. 290:36–46. 2001. View Article : Google Scholar : PubMed/NCBI | |
Ru Q, Shang BY, Miao QF, Li L, Wu SY, Gao RJ and Zhen YS: A cell penetrating peptide-integrated and enediyne-energized fusion protein shows potent antitumor activity. Eur J Pharm Sci. 47:781–789. 2012. View Article : Google Scholar : PubMed/NCBI | |
Adams GP, Schier R, McCall AM, et al: High affinity restricts the localization and tumor penetration of single-chain Fv antibody molecules. Cancer Res. 61:4750–4755. 2001.PubMed/NCBI | |
Carter PJ: Potent antibody therapeutics by design. Nat Rev Immunol. 6:343–357. 2006. View Article : Google Scholar : PubMed/NCBI |