Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-2015 Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2015 Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Expression of P‑gp in acute myeloid leukemia and the reversal function of As2O3 on drug resistance

  • Authors:
    • Feng Gao
    • Wanwei Dong
    • Wei Yang
    • Jia Liu
    • Zhihong Zheng
    • Kailai Sun
  • View Affiliations / Copyright

    Affiliations: Department of Genetics, China Medical University, Shenyang, Liaoning 110001, P.R. China, Laboratory Animal Center, China Medical University, Shenyang, Liaoning 110001, P.R. China
  • Pages: 177-182
    |
    Published online on: November 10, 2014
       https://doi.org/10.3892/ol.2014.2692
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

To study the expression of P‑glycoprotein (P‑gp) and the reversal function of As2O3, the active ingredient of arsenic, on drug resistance in acute myeloid leukemia (AML) patients, P‑gp and cluster of differentiation 34 (CD34) were examined in primary mononuclear and resistant cells, with or without As2O3. In addition, multidrug resistance gene 1 (MDR1) mRNA expression was investigated in K562/D cells and AML patients. In total, 28.6% of newly‑treated (NT) patients and 59.1% of relapsed/refractory (RR) patients were P‑gpfunction+, and 31.7% of NT patients and 59.1% of RR patients were CD34+. The positivity rate of P‑gpfunction and CD34+ expression in the RR group were significantly higher compared with that in the NT group (P<0.05). In addition, higher CD34+, P‑gpexpression+ and P‑gpfunction+ values were observed in older patients compared with younger patients. MDR1 expression was downregulated in certain patients following treatment with AS2O3. In the present study, the overexpression of P‑gp was the primary cause of drug resistance in the AML patients, and MDR1 expression was downregulated by As2O3 in primary leukemia and drug‑resistant cells.

Introduction

In general, the treatment of leukemia consists of chemotherapy and bone marrow transplantation. Clinically, 60–80% of acute myeloid leukemia (AML) patients experience complete remission following routine chemotherapy treatment (1), however, numerous patients relapse. The proportion of relapsed/refractory (RR) patients increases with age (2). Gao et al observed that the expression of P-glycoprotein (P-gp) in RR patients was higher than that in treatment-sensitive patients (3). Therefore, the overexpression of P-gp is considered to be the primary cause of multidrug resistance (MDR) in patients with AML. P-gp functions as an ATP-dependent membrane protein, and is principally expressed in excretory tissues located in the placenta, kidneys, liver, intestines, blood brain barrier and blood testes barrier. P-gp is involved in the absorption, distribution and excretion of drugs, xenobiotics and endogenous compounds (4). At present, research into the reversal of MDR in leukemia is primarily aimed at identifying reversal agents that target ATP-binding membrane proteins. Verapamil (VRP) and cyclosporine A (CsA) have been extensively studied in the clinic and the laboratory as potential reversal agents. The therapeutic mechanism of VRP for MDR is the competition with anticarcinogens for the associated binding sites of P-gp, which increases the retention of anticarcinogens in cells (5). CsA, and its derivative, PSC-833, can bind to P-gp in a competitive manner to prevent MDR (6). However, severe side-effects are a common feature of these reversal agents, therefore, their clinical application is restricted. Emerging biotechnologies such as small interfering RNA and P-gp antibodies, which target the function and expression of P-gp, have been successful, but are currently in the early stages of research (7,8). During the differentiation of leukemia cells, CD34 is expressed in AML malignant cells, while the expression P-gp is decreased (9,10). Whether CD34 levels correlate with the expression or function of P-gp remains unclear (11). In recent years, the majority of studies have focused on the treatment of tumors. Arsenic, also known as arsenic trioxide in China, is a traditional Chinese medicine that has been used for >2,000 years. The active ingredient of arsenic, As2O3, was used for the treatment of psoriasis, rheumatism, leukemia, syphilis and hemorrhoids several centuries ago. The first report of As2O3 therapy for acute promyelocytic leukemia (APL), a subtype of AML, was in the early 1970s. A research group from the Harbin Medical University of China (Harbin, Heilongjiang, China) identified that intravenous infusions of Ailing-1, a crude solution of As2O3 and trace amounts of mercury, could be used as a treatment for APL (12–14). Subsequently, researchers at the Shanghai Institute of Hematology (Shanghai, China) demonstrated that As2O3 could induce APL cell apoptosis and differentiation (15–17). Currently, As2O3 is used extensively as a treatment for APL and solid tumors in the clinic. A Chinese study that investigated the mechanism of As2O3 for the treatment of APL was published in 2010 (18). The results revealed that As2O3 upregulates the degradation of an oncogenic protein involved in APL cell proliferation. In addition, other previous studies have demonstrated that As2O3 is effective in the treatment of cancer stem cells, and reverses drug resistance in tumor cells (19,20). However, the mechanism behind this action of As2O3 remains unclear. At present, AML is only treated with As2O3 when chemotherapeutics are deemed ineffective. Furthermore, As2O3 is not used as a resistance reversal agent in clinical treatment. The present study aimed to investigate the expression and functional changes of P-gp in AML cells, in order to reveal the role of As2O3 in the reversal of drug resistance in leukemia cells.

Materials and methods

Cell culture and patient samples

K562/D and K562/S drug-resistant cells were maintained in RPMI 1640 medium (GIBCO, Los Angeles, CA, USA) with 10% fetal bovine serum, 100 U/ml penicillin and 100 μg/ml streptomycin, in a humidified atmosphere at 37°C with 5% CO2. The primary mononuclear cells were separated from nine AML patients and maintained in RPMI 1640 medium in the conventional manner (21). The primary mononuclear and K562/D and K562/S cells were divided into two groups; a medication group receiving 1μM As2O3 and a control group receiving no As2O3. In total, 85 AML patients (59 males and 26 females) from the First Affiliated Hospital of China Medical University (Shenyang, China), and the Department of Hematology in the 202 Hospital of the People’s Liberation Army of China (Shenyang, China), were included in the present study. The mean age of the patients was 41.8 years (range, 18 to 79 years). The present study was performed in accordance with the ethical standards of the 1975 Declaration of Helsinki, as revised in 2000, and was approved by the Institutional Review Boards of the aforementioned hospitals. Written informed consent was obtained from all patients.

Reagents

Rhodamine 123 (RH123) and CsA were purchased from Sigma-Aldrich (St. Louis, MO, USA). The mouse anti-human monoclonal antibodies against UIC2 and cluster of differentiation 34 (CD34) were purchased from Immunotech (Marseille, France). TRIzol and Lipofectamine 2000 transfection reagents were purchased from Invitrogen (Carlsbad, CA, USA). The diethylpyrocarbonate and Reverse Transcription System were obtained from Promega (Madison, WI, USA).

Separation of peripheral blood mononuclear cells

In total, 85 AML patients consisting of 2, 8, 37, 15, 19, 3 and 1 case/s were classified with the M0, M1, M2, M4, M5, M6, and M7 AML subtypes, respectively according to the French-American-British classification system (22). The patients were divided into two groups, consisting of either newly-treated (NT) patients (63 cases) or RR patients (22 cases). Samples of 3–5 ml of blood or marrow (immature leukemia cells >70%) were collected from the patients. The mononuclear cells were prepared using the Ficoll-Hypaque technique. Certain cells were used for detecting the expression of P-gp and CD34 by immunocytochemistry, and others were used to detect the function of P-gp.

Expression of P-gp and CD34 detected by immunocytochemistry

The K562/S and K562/D cells were fixed by incubation in cold acetone for 10 min, and then incubated with 20 μl of mouse anti-human monoclonal JSB-1 (Maixin Biotechnology, Fuzhou, China) and mouse anti-human monoclonal CD34 antibodies (Immunotech) (5 μg/ml) at 4°C overnight. The following day, the biotin-conjugated rabbit anti-mouse IgG secondary antibody (Maixin Biotechnology) and alkaline phosphatase-conjugated streptavidin complex were added, and the samples were incubated at 37°C for 30 min. The samples were then stained with hematoxylin for 2 min, and the slides were examined using an optical microscope. The cells positive for the expression of P-gp and CD34 exhibited a red color in the cell membrane and cytoplasm, and the cells negative for P-gp and CD34 expression were counterstained blue. Positive P-gp and CD34 expression was confirmed by a positive cell number of >20% (in 500 cells).

P-gp function detected by flow cytometry (FCM)

The leukemia cells isolated from the AML patients, and the K562/D cells, were divided into two groups, receiving either treatment with 200 ng/ml RHl23 and 5 μg/ml CsA or treatment with 200 ng/ml RHl23 only, as a control. Subsequent to the incubation of all cells with RH123 at 37°C for 60 min, 10,000 cells were analyzed by FCM (FACScan; Becton Dickinson, Franklin Lakes, NJ, USA) at a wavelength of 490 nm. An accumulation of >30% indicated a positive result.

Expression of P-gp in patients treated with As2O3

In three cases, the patients were treated with a dose of 10 mg As2O3 daily. The mononuclear cells were isolated from the peripheral blood or bone marrow of the patients following As2O3 treatment for five days. The total RNA was isolated by TRIzol reagent according to the manufacturer’s instructions (Invitrogen), and cDNA was reverse transcribed from the isolated mRNA using an AMV RNA PCR kit (Takara Bio, Inc., Shiga, Japan), in line with the standard operating procedure. The MDR1 mRNA primers and probe were as follows: Forward, 5′-CCCTTCAGTGGCTGGTACAT-3′ and reverse, 5′-ACCGCGATATTGATCTCCAC-3′; and TaqMan probe, 5′-FCCGATCCATGCTCAGACAGGATGTGAP-3′. Each polymerase chain reaction (PCR) (25 μl) contained 5 μl 5× buffer, 0.5 μl MgCl2 (250 mmol/l), 0.75 μl dNTPs (10 mmol/l), 1 μl TaqMan primers (10 μmol/l, each), 0.6 μl probe (5 μmol/l), Taq polymerase (1.25 units, ABI; Life Technologies, Paisley, UK), 1 μl cDNA sample and 14.9 μl ddH2O. The PCR parameters were as follows: 50°C for 2 min and 94°C for 2 min, followed by 40 cycles at 94°C for 15 sec and 60°C for 40 sec. The standard recombinant plasmid was diluted into five gradients and constructed as the reference standard, and the PCR without a patient sample was used as the negative control. The results were analyzed using the standard software provided with the ABI 7900HT Fast Real-Time PCR System (Life Technologies). All measurements were performed at least three times.

Statistical analysis

Statistical analysis was performed using SPSS 17.0 (SPSS, Inc., Chicago, IL, USA). Statistical significance was determined by a one-way analysis of variance and Student’s t-test. Correlation between CD34 expression, P-gp expression and patient age was analyzed by Spearman’s rank correlation. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of CD34 and P-gp, and functional analysis of P-gp in AML

The expression and function of P-gp in the leukemia cells from the AML patients was assessed using immunocytochemistry (Figs. 1 and 2). In total, 23 of 63 (36.5%) NT patients and 11 of 22 (50%) RR patients were P-gpexpression+. However, no statistically significant difference was identified between the two groups. Furthermore, 18 of 63 (28.6%) NT patients and 13 of 22 (59.1%) RR patients were P-gpfunction+. The positivity rate of P-gpfunction was significantly higher in the RR group than in the NT group (P<0.05). In addition, P-gpexpression demonstrated a positive correlation with P-gpfunction (P=0.0001, r=0.579).

Figure 1

Immunocytochemical fluorescence results showing the expression of cluster of differentiation 34 (CD34) and P-glycoprotein (P-gp) in the (A) K562/D and (B) K562/S cells. Red indicates the expression of P-gp and blue indicates the counterstain of the nucleus. The (C) positive and (D) negative expression of P-gp in the AML cells, and the (E) positive and (F) negative expression of CD34 in the AML cells is also shown. AML, acute myeloid leukemia.

Figure 2

Expression and function of P-gp detected with flow cytometry. The expression of P-gp in the (A) K562/S and (B) K562/D cells, and the expression of P-gp function in the (C) K562/S and (D) K562/D cells. (E) Negative and (F) positive P-gp function observed in the AML cells of the patients. (A–D) In the expression analysis, the blue solid line is the blank control, the pink peak is the secondary antibody only (negative control) and the blue dashed line indicates the experimental group. (E and F) In the functional analysis, the blue solid line is the blank control, the blue dashed line indicates the cells that were treated with RH123 and cyclosporin A, and the pink line indicates the negative control (cells that were only treated with RH123). P-gp, P-glycoprotein; AML, acute myeloid leukemia.

In order to analyze the correlation between CD34 and P-gp expression, the expression of CD34 was investigated using immunocytochemistry (Fig. 1E and F). The results demonstrated that 20 of 63 (31.7%) patients in the NT group, and 13 of 22 (59.1%) in the RR group, were CD34+. The expression of CD34 in the RR group was significantly higher than that in the NT group (P<0.05). In addition, CD34 expression was positively correlated with P-gpfunction (P=0.0001, r=0.579) and P-gpexpression (P=0.0001, r=0.483).

To analyze the correlation between CD34 expression, P-gp expression and function, and patient age, a total of 85 AML patients were divided into two groups, consisting of patients either <50 years old or ≥50 years old. The results revealed that 8 of 46 (17.4%), 12 of 46 (26.1%) and 9 of 46 (19.6%) NT patients in the <50 years group were CD34+, P-gpexpression+ and P-gpfunction+, respectively. Furthermore, 11 CD34+ cases (64.7%), 11 P-gpexpression+ cases (64.7%) and nine P-gpfunction+ cases (52.9%) were found in 17 NT patients from the ≥50 years group. Notably, those patients ≥50 years had a significantly higher CD34+, P-gpexpression+ and P-gpfunction+ values compared with those <50 years (P<0.05).

Effect of MDR1 mRNA in K562/D cells and AML patients treated with As2O3

Out of a total of 85 AML patients, MDR1 mRNA was detected in three patients positive for P-gp expression following As2O3 treatment, and in nine cases of primary mononuclear leukemia cells following As2O3 treatment. The quantitative PCR results demonstrated that the expression of MDR1 mRNA in the three patients was significantly downregulated following treatment with As2O3 (P<0.05; Table I). Significant downregulation of the MDR1 mRNA expression was also observed in eight cases of primary mononuclear leukemia cells following treatment with As2O3 (P<0.05). Furthermore, the MDR1 mRNA expression level decreased 2.3-fold in the K562/D cells following treatment with As2O3.

Table I

Expression of MDR1 mRNA before and after As2O3 treatment.

Table I

Expression of MDR1 mRNA before and after As2O3 treatment.

MDR1 mRNA expression

SamplesBeforeAfter
1 5.7×10−3 3.8×10−3
2 2.5×10−4 2.4×10−4
3 8.0×10−2 1.4×10−2
4 9.0×10−4 3.7×10−4
5 1.3×10−3 1.2×10−3
6 1.7×10−3 7.8×10−3
7 2.2×10−3 3.7×10−3

[i] MDR1, multidrug resistance gene 1.

Effect of P-gp expression and function in K562/D cells following treatment with As2O3

Using FCM, it was observed that the expression of P-gp decreased following four days of treatment with 1μM As2O3. The fluorescence intensity of P-gp decreased by 30.5%, whereas the intensity of RH123 increased by 38.1% (P<0.05). Therefore, it was concluded that As2O3 could prolong drug release in the K562/D cells by inhibiting the expression of P-gp and attenuating drug elimination, which is attributable to the function of P-gp.

Discussion

The present study identified that P-gp, involved in drug resistance, was expressed in AML cells, and that As2O3 could reverse the drug resistance in P-gp-expressing leukemia cells. A previous study demonstrated that the expression of P-gp in RR AML patients was higher than that in NT patients (23). However, using FCM, the present study identified extremely few cases of positive P-gp expression (data not shown). P-gpfunction, however, was found to be higher in RR patients than in the NT patients. The expression of P-gp, detected by immunocytochemistry, demonstrated no significant difference between the two patient groups, however, P-gpexpression was revealed to be positively correlated with P-gpfunction. Therefore, it was hypothesized that immunocytochemistry and FCM may not have been sensitive enough to detect the expression of P-gp in the present study.

Previous studies identified that leukemia cells exist as differentially-phased subgroups of cells (24–26). Certain leukemia cells can reproduce and have long-term proliferation abilities. Others possess a finite capacity to replicate and eventually differentiate into immature leukemia cells, which account for the majority of malignant cells; these express the CD34 in the AML subgroup cells (1). The positivity rate of P-gp expression, and the function of P-gp, demonstrated a downward trend during the CD34+/CD33−, CD34+/CD33+ and CD34−/CD33+ cell maturation processes. The present study identified that the expression of CD34 was positively correlated with P-gpfunction and P-gpexpression. Furthermore, CD34 had a higher P-gp positivity rate in the RR patient group. Therefore, it was concluded that the reason for the increase in the P-gp positivity rate observed in the RR patient group was due not to induction by chemotherapeutics, but to the elimination of leukemia cells that were sensitive to treatment, which allowed the CD34+/P-gp+ subgroup of cells to preferentially proliferate. Therefore, it is important to determine whether it is feasible to use an inhibitor of P-gp during the initial treatment with chemotherapy, so as to eliminate the malignant clone of P-gp+ cells and avoid MDR caused by long-term chemotherapy. A previous study (27) found that the positivity rates of P-gp expression and function increased with increasing patient age. In the present study, it was revealed that the expression of CD34 and P-gp, and the function of P-gp, were significantly different between the <50-year-old and ≥50-year-old patient groups. In addition, older patients demonstrated an increased P-gp positivity rate. Older patients are often treated with lower doses of drugs in order to reduce side-effects and complications in clinical therapy. Unfortunately, these lower doses can affect treatment outcomes and prognosis. Therefore, it will be critical to detect the function of P-gp as early as possible in order to provide a rational and efficacious treatment.

Previous studies have demonstrated that As2O3 could reverse anticancer drug resistance by inhibiting the expression of P-gp (28,29). The present study investigated the expression of MDR1 using quantitative PCR prior to and subsequent to treatment with As2O3 in three RR AML patients. The expression of MDR1 was inhibited by As2O3 in vivo. Due to the small number of As2O3 treatment cases in clinical therapy, primary mononuclear leukemia cells positive for P-gp expression were cultured from nine AML patients and analyzed for changes in MDR1 expression following treatment with As2O3. According to quantitative PCR, the expression of MDR1 was significantly downregulated following treatment with As2O3.

The drug-resistant cell line used in the present study, K562/D, was induced by Adriamycin (ADM). This cell line has typical MDR characteristics and is resistant to a number of chemotherapeutics, such as ADM, daunorubicin and vincristine (VCR). Compared with K562 wild-type cells, K562/D cells possess ~160 and 500 times greater drug resistance to ADM and VCR, respectively (30). Therefore, the K562/D cell line is an appropriate model to study the role of P-gp expression in AML drug resistance. In the present study, the expression and function of P-gp were significantly downregulated in the K562/D cells following As2O3 treatment, as detected by FCM. The K562/D cell line has commonly been used to examine the function of the P-gp ion pump (31). The overexpression of P-gp can result in a lower drug concentration in the cells, and as observed in the present study, the RH123 fluorochrome is pumped out the cells as the substrate. The experimental results demonstrated that As2O3 could inhibit the expression of P-gp in primary mononuclear and drug-resistant cells. The results of the present study demonstrate that As2O3 has the potential to reverse drug resistance, and therefore should not only be used when chemotherapeutics prove ineffective, but also as a resistance reversal agent used in coordination with other chemotherapeutics. These results provide support for the therapeutic development and application of As2O3. The mechanism of As2O3-mediated P-gp inhibition warrants further investigation.

Acknowledgements

This study was supported by grants from the Natural Science Foundation of China (no. 30928008) and the Science and Technology Projects of Liaoning Province (no. 2008408002-2).

References

1 

Thomas H and Coley HM: Overcoming multidrug resistance in cancer: an update on the clinical strategy of inhibiting p-glycoprotein. Cancer Control. 10:159–165. 2003.PubMed/NCBI

2 

Leith CP, Chen IM, Kopecky KJ, Appelbaum FR, Head DR, Godwin JE, Weick JK and Willman CL: Correlation of multidrug resistance (MDR1) protein expression with functional dye/drug efflux in acute myeloid leukemia by multiparameter flow cytometry: identification of discordant MDR−/efflux+ and MDR1+/efflux− cases. Blood. 86:2329–2342. 1995.PubMed/NCBI

3 

Gao FZM, Liu Y and Sun K: Analyses of expression and function of P-glycoprotein in relapsed/refractory acute myelogenous leukemia patients. Journal of Leukemia & Lymphoma. 15:419–421. 2006.(In Chinese).

4 

Huls M, Russel FG and Masereeuw R: The role of ATP binding cassette transporters in tissue defense and organ regeneration. J Pharmacol Exp Ther. 328:3–9. 2009. View Article : Google Scholar

5 

Mahadevan D and List AF: Targeting the multidrug resistance-1 transporter in AML: molecular regulation and therapeutic strategies. Blood. 104:1940–1951. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Lopes EC, Scolnik M, Alvarez E and Hajos SE: Modulator activity of PSC 833 and cyclosporin-A in vincristine and doxorubicin-selected multidrug resistant murine leukemic cells. Leuk Res. 25:85–93. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Malmo J, Sandvig A, Vårum KM and Strand SP: Nanoparticle mediated P-glycoprotein silencing for improved drug delivery across the blood-brain barrier: a siRNA-chitosan approach. PLoS One. 8:e541822013. View Article : Google Scholar : PubMed/NCBI

8 

Aliabadi HM, Mahdipoor P and Uludağ H: Polymeric delivery of siRNA for dual silencing of Mcl-1 and P-glycoprotein and apoptosis induction in drug-resistant breast cancer cells. Cancer Gene Ther. 20:169–77. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Haase D, Feuring-Buske M, Könemann S, Fonatsch C, Troff C, Verbeek W, Pekrun A, Hiddemann W and Wörmann B: Evidence for malignant transformation in acute myeloid leukemia at the level of early hematopoietic stem cells by cytogenetic analysis of CD34+ subpopulations. Blood. 86:2906–2912. 1995.PubMed/NCBI

10 

Feller N, Schuurhuis GJ, van der Pol MA, Westra G, Weijers GW, van Stijn A, Huijgens PC and Ossenkoppele GJ: High percentage of CD34 positive cells in autologous AML peripheral blood stem cell products reflects inadequate in vivo purging and low chemotherapeutic toxicity in a subgroup of patients with poor clinical outcome. Leukemia. 17:68–75. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Samdani A, Vijapurkar U, Grimm MA, Spier CS, Grogan TM, Glinsmann-Gibson BJ and List AF: Cytogenetics and P-glycoprotein (PGP) are independent predictors of treatment outcome in acute myeloid leukemia (AML). Leuk Res. 20:175–180. 1996. View Article : Google Scholar : PubMed/NCBI

12 

Zhu J, Chen Z, Lallemand-Breitenbach V and de Thé H: How acute promyelocytic leukaemia revived arsenic. Nat Rev Cancer. 2:705–713. 2002. View Article : Google Scholar : PubMed/NCBI

13 

Sun HD, Ma L, Hu XC and Zhang TD: Ai-ling 1 treated 32 cases of acute promyelocytic leukemia. Chin J Integrat Trad Chin West Med. 12:21992.(In Chinese).

14 

Chen GQ, Zhu J, Shi XG, Ni JH, Zhong HJ, Si GY, Jin XL, Tang W, Li XS, Xong SM, et al: In vitro studies on cellular and molecular mechanisms of arsenic trioxide (As2O3) in the treatment of acute promyelocytic leukemia: As2O3 induces NB4 cell apoptosis with downregulation of Bcl-2 expression and modulation of PML-RAR alpha/PML proteins. Blood. 88:1052–1061. 1996.PubMed/NCBI

15 

Zhang PWS, Hu LH, Shi FD, Qiu FQ, Hong GJ, Han XY, Yang HF, Sun YZ, Liu YP, Zhao J and Jin ZJ: Treatment of 72 cases of acute promyelocytic leukemia with intravenous arsenic trioxide. Chin J Hematol. 5:41996.(In Chinese).

16 

Chen Z, Wang ZY and Chen SJ: Acute promyelocytic leukemia: cellular and molecular basis of differentiation and apoptosis. Pharmacol Ther. 76:141–149. 1997. View Article : Google Scholar

17 

Chen GQ, Shi XG, Tang W, Xiong SM, Zhu J, Cai X, Han ZG, Ni JH, Shi GY, Jia PM, et al: Use of arsenic trioxide (As2O3) in the treatment of acute promyelocytic leukemia (APL): I. As2O3 exerts dose-dependent dual effects on APL cells. Blood. 89:3345–3353. 1997.PubMed/NCBI

18 

Zhang XW, Yan XJ, Zhou ZR, Yang FF, Wu ZY, Sun HB, Liang WX, Song AX, Lallemand-Breitenbach V, Jeanne M, et al: Arsenic trioxide controls the fate of the PML-RARalpha oncoprotein by directly binding PML. Science. 328:240–243. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Qiang L, Yang Y, Ma YJ, Chen FH, Zhang LB, Liu W, Qi Q, Lu N, Tao L, Wang XT, et al: Isolation and characterization of cancer stem like cells in human glioblastoma cell lines. Cancer Lett. 279:13–21. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Zhao YFJ, Liang J, Chen B, Yao R, Shang Q and Wang S: MDR reversing and apoptosis inducing effects on treatment with arsenic trioxide in gastric cancer cell cine SGC7901/ADM. Clin Oncol Cancer Res. 32:32005.(In Chinese).

21 

Fuss IJ, Kanof ME, Smith PD and Zola H: Isolation of whole mononuclear cells from peripheral blood and cord blood. Curr Protoc Immunol. Chapter 7:2000.

22 

Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR and Sultan C: Proposals for the classification of the acute leukaemias. French-American-British (FAB) co-operative group. Br J Haematol. 33:451–458. 1976. View Article : Google Scholar : PubMed/NCBI

23 

Abd El-Ghaffar HA, Aladle DA, Farahat SE and Abd El-Hady N: P-glycoprotein (P-170) expression in acute leukemias. Hematology. 11:35–41. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Li X, Li J, Du W, Zhang J, Liu W, Chen X, Li H, Huang S and Li X: Relevance of immunophenotypes to prognostic subgroups of age, WBC, platelet count, and cytogenetics in de novo acute myeloid leukemia. APMIS. 119:76–84. 2011. View Article : Google Scholar

25 

Rao J, Xu DR, Zheng FM, Long ZJ, Huang SS, Wu X, Zhou WH, Huang RW and Liu Q: Curcumin reduces expression of Bcl-2, leading to apoptosis in daunorubicin-insensitive CD34+ acute myeloid leukemia cell lines and primary sorted CD34+ acute myeloid leukemia cells. J Transl Med. 9:712011. View Article : Google Scholar : PubMed/NCBI

26 

Oelschlaegel U, Mohr B, Schaich M, Schäkel U, Kroschinsky F, Illmer T, Ehninger G and Thiede C: HLA-DRneg patients without acute promyelocytic leukemia show distinct immunophenotypic, genetic, molecular, and cytomorphologic characteristics compared to acute promyelocytic leukemia. Cytometry B Clin Cytom. 76:321–327. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Gao FLY, Hou K and Sun K: The relationship between age of AML patients and expression of P-gp. Chin J Prac Int Med. 27:22007.(In Chinese).

28 

Xue YW, Han JG, Li BX and Yang BF: Reversal effect and mechanism of arsenic trioxide on multidrug resistance of gastric carcinoma cells SGC7901. Yao Xue Xue Bao. 42:949–953. 2007.(In Chinese). PubMed/NCBI

29 

Wang T, Ma LM, Zhang HP, Wang HW, Yang LH and Qiao ZH: The effect of arsenic trioxide (As2O3) combined with BSO on K562/ADM cell and its mechanisms. Zhonghua Xue Ye Xue Za Zhi. 28:438–443. 2007.(In Chinese). PubMed/NCBI

30 

Yang C and Lui S: The clinical significance of overexpression of drug-resistance genes and reversal of multidrug resistance in cancer. Bulletin of Chinese Cancer. 10:132–136. 2001.(In Chinese).

31 

Praet M, Stryckmans P and Ruysschaert JM: Cellular uptake, cytotoxicity, and transport kinetics of anthracyclines in human sensitive and multidrug-resistant K562 cells. Biochem Pharmacol. 51:1341–1348. 1996. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao F, Dong W, Yang W, Liu J, Zheng Z and Sun K: Expression of P‑gp in acute myeloid leukemia and the reversal function of As2O3 on drug resistance. Oncol Lett 9: 177-182, 2015.
APA
Gao, F., Dong, W., Yang, W., Liu, J., Zheng, Z., & Sun, K. (2015). Expression of P‑gp in acute myeloid leukemia and the reversal function of As2O3 on drug resistance. Oncology Letters, 9, 177-182. https://doi.org/10.3892/ol.2014.2692
MLA
Gao, F., Dong, W., Yang, W., Liu, J., Zheng, Z., Sun, K."Expression of P‑gp in acute myeloid leukemia and the reversal function of As2O3 on drug resistance". Oncology Letters 9.1 (2015): 177-182.
Chicago
Gao, F., Dong, W., Yang, W., Liu, J., Zheng, Z., Sun, K."Expression of P‑gp in acute myeloid leukemia and the reversal function of As2O3 on drug resistance". Oncology Letters 9, no. 1 (2015): 177-182. https://doi.org/10.3892/ol.2014.2692
Copy and paste a formatted citation
x
Spandidos Publications style
Gao F, Dong W, Yang W, Liu J, Zheng Z and Sun K: Expression of P‑gp in acute myeloid leukemia and the reversal function of As2O3 on drug resistance. Oncol Lett 9: 177-182, 2015.
APA
Gao, F., Dong, W., Yang, W., Liu, J., Zheng, Z., & Sun, K. (2015). Expression of P‑gp in acute myeloid leukemia and the reversal function of As2O3 on drug resistance. Oncology Letters, 9, 177-182. https://doi.org/10.3892/ol.2014.2692
MLA
Gao, F., Dong, W., Yang, W., Liu, J., Zheng, Z., Sun, K."Expression of P‑gp in acute myeloid leukemia and the reversal function of As2O3 on drug resistance". Oncology Letters 9.1 (2015): 177-182.
Chicago
Gao, F., Dong, W., Yang, W., Liu, J., Zheng, Z., Sun, K."Expression of P‑gp in acute myeloid leukemia and the reversal function of As2O3 on drug resistance". Oncology Letters 9, no. 1 (2015): 177-182. https://doi.org/10.3892/ol.2014.2692
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team