Open Access

Effect of combined 5-aza-2'deoxycytidine and cisplatin treatment on the P15 lung adenocarcinoma cell line

  • Authors:
    • Kaishan Liu
    • Wenyan Huang
    • Weisong Gao
    • Wenfang He
  • View Affiliations

  • Published online on: February 26, 2015     https://doi.org/10.3892/ol.2015.2986
  • Pages: 2007-2012
  • Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Aberrant promoter hypermethylation resulting in the epigenetic silencing of apoptosis‑associated genes is a key process in the chemotherapeutic treatment of cancer. The nucleoside analog, 5‑aza‑2'deoxycytidine (DAC), inhibits the activity of DNA methyltransferase enzymes and is able to restore the expression levels of genes that have been silenced by aberrant DNA methylation. The aim of the present study was to investigate the effect of combined treatment with DAC and cisplatin (CDDP) on the lung adenocarcinoma cell line, P15. Growth inhibition was examined using a clone formation assay and growth inhibitory activities by cell counting during treatment with DAC alone, CDDP alone or DAC followed by CDDP. In addition, changes in the mRNA expression levels of various apoptosis‑associated genes following treatment with increasing concentrations of DAC were determined using reverse transcription‑polymerase chain reaction. Furthermore, terminal deoxynucleotidyl transferase‑mediated dUTP nick end labeling (TUNEL) analysis was used to detect the number of apoptotic P15 tumor cells following treatment with DAC and/or CDDP. The results indicated that DAC treatment alone restored the mRNA expression levels of p73, p16INK4a, B‑cell lymphoma (Bcl)‑2‑associated agonist of cell death and Bcl‑2‑associated X protein. In addition, combined therapy with DAC and CDDP was found to significantly suppress the growth of P15 tumor cells compared with DAC or CDDP treatment alone. In conclusion, DAC may enhance the chemosensitivity of the P15 cell line to treatment with CDDP.

Introduction

Lung cancer is a leading cause of cancer-associated mortality worldwide and the most common type is non-small cell lung cancer (NSCLC) (1). Despite progress in the development of molecular-targeted therapeutic agents and surgical approaches, chemotherapy remains an important strategy for the treatment of NSCLC. A combination of a next-generation cytotoxic agents and a platinum compound is the standard treatment regimen for patients with advanced NSCLC (2,3). The cytotoxicity of cisplatin (CDDP), a platinum compound used in chemotherapy, is predominantly due to its interaction with DNA, forming DNA adducts that result in the activation of a number of apoptosis signaling pathways (4). However, the resistance of NSCLC cells to CDDP, which is currently a barrier in the treatment of patients with NSCLC, is associated with inactivation of these apoptosis signaling pathways (5,6).

In tumor cells, numerous apoptosis-associated genes appear to have methylated CpG islands. DNA methylation is a crucial regulator in various biological processes; however, aberrant CpG island hypermethylation in gene promoter regions may impact the cell cycle, proliferation, apoptosis, metastasis, drug resistance and intracellular signaling. Therefore, the occurrence of this aberrant hypermethylation is important in carcinogenesis and cancer treatment. DNA hypermethylation is an epigenetic modification that leads to the transcriptional silencing of regulatory genes in various types of human cancer. Furthermore, DNA methyltransferase (DNMT) enzymes are critical for the maintenance of normal DNA methylation (7,8).

The expression of apoptosis-associated genes, which is silenced by aberrant DNA hypermethylation, can be restored by the pyrimidine nucleoside analog of cytosine, 5-aza-2′deoxycytidine (DAC) (9,10). The loss of DNA hypermethylation occurs through the formation of a covalent complex between DAC and DNMTs (11). Therefore, the clinical application of DAC in the treatment of patients with myelodysplastic syndrome (MDS) resulted in significant demethylation of apoptosis-associated genes in certain cases (12).

The aim of the present study was to evaluate the effect of combined therapy with DAC and CDDP on the human lung adenocarcinoma cell line, P15. In addition, the mRNA expression levels of six associated genes, including p73, B-cell lymphoma (Bcl)-xL; Bcl-2-associated agonist of cell death (BAD); Bcl-2-associated X protein (Bax), p14ARF and p16INK4a, were analyzed.

Materials and methods

Cell culture and DAC treatment

The P15 cell line, which is derived from lung adenocarcinoma, was obtained from the Center for Experimental Animals of Sun Yat-sen University (Guangzhou, China). P15 cells were maintained in RPMI-1640 medium (Corning, Inc., Corning, New York, NY, USA) supplemented with 10% fetal bovine serum in an atmosphere of 5% CO2 at 37°C. The P15 cell culture was exposed to different concentrations of the demethylation agent, DAC (2, 5 and 10 µmol/l; Sigma-Aldrich, St. Louis, MO, USA), for 72 h to assess growth inhibition and monitor the mRNA expression levels of specific genes.

Clone formation assay

The exponentially growing cells were trypsinized (Sigma-Aldrich) into a single cell suspension following treatment with 5 µM DAC for 72 h. Next, the cells were inoculated into 6-well plates, with each well containing 500 cells. The cells were treated with 0.05 µM CDDP for 72 h and cultured at 37°C in an atmosphere of 5% CO2 to facilitate colony formation for 12 days. After rinsing twice with phosphate-buffered saline (PBS), the colonies were fixed with 1 ml methanol for 30 min. The fixing solution was discarded and 1 ml Giemsa dye (Wuhan Huamei Biotechnology Co., Ltd., Beijing, China) was applied for 30 min to stain the cells. Colonies containing a minimum of 50 viable cells were counted using an inverted fluorescence microscope (Olympus BX-51; Olympus Corporation, Tokyo, Japan) to quantify the survival fractions. The survival fraction was calculated using the following formula: Survival fraction = number of colonies/500 cells.

Growth inhibitory activities of DAC

Cells (0.25×104) were seeded in triplicate in 24-well plates two days prior to treatment (day −2). The seeded cells were divided into four groups as follows: untreated control; DAC alone; CDDP alone; and DAC followed by CDDP treatment groups. New medium containing 5 µM of DAC (or PBS) was added to the appropriate groups on day 0. On day 3, the cells were rinsed with PBS and new medium containing 0.05 µM CDDP was added to the CDDP alone and DAC followed by CDDP treatment groups, according to the manufacturer's instructions. The cells were digested with 0.25% trypsin and 0.5 M EDTA and counted daily from seeding until day 6.

Total RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted from the cells using TRIzol reagent (Omega Bio-Tek, Inc., Norcross, GA, USA), purified and dissolved in diethylpyrocarbonate-treated distilled water. Next, 1.0 µg total RNA was reverse-transcribed using avian myeloblastosis virus reverse transcriptase (Takara Biotechnology Co., Ltd., Dalian, China). cDNA was then obtained and PCR amplification was performed using the primers indicated in Table I, under the following conditions: Initial denaturation at 94°C for 2 min, followed by 30–35 cycles of denaturation at 94°C for 30 sec, annealing at 55–63°C for 30 sec and extension at 72°C for 1 min. The PCR mixture consisted of: distilled H2O 12.5 µl, 5X PCR buffer 2 µl (Takara Biotechnology Co., Ltd.), Taq enzyme 0.5 µl (Takara Biotechnology Co., Ltd.), NTPs 2 µl (Takara Biotechnology Co., Ltd.), forward primer 1 µl, reverse primer 1 µl, cDNA 1 µl. The primers were designed and synthesized by Takara Biotechnology Co. Ltd. The PCR products were electrophoresed on 3% agarose gels, stained with ethidium bromide (Takara Biotechnology Co., Ltd.) and visualized under ultraviolet illumination using a Uvidoc gel documentation system (GelDoc XR, Bio-Rad Laboratories, Inc., Hercules, CA, USA). β-actin was selected as the endogenous reference gene. The six apoptosis-related genes, such as p73, Bcl-xL, BAD, Bax, p14ARF, and p16INK4a, were investigated by RT-PCR.

Table I.

Genes and primer sequences.

Table I.

Genes and primer sequences.

Nucleotide sequence, 5′-3′

GeneForward primerReverse primerAnnealing temperature, °CProduct size, bp
β-actin CCTTCCTGGGCATGGAGTCCT AATCTCATCTTGTTTTCTGCG55407
p73 ACTTCAACGAAGGACAGTCTGCT AATTCCGTCCCCACCTGTG63142
Bcl-xL CATGGCAGCAGTAAAGCAAG GCATTGTTCCCATAGAGTTCC55351
BAD TTTAAGAAGGGACTTCCTCGCC GAGCTTCCCCTGCCCAAGTT60119
Bax ATCCAGGATCGAGCAGGGCG ACTCGCTCAGCTTCTTGGTG5894
p14ARF GAGTGAGGGTTTTCGTGG GCCCATCATCATGACCTG55153
p16INK4a CAACGCACCGAATAGTTACGG GCGCAGTTGGGCTCCG55105

[i] Bcl, B-cell lymphoma (Bcl); Bax, Bcl-2-associated X protein; BAD, Bcl-2-associated agonist of cell death.

Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end labeling (TUNEL) analysis

TUNEL (Roche Diagnostics, Basel, Switzerland) was used to evaluate the treatment-associated apoptosis, according to the manufacturer's instructions. Cells (0.25×104/well) were seeded on the slides in 6-well plates and exposed to 5 µM DAC for 72 h, followed by 1.25 µM CDDP for 72 h. The slides were washed with PBS, fixed for 60 min with 4% paraformaldehyde and incubated with TUNEL detection solution containing TdT and fluorescein isothiocyanate (FITC)-labeled solution. DNA strand breaks were labeled with FITC-conjugated dUTP and the nuclei were visualized using an inverted fluorescence microscope (Olympus BX-51; Olympus Corporation).

Statistical analysis

Statistical analyses were performed using the SPSS software (version 16.0; SPSS Inc., Chicago, IL, USA). Survival and apoptosis were analyzed using Welch's t-test and P<0.05 was considered to indicate a statistically significant difference. Data are presented as the mean ± standard deviation.

Results

Colony formation

The survival fraction for colony formation in cells treated with DAC alone (0.440±0.009) was not significantly different from that of the control group (0.574±0.004; P>0.05). However, following combined treatment with DAC and CDDP, the survival fraction for colony formation was significantly decreased when compared with the DAC alone group (0.200±0.007 vs. 0.328±0.007; P<0.05; Fig. 1).

Cell proliferation inhibition

The growth curve of cell proliferation following treatment with DAC and/or CDDP is indicated in Fig. 2. On day 6, the number of cells in the combined treatment group was 15% lower compared with the number of cells in the control group (P=0.004). Furthermore, cell proliferation was significantly more suppressed in DAC alone group compared with the control group, as well as in the combined DAC and CDDP treatment group compared with the CDDP alone group (P<0.05).

Effect of DAC on mRNA expression levels

Following exposure to different concentrations of DAC, the mRNA expression levels of six genes in the P15 cells was determined (Fig. 3). The P15 cells expressed no p73 mRNA following treatment with 0 and 2 µM DAC; however, equal levels of p73 expression occurred upon treatment with 5 and 10 µM DAC. Therefore, DAC appears to restore the expression of p73 transcripts. In addition, no mRNA expression of BAD was identified in the untreated P15 cells. By contrast, treatment with 5 and 10 µM DAC markedly enhanced BAD expression and treatment with 2 µM DAC weakly enhanced BAD expression. In addition, p16INK4a was expressed weakly upon treatment with 2, 5 and 10 µM DAC, while Bax mRNA expression was evident at 5 µM DAC, and weakly detected at 2 and 10 µM DAC. However, the mRNA expression levels of p14ARF and Bcl-xL did not appear to be affected by DAC treatment.

Cell apoptosis

Apoptotic cells are illustrated by fluorescence in Fig. 4. A small number of apoptotic cells were identified in the untreated cells or the cells treated with DAC alone, with no statistically significant difference in the mean number of apoptotic cells observed between these two groups. The highest mean number of apoptotic cells was observed in the DAC and CDDP combination therapy group (P=0.001, vs. control group).

Discussion

Previous studies have indicated that methylation of specific genes resulting in epigenetic silencing occurs in lung cancer. These genes are involved in a number of processes, including cell cycle control, DNA repair, the regulation of cell differentiation and proliferation, and pro-apoptosis (13,14). Therefore, the DNA methylation status of these genes may be used as a molecular marker for early diagnosis, prognosis, disease recurrence risk assessment or response to therapy in patients with lung cancer (15,16).

The clinical efficacy of DAC therapy has yet to be fully investigated in solid tumors; however, the combination of DAC and a chemotherapeutic agent has been proven to exhibit a synergistic effect. For instance, Charlet et al (17) reported that the treatment of neuroblastoma cells with a combination of chemotherapeutic agents and DAC significantly increased the levels of apoptosis induced by CDDP, doxorubicin and etoposide therapy, when compared with treatment with these chemotherapeutic agents alone. Furthermore, Shang et al (18) demonstrated that combination therapy with DAC and CDDP may be a novel strategy to improve the clinical response rate of transitional cell carcinoma of the bladder.

p73 is a member of the p53 family and, therefore, p73 and p53 share significant homology in their DNA-binding domains. Similar to p53, p73 can elicit cancer cell apoptosis in response to DNA damage caused by CDDP-based chemotherapy. However, the p73 gene is rarely mutated (19,20). Alternatively, epigenetic silencing by promoter hypermethylation and complex formation with inhibitory proteins are two distinct inactivation mechanisms of p73 (21). Epigenetic silencing of the p73 gene via hypermethylation of its promoter was previously identified in MDS and non-Hodgkin lymphoma (22,23). Furthermore, the loss of p73 expression in six NSCLC cell lines was determined to be associated with 5′CpG island hypermethylation. In the C57 cell line, DAC was able to restore the mRNA expression of p73 (24,25). Similarly, the present study identified that DAC was successful in restoring p73 mRNA expression in the human lung adenocarcinoma cell line, P15 (Fig. 3). Furthermore, chemotherapeutic agent (CDDP)-induced cell death was increased in the P15 cell line when administered in combination with DAC (Fig. 4). Thus, p73 appeared to enhance the chemosensitivity of P15 tumor cells to CDDP, indicating a potential role of p73 as a tumor suppressor in NSCLC.

p16INK4a, which is known to participate in the regulation of the cell cycle, is frequently inactivated in a variety of human cancer types. Kim et al (26) proposed that abnormal methylation of p16INK4a was an early event of lung carcinogenesis. Furthermore, hypermethylation of p16INK4a was identified in plasma and sputum samples of patients with early lung cancer, as well as in lung cancer tissue samples (27,28). These studies indicated that p16INK4a gene hypermethylation presented high specificity as the hypermethylation did not occur in healthy lung tissue. In addition, the abnormal methylation of p16INK4a is associated with poor prognosis in NSCLC patients (29) as the disruption of p16INK4a cell cycle control would allow clonal expansion to occur. In the present study, clone formation and cell growth inhibitory assays demonstrated that the tumor cell growth was significantly inhibited upon treatment with DAC; this may indicate an association between restored expression of p16INK4a and cell growth inhibition (Figs. 1, 2 and 3).

BAD and Bax are pro-apoptotic genes of the Bcl-2 family; therefore, aberrant promoter methylation in these genes may affect the tumor cell apoptosis pathway (30,31). In the present study, the treatment of P15 cells with DAC increased BAD and Bax mRNA expression levels (Fig. 3). Although the mechanisms involved have yet to be fully elucidated, DAC may enhance pro-apoptosis in P15 cells through the restoration of BAD and Bax genes (Fig. 4).

In conclusion, the present study demonstrated that the aberrant hypermethylation of various gene promoters affected the chemosensitivity of human lung adenocarcinoma cells to treatment with CDDP. Treatment of P15 cells with DAC restored the mRNA expression levels of p73, p16INK4a, BAD and Bax. Furthermore, combined therapy with DAC and CDDP significantly suppressed the growth of lung tumor cells compared with DAC or CDDP treatment alone, indicating the potential of DAC in the treatment of NSCLC.

Acknowledgements

Data published in the present study were extracted from the medical thesis of Mr. Wenyan Huang.

Glossary

Abbreviations

Abbreviations:

DAC

5-aza-2′deoxycytidine

CDDP

cisplatin

NSCLC

non-small-cell lung cancer

RT-PCR

reverse transcription-polymerase chain reaction

TUNEL

terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling

References

1 

Field JK, Oudkerk M, Pedersen JH and Duffy SW: Prospects for population screening and diagnosis of lung cancer. Lancet. 382:732–741. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Reck M, Heigener DF, Mok T, Soria JC and Rabe KF: Management of non-small-cell lung cancer: recent developments. Lancet. 382:709–719. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Ozawa Y, Inui N, Naitoh T, et al: Phase II study of combination chemotherapy with S-1 and weekly cisplatin in patients with previously untreated advanced non-small cell lung cancer. Lung Cancer. 63:68–71. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Barr MP, Gray SG, Hoffmann AC, et al: Generation and characterisation of cisplatin-resistant non-small cell lung cancer cell lines displaying a stem-like signature. PloS One. 8:e541932013. View Article : Google Scholar : PubMed/NCBI

5 

Sève P and Dumontet C: Chemoresistance in non-small cell lung cancer. Curr Med Chem Anticancer Agents. 5:73–88. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Almeida GM, Duarte TL, Farmer PB, Steward WP and Jones GD: Multiple end-point analysis reveals cisplatin damage tolerance to be a chemoresistance mechanism in a NSCLC model: implications for predictive testing. Int J Cancer. 122:1810–1819. 2008. View Article : Google Scholar : PubMed/NCBI

7 

McCabe MT, Brandes JC and Vertino PM: Cancer DNA methylation: molecular mechanisms and clinical implications. Clin Cancer Res. 15:3927–3937. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Cheung HH, Lee TL, Rennert OM and Chan WY: DNA methylation of cancer genome. Birth Defects Res C Embryo Today. 87:335–350. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Fang JY, Yang L, Zhu HY, Chen YX, Lu J, Lu R, Cheng ZH and Xiao SD: 5-Aza-2′-deoxycitydine induces demethylation and up-regulates transcription of p16INK4a gene in human gastric cancer cell lines. Chin Med J (Engl). 117:99–103. 2004.PubMed/NCBI

10 

Chu LC, Eberhart CG, Grossman SA and Herman JG: Epigenetic silencing of multiple genes in primary CNS lymphoma. Int J Cancer. 119:2487–2491. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Karahoca M and Momparler RL: Pharmacokinetic and pharmacodynamic analysis of 5-aza-2′-deoxycytidine (decitabine) in the design of its dose-schedule for cancer therapy. Clin Epigenetics. 5:32013. View Article : Google Scholar : PubMed/NCBI

12 

Mund C, Hackanson B, Stresemann C, Lübbert M and Lyko F: Characterization of DNA demethylation effects induced by 5-aza-2′-deoxycytidine in patients with myelodysplastic syndrome. Cancer Res. 65:7086–7090. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Belinsky SA: Gene-promoter hypermethylation as a biomarker in lung cancer. Nat Rev Cancer. 4:707–717. 2004. View Article : Google Scholar : PubMed/NCBI

14 

Belinsky SA: Silencing of genes by promoter hypermethylation: key event in rodent and human lung cancer. Carcinogenesis. 26:1481–1487. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Pfeifer GP and Rauch TA: DNA methylation patterns in lung carcinomas. Semin Cancer Biol. 19:181–187. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Fleischhacker M, Dietrich D, Liebenberg V, Field JK and Schmidt B: The role of DNA methylation as biomarkers in the clinical management of lung cancer. Expert Rev Respi Med. 7:363–383. 2013. View Article : Google Scholar

17 

Charlet J, Schnekenburger M, Brown KW and Diederich M: DNA demethylation increases sensitivity of neuroblastoma cells to chemotherapeutic drugs. Biochem Pharmacol. 83:858–865. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Shang D, Liu Y, Matsui Y, et al: Demethylating agent 5-aza-2′-deoxycytidine enhances susceptibility of bladder transitional cell carcinoma to cisplatin. Urology. 71:1220–1225. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Han S, Sermba S, Abe T, Makino N, Furukawa T, Fukushige S, Takahashi H, Sakurada A, Sato M, Shiiba K, et al: Infrequent somatic mutations of the p73 gene in various human cancers. Eur J Surg Oncol. 25:194–198. 1999. View Article : Google Scholar : PubMed/NCBI

20 

Yoshikawa H, Nagashima M, Khan MA, McMenamin MG, Hagiwara K and Harris CC: Mutational analysis of p73 and p53 in human cancer cell lines. Oncogene. 18:3415–3421. 1999. View Article : Google Scholar : PubMed/NCBI

21 

Maas AM, Bretz AC, Mack E and Stiewe T: Targeting p73 in cancer. Cancer Lett. 332:229–236. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Zhao Y, Fei C, Zhang X, et al: Methylation of the p73 gene in patients with myelodysplastic syndromes: correlations with apoptosis and prognosis. Tumour Biol. 34:165–172. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Pei JH, Luo SQ, Zhong Y, Chen JH, Xiao HW and Hu WX: The association between non-Hodgkin lymphoma and methylation of p73. Tumour biol. 32:1133–1138. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Liu K, Zhan M and Zheng P: Loss of p73 expression in six non-small cell lung cancer cell lines is associated with 5′CpG island methylation. Exp Mol Pathol. 84:59–63. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Liu K, Zhuang X and Mai Z: p73 expression is associated with cellular chemosensitivity in human non-small cell lung cancer cell lines. Oncol Lett. 5:583–587. 2013.PubMed/NCBI

26 

Kim DH, Nelson HH, Wiencke JK, et al: p16(INK4a) and histology-specific methylation of CpG islands by exposure to tobacco smoke in non-small cell lung cancer. Cancer Res. 61:3419–3424. 2001.PubMed/NCBI

27 

Bearzatto A, Conte D, Frattini M, et al: p16(INK4A) hypermethylation detected by fluorescent methylation-specific PCR in plasmas from non-small cell lung cancer. Clin Cancer Res. 8:3782–3787. 2002.PubMed/NCBI

28 

Shin KC, Lee KH, Lee CH, Shin IH, Suh HS and Jeon CH: MAGE A1-A6 RT-PCR and MAGE A3 and p16 methylation analysis in induced sputum from patients with lung cancer and non-malignant lung diseases. Oncol Rep. 27:911–916. 2012.PubMed/NCBI

29 

Lou-Qian Z, Rong Y, Ming L, Xin Y, Feng J and Lin X: The prognostic value of epigenetic silencing of p16 gene in NSCLC patients: a systematic review and meta-analysis. PloS One. 8:e549702013. View Article : Google Scholar : PubMed/NCBI

30 

Zinkel S, Gross A and Yang E: BCL2 family in DNA damage and cell cycle control. Cell Death Differ. 13:1351–1359. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Hervouet E, Vallette FM and Cartron PF: Impact of the DNA methyltransferases expression on the methylation status of apoptosis-associated genes in glioblastoma multiforme. Cell Death Dis. 1:e82010. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May-2015
Volume 9 Issue 5

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Liu K, Huang W, Gao W and He W: Effect of combined 5-aza-2'deoxycytidine and cisplatin treatment on the P15 lung adenocarcinoma cell line. Oncol Lett 9: 2007-2012, 2015.
APA
Liu, K., Huang, W., Gao, W., & He, W. (2015). Effect of combined 5-aza-2'deoxycytidine and cisplatin treatment on the P15 lung adenocarcinoma cell line. Oncology Letters, 9, 2007-2012. https://doi.org/10.3892/ol.2015.2986
MLA
Liu, K., Huang, W., Gao, W., He, W."Effect of combined 5-aza-2'deoxycytidine and cisplatin treatment on the P15 lung adenocarcinoma cell line". Oncology Letters 9.5 (2015): 2007-2012.
Chicago
Liu, K., Huang, W., Gao, W., He, W."Effect of combined 5-aza-2'deoxycytidine and cisplatin treatment on the P15 lung adenocarcinoma cell line". Oncology Letters 9, no. 5 (2015): 2007-2012. https://doi.org/10.3892/ol.2015.2986