Expression of microRNA-10a, microRNA-342-3p and their predicted target gene TIAM1 in extranodal NK/T-cell lymphoma, nasal type

  • Authors:
    • Haobo Huang
    • Liping Fan
    • Rong Zhan
    • Shunquan Wu
    • Wenyan Niu
  • View Affiliations

  • Published online on: October 27, 2015     https://doi.org/10.3892/ol.2015.3831
  • Pages: 345-351
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

MicroRNAs (miRNAs) may act as oncogenes or tumor suppressor genes in different types of human cancer. T‑lymphoma invasion and metastasis inducing factor 1 (TIAM1) participates in the development of several types of human cancer. However, the expression of miRNAs and TIAM1 in extranodal natural killer (NK)/T‑cell lymphoma, nasal type (ENKTCL) remains poorly understood. In the present study, the association between the expression levels of miR‑10a and miR‑342‑3p and the protein expression levels of TIAM1 was examined in ENKTCL tissues. The expression levels of miR‑10a, miR‑22, miR‑340, miR‑342‑3p and miR‑590‑5p in 15 primary ENKTCL tissues were analyzed using quantitative polymerase chain reaction, and the protein expression levels of TIAM1 in 21 primary ENKTCL tissues were analyzed using immunohistochemistry. The expression levels of miR‑10a and miR‑342‑3p were lower in ENKTCL tissues than in normal NK cells, but no significant differences were observed in the expression levels of miR‑22, miR‑340 and miR‑590‑5p in ENKTCL tissues, compared with normal NK cells. The low expression levels of miR‑10a detected in the tissues of patients with ENKTCL were inversely correlated with the age of the patients, whereas the low expression levels of miR‑342‑3p measured in these samples were not correlated with any demographic or clinical features of the patients. The protein expression levels of TIAM1 were higher in ENKTCL tissues than in normal and reactive lymph node hyperplasia tissues, and positively correlated with the Ann Arbor stage and international prognostic index score of the tumors. Furthermore, the expression levels of miRNA‑10a and miRNA‑342‑3p were inversely correlated with the protein expression levels of TIAM1 in ENKTCL tissues. These data suggest that TIAM1 may contribute to the pathogenesis of ENKTCL, and miRNA‑10a and miRNA‑342‑3p may be involved in the development of ENKTCL via the TIAM1 pathway.

Introduction

Extranodal natural killer (NK)/T-cell lymphoma, nasal type (ENKTCL) is an aggressive type of lymphoma that occurs frequently in the Asian population (1,2). The pathogenesis of this tumor is poorly understood, and conventional chemotherapy regimens, currently employed for the treatment of other aggressive types of lymphoma, usually provide poor outcomes in patients with ENKTCL (1,2). Therefore, studies on the pathogenetic abnormalities that occur during the development of ENKTCL may contribute to improving the clinical outcomes of these patients.

MicroRNAs (miRNAs) are small non-coding RNA molecules that inhibit the transcription or translation of mRNA. Previous studies have demonstrated that dysregulation of miRNA occurs in numerous types of human cancer, indicating that miRNAs may act as oncogenes or tumor suppressor genes (3). Previous miRNA expression profiling studies conducted on a series of ENKTCL formalin-fixed paraffin-embedded (FFPE) tissues revealed that several miRNAs, including miR-10a, miR-22, miR-340, miR-342-3p and miR-590-5p, are dysregulated in ENKTCL tissues, compared with normal NK cells (1). Bioinformatic analysis of these miRNAs indicated that all of them target the T-lymphoma invasion and metastasis-inducing factor 1 (TIAM1) gene (1).

Tiam1 is a specific guanine nucleotide exchange factor for Rho-like guanosine triphosphate (GTP)ases, which exhibits its pathophysiological role via the activation of the rat sarcoma-related C3 botulinum toxin substrate signaling pathway (4). Overexpression of TIAM1 has been reported in various solid tumors (512). In addition, previous studies have demonstrated that TIAM1 modulates a number of cellular processes considered to be associated with tumor progression, including cell apoptosis, invasion and migration (1318). These findings suggest that TIAM1 may be a target for cancer therapy. However, there is limited evidence regarding the role of the TIAM1 gene in the pathogenesis of ENKTCL.

To gain insight into the potential role of miR-10a, miR-22, miR-340, miR-342-3p, miR-590-5p and TIAM1 in the pathogenesis of ENKTCL, the present study examined the expression levels of these miRNAs and their target gene TIAM1 in ENKTCL tissues, in order to assess whether the expression levels of these molecules correlated with the clinical features of patients with ENKTCL.

Materials and methods

Patients and controls

Patients who were diagnosed with ENKTCL from 2007 to 2011 were selected from the archives of the Department of Pathology of the Fujian Medical University Union Hospital (Fuzhou, China), and classified according to the 2008 World Health Organization classification of lymphomas (19). A total of 21 patients were selected for the study. The study was approved by the ethics committee of Fujian Medical University Union Hospital. The samples were collected with the patients' consent. Patients with no additional tissue available for immunohistochemical testing were excluded from the study. The FFPE tissues of 15 patients were subjected to quantitative polymerase chain reaction (qPCR) analysis. In addition, ten samples of normal and reactive lymph node hyperplasia FFPE tissue were included as controls.

Isolation of normal NK cells from peripheral blood

Human normal NK cells were isolated from whole blood samples obtained from healthy donors, which were collected with EDTA using NK Cell Isolation Kit (TBD Science, Tianjin, China).

RNA extraction

Prior to RNA extraction, five pieces of the FFPE tissue sections were treated with 1 ml xylene (Kemiou Chemical Reagent Co., Tianjin, China) for 10 sec at room temperature, then incubated at 56 degree for 3 min to remove the paraffin, and subsequently digested with 10 µl proteinase K (Qiagen, Inc., Valencia, CA, USA), followed by incubation at 56°C for 15 min, then at 80°C for 15 min. Total RNA was then isolated using miRNeasy FFPE Kit (Qiagen, Inc.), according to the manufacturers protocol. Total RNA from NK cells was extracted with TRIzol (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA, USA).

Reverse transcription (RT) and qPCR of miRNAs

Complementary DNA was synthesized from total RNA using PrimeScript™ RT reagent Kit (Perfect Real Time) (Takara Bio, Inc., Otsu, Japan), following the manufacturers protocol. The RT reactions contained 500 ng total RNA extracted from the samples, 2 µl 5X PrimeScript™ Buffer (Takara Bio, Inc.), 0.5 µl 1X PrimeScript™ RT Enzyme Mix I (Takara Bio, Inc.) and 0.5 µl oligo(dT) primer (Takara Bio, Inc.). The 10-µl reactions were incubated for 42 min at 37°C, followed by 30-sec incubation at 85°C, and then exposed to 4°C.

To quantify the expression levels of the aforementioned miRNAs, qPCR was conducted using SYBR® Premix Ex Taq™ II (Tli RNase H Plus) Kit (Takara, Bio, Inc.) with an Applied Biosystems 7300 Real Time PCR System (Thermo Fisher Scientific, Inc.), according to the manufacturers protocol. The 20-µl PCR reactions included 0.19 µl RT product, 10.0 µl 2X SYBR® Premix Ex Taq™ II (Takara Bio, Inc.), 2.0 µl primers mix (Biosune, Inc., Shanghai, China), 0.4 µl 50X ROX Reference Dye II (Takara Bio, Inc.) and 7.41 µl RNase-free dH2O (Takara Bio, Inc.). The reaction mixtures were incubated in a 96-well plate at 95°C for 1 min, followed by 40 cycles of amplification at 95°C for 5 sec and 60°C for 30 sec. The sequences of the primers used are listed in Table I. The quantification cycle (Cq) was determined using default threshold settings. All the experiments were performed in triplicate. U6 small nuclear RNA was used as control to normalize the miRNA input in the qPCR assay. The qPCR data were analyzed using the 2−ΔCq method.

Table I.

Primer sequences of miRNAs for quantitative polymerase chain reaction analysis.

Table I.

Primer sequences of miRNAs for quantitative polymerase chain reaction analysis.

Primer sequence (5′-3)

GeneForwardReverse
miRNA-10aTAC CCT GTA GAT CCG AAT TTGTGATT CCC CTA GAT ACG AAT TTG TGA
miRNA-22 AGCAACATGCCCTGCTC TCTGTCACCTTCCAGATGATG
miRNA-340 ATAAAGCAATGAGACTGATTGTC GGCTATAAAGTAACTGAGACGGA
miRNA-342-3p GTGCTATCTGTGATTGAGGGA CGGGTGCGATTTCTGTG
miRNA-590-5p TTAGAGCCAACCAGCAGC GCATTGACAGCACATCCC
U6 GTTTTGTAGTTTTTGGAGTTAGTGTTGTGT CTCAACCTACAATCAAAAACAACACAAACA

[i] miRNA, microRNA.

Immunohistochemistry

Tissue sections were subjected to antigen retrieval by incubation in 10 mmol/l sodium citrate buffer (pH 6.0) for 10 min in a microwave oven (WD900SL23–2, Galanz Enterprises Co., Ltd., Foshan, China) at the maximum power setting. Any potential endogenous peroxidase activity present in the tissues was blocked by incubation with 3% H2O2 for 15 min. Subsequently, the tissue sections were incubated at room temperature for 60 min with a rabbit polyclonal antibody specific for human TIAM1 (dilution,7 1:100; cat no. sc-872, Santa Cruz Biotechnology, Inc., Dallas, TX, USA) diluted in phosphate-buffered saline (PBS). Immunoreactive proteins were visualized with MaxVision™ HRP-Polymer anti-Rabbit IHC Kit (Fuzhou Maixin Biotech Co., Ltd., Fuzhou, China), following the manufacturers protocol, and counterstained with hematoxylin (Sigma-Aldrich Shanghai Trading Co., Ltd., Shanghai, China). Tissue sections corresponding to the negative control were treated with PBS under the same experimental conditions than the samples.

Quantitative evaluation of the protein expression levels of TIAM1 was performed by counting the percentage of immunoreactive cells positive for TIAM1 that were present in a number of high-power microscopic fields (magnification, ×200; BX41 microscope, Olympus Corporation, Tokyo, Japan). The ENKTCL tissues were scored based on the percentage of positive tumor cells expressing cytoplasmic TIAM1, as follows: i) <15%, score 0; ii) 15–24%, score 1; iii) 25–49%, score 2; iv) 50–74%, score 3; and v) ≥75%, score 4.

Statistical analysis

Since the data corresponding to the expression levels of miR-10a, miR-22, miR-340, miR-342-3p and miR-590-5p followed a normal distribution, the expression levels of these miRNAs in ENKTCL tissues and normal NK cells were compared using Students two-tailed t test. The association between the clinical features of patients with ENKTCL and the expression levels of miR-10a, miR-342-3p and TIAM1 protein detected in these patients was analyzed via Students two-tailed t test and χ2 test, respectively. Spearmans rank correlation was used to evaluate the association between the expression levels of miR-10a and miR-342-3p and the protein expression levels of TIAM1. P<0.05 was considered to indicate a statistical significant difference. SPSS software version 17.0 (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis.

Results

Clinical features of patients with ENKTCL

The main demographic and clinical features of patients with ENKTCL are listed in Table II. The median age at the time of diagnosis was 44.1 years (range, 13–71 years), and the most frequent cancer site was the nasal cavity. According to the Ann Arbor staging of lymphoma, 6 patients were in stage I, 3 in stage II, 2 in stage III and 10 in stage IV (20). High expression levels of lactate dehydrogenase (LDH) were observed in 10 patients, and 12 patients exhibited B symptoms.

Table II.

Clinical features of 21 patients with ENKTCL.

Table II.

Clinical features of 21 patients with ENKTCL.

Patient no.Age (years)GenderPrimary cancer siteStageaLDH levelsB symptomsIPITIAM1 in ENKTCL (IHS)b
  127MaleNasal cavityINormalA00
  252FemaleNasal cavityIINormalB00
  371MaleNasal cavityINormalA10
  468MaleGingivaIVNormalA40
  524MaleAdrenal glandIIINormalA22
  654MaleNasal cavityIVHighB40
  755MaleNasal cavityINormalA02
  845FemaleBone marrowIVNormalB32
  939MaleNasal cavityIVHighB31
1041MaleNasal cavityIHighA12
1126MaleGastricIVHighA40
1264MaleNasal cavityIHighA31
1313FemaleBone marrowIVHighB42
1455MaleBone marrowIVHighB41
1543MaleBone marrowIVHighB40
1643FemaleNasal cavityIIHighB20
1771MaleNasal cavityINormalA20
1840MaleNasal cavityIVNormalB31
1939MaleNasal cavityIIINormalB32
2024MaleNasal cavityIVHighB32
2132MaleNasal cavityIINormalB10

a Ann Arbor staging;

b protein expression levels of TIAM1 in ENKTCL tissues. ENKTCL, extranodal natural killer/T-cell lymphoma, nasal type; LDH, lactate dehydrogenase; IPI, international prognostic index; TIAM1, T-lymphoma invasion and metastasis inducing factor 1; IHS, immunohistochemistry score.

qPCR results of miR-10a, miR-22, miR-340, miR-342-3p and miR-590-5p

The expression levels of miR-10a were markedly lower in ENKTCL tissues than in normal NK cells (Fig. 1A). In addition, the expression levels of miR-342-3p in ENKTCL tissues were significantly lower than in normal NK cells (Fig. 1B). In contrast, the expression levels of miR-22, miR-340 and miR-590-5p did not differ significantly between ENKTCL tissues and normal NK cells (Fig. 1C–E). These results suggest that miR-10a and miR-342-3p may be involved in the pathogenesis of ENKTCL.

Correlations between the expression levels of miR-10a and miR-342-3p and the demographic and clinical characteristics of patients with ENKTCL

The expression levels of miR-10a in ENKTCL FFPE tissues were inversely correlated with the patients age (P=0.02), but not with other demographic or clinical features, including gender, Ann Arbor stage, levels of LDH, B symptoms and international prognostic index (IPI) score (Table III). The expression levels of miR-342-3p in ENKTCL FFPE tissues was not correlated with any demographic or clinical features of the patients.

Table III.

Association between the expression levels of miR-10a, miR-342-3p and TIAM1 protein in tissues of patients with ENKTCL and the demographic and clinical features of the patients.

Table III.

Association between the expression levels of miR-10a, miR-342-3p and TIAM1 protein in tissues of patients with ENKTCL and the demographic and clinical features of the patients.

miR-10amiR-342-3pTIAM1



Clinical featureCases (no.)Expression (×10−3)a P-valuebExpression (×10−3)a P-valuebCases (no.)TIAM1+ cases (no.) P-valuec
Age (years) 0.02 0.97 0.34
  ﹤60134.97±1.13 2.08±0.27 1710
  ≥60  21.46±0.64 2.05±0.73   4  1
Gender 0.58 0.70 0.92
  Male124.03±1.02 2.02±0.28 17  9
  Female  36.41±3.43 2.29±0.56   4  2
Ann Arbor stage 0.98 0.22 0.02
  I–II  64.46±1.98 1.68±0.41   9  2
  III–IV  94.54±1.20 2.34±0.28 12  9
LDH levels 0.93 0.90 0.51
  High  64.39±1.72 2.12±0.44 10  6
  Normal  94.59±1.36 2.05±0.3 11  5
B symptoms 0.06 0.88 0.53
  Positive  86.28±1.53 2.11±0.32 12  7
  Negative  72.48±0.93 2.04±0.39   9  4
IPI (score) 0.61 0.21 0.02
  0–2  73.90±1.77 1.74±0.35   9  2
  3–5  85.04±1.24 2.37±0.32 12  9

a Expression measured relative to U6;

b Students t-test;

c χ2 test. miR, microRNA; TIAM1, T-lymphoma invasion and metastasis inducing factor 1; ENKTCL, extranodal natural killer/T-cell lymphoma, nasal type; LDH, lactate dehydrogenase; IPI, international prognostic index.

Immunohistochemistry and correlation between the expression levels of TIAM1 protein and the demographic and clinical features of patients with ENKTCL

Tiam1 protein was expressed in 11 ENKTCL samples (52.4%) and in 1 of 10 paired samples of normal and reactive lymph node hyperplasia (10%), where its expression levels were low (Fig. 2). The intensity of TIAM1 protein expression detected in the ENKTCL tissues is listed in Table II. The protein expression levels of TIAM1 in ENKTCL FFPE tissues were positively correlated with Ann Arbor stage and IPI score (P=0.02; Table III), but no significant association was observed with any other demographic or clinical features of the patients. These results suggest that TIAM1 protein may be involved in the pathogenesis of ENKTCL.

Correlations between the expression levels of miR-10a, miR-342-3p and TIAM1 protein in ENKTCL FFPE tissues

Expression of TIAM1 protein was detected in the FFPE tissues of 7 of the 15 patients with ENKTCL analyzed (47%). In these patients, the expression levels of miR-10a and miR-342-3p appeared to be inversely correlated with the protein expression levels of TIAM1 (Spearmans r=−0.60 and −0.73 for miR-10a and miR-342-3p, respectively; P=0.02; Fig. 3).

Discussion

Previous studies have demonstrated that the expression levels of several miRNAs are downregulated in ENKTCL FFPE tissues, which is considered to contribute to the pathogenesis of the tumor by the loss of the suppressive effects that these miRNAs normally exert on their target genes (1,2125). In a study by Ng et al (1), the expression levels of miR-10a, miR-22, miR-340, miR-342-3p and miR-590-5p appeared to be downregulated in ENKTCL FFPE tissues, compared with normal NK cells, according to the results of human miRNA microarray analysis. However, these findings were not further validated by qPCR.

The qPCR data of the present study are consistent with the previous miRNA microarray results reported by Ng et al (1), confirming that miR-10a and miR-342-3p are downregulated in ENKTCL FFPE tissues, compared with normal NK cells. However, in the present study, the expression levels of miR-22, miR-340 and miR-590-5p did not differ significantly between ENKTCL tissues and normal NK cells. Furthermore, the expression levels of miR-10a in the ENKTCL FFPE tissues correlated with the patients age, but the expression levels of miR-342-3p did not correlate with any demographic or clinical feature of the patients. Therefore, further studies are required to validate the potential participation of miR-10a and miR-342-3p in the pathogenesis of ENKTCL.

Previous studies have identified several target genes of miR-10a, including high-mobility group A2 (26), cell adhesion molecule L1-like (27), homeobox (HOX)A1 (28) and HOXD4 (29), which are involved in cellular differentiation, growth, migration and invasion in various pathophysiological processes (2629). Other studies have demonstrated that the expression of miR-342-3p is downregulated in the blood and tumor tissues of patients with cancer, including colorectal cancer (30), clinical glioblastoma multiforme (31), breast tumor (32), acute lymphoblastic leukemia (33) and Sézary syndrome (34). In addition, miR-342-3p has been previously demonstrated to be involved in cell differentiation (35), growth (36,37), invasion (37) and response to chemotherapy (38,39) in cancer cells.

Previous studies have suggested that multiple miRNAs may suppress the expression of the same target gene by directly targeting its 3 untranslated region (40). Furthermore, previous bioinformatic analysis indicated that miR-10a and miRNA-342-3p target the TIAM1 gene (1).

Tiam1 has been identified as a guanine nucleotide exchange factor that exchanges guanosine diphosphate for GTP in Rho-like GTPases, thereby activating them. This process leads to the activation of a signaling pathway that stimulates the c-Jun N-terminal kinase, p38 mitogen-activated protein kinase and extracellular signal-regulated kinase pathways, which results in the regulation of the expression of genes involved in cellular migration, invasion and metastasis (4,5). To date, overexpression of TIAM1 has been reported in various types of tumor tissue, including head and neck (5), esophageal (6), colorectal (7), gallbladder (8), renal cell (9), nasopharyngeal (10), hepatocellular (11) and prostate carcinoma (12). In addition, overexpression of TIAM1 has been suggested to be involved in tumor progression via lymphangiogenesis (13), apoptosis (14,15), invasion and migration (1618). However, the expression of TIAM1 in ENKTCL FFPE tissue and its association with clinical features of patients with ENKTCL remain unclear.

The immunohistochemistry data of the present study demonstrated that TIAM1 protein was overexpressed in ENKTCL FFPE tissues, compared with normal and reactive lymph node hyperplasia FFPE tissues, which is in agreement with the results of previous studies on various malignancies (4–6,8–13). The overexpression of TIAM1 in the ENKTCL cases analyzed in the present study correlated with the Ann Arbor stage and IPI score of the tumors. However, no significant association was observed between the protein expression levels of TIAM1 and any other demographic and clinical characteristics of the patients, including age, gender, levels of LDH and B symptoms. Overall, the results of the present study suggest that TIAM1 may be involved in the pathogenesis of ENKTCL. However, due to the small sample size of the present study, further studies involving a larger number of cases of ENKTCL are required in order to confirm these findings.

In conclusion, the results of the present study suggest that reduced expression of miR-10a and miR-342-3p and overexpression of TIAM1 protein may be involved in the progression of ENKTCL. Additional in vitro and in vivo studies are required to further elucidate the potential role and mechanism of action of these molecules in the development of ENKTCL.

Acknowledgements

The present study was funded by the National Natural Science Foundation of China (Beijing, China; grant no. 81201872), the Natural Science Foundation of Fujian Province (Fuzhou, China; grant no. 2013J01308), the Fujian Provincial Health Bureau Youth Research Projects (Fuzhou, China; grant no. 2011-1-12), the Medical Elite Cultivation Program of Fujian Province (Fuzhou, China; grant no. 2015-ZQN-JC-18) and the Middle Age and Young Teacher Education and Research Program of Fujian Province (Fuzhou, China; grant no. JA14133).

References

1 

Ng SB, Yan J, Huang G, Selvarajan V, Tay JL, Lin B, Bi C, Tan J, Kwong YL, Shimizu N, et al: Dysregulated microRNAs affect pathways and targets of biologic relevance in nasal-type natural killer/T-cell lymphoma. Blood. 118:4919–4929. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Kim SJ, Jung HA, Chuang SS, Hong H, Guo CC, Cao J, Hong XN, Suzuki R, Kang HJ, Won JH, et al: Asia Lymphoma Study Group: Extranodal natural killer/T-cell lymphoma involving the gastrointestinal tract: Analysis of clinical features and outcomes from the Asia Lymphoma Study Group. J Hematol Oncol. 6:862013. View Article : Google Scholar : PubMed/NCBI

3 

Esquela-Kerscher A and Slack FJ: Oncomirs-microRNAs with a role in cancer. Nat Rev Cancer. 6:259–269. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Cook DR, Rossman KL and Der CJ: Rho guanine nucleotide exchange factors: Regulators of Rho GTPase activity in development and disease. Oncogene. 33:4021–4035. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Wang S, Li S, Yang X, Yang S, Liu S, Liu B and Liu J: Elevated expression of T-lymphoma invasion and metastasis inducing factor 1 in squamous-cell carcinoma of the head and neck and its clinical significance. Eur J Cancer. 50:379–387. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Liu H, Shi G, Liu X, Wu H, Fan Q and Wang X: Overexpression of Tiam1 predicts poor prognosis in patients with esophageal squamous cell carcinoma. Oncol Rep. 25:841–848. 2011.PubMed/NCBI

7 

Jin H, Li T and Ding Y, Deng Y, Zhang W, Yang H, Zhou J, Liu C, Lin J and Ding Y: Methylation status of T-lymphoma invasion and metastasis 1 promoter and its overexpression in colorectal cancer. Hum Pathol. 42:541–551. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Du X, Wang S, Lu J, Wang Q, Song N, Yang T, Dong R, Zang L, Yang Y, Wu T and Wang C: Clinical value of Tiam1-Rac1 signaling in primary gallbladder carcinoma. Med Oncol. 29:1873–1878. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Zhao L, Liu Y, Sun X, He M and Ding Y: Overexpression of T lymphoma invasion and metastasis 1 predict renal cell carcinoma metastasis and overall patient survival. J Cancer Res Clin Oncol. 137:393–398. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Qi Y, Huang B, Yu L, Wang Q, Lan G and Zhang Q: Prognostic value of Tiam1 and Rac1 overexpression in nasopharyngeal carcinoma. ORL J Otorhinolaryngol Relat Spec. 71:163–171. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Ding Y, Chen B, Wang S, Zhao L, Chen J, Ding Y, Chen L and Luo R: Overexpression of Tiam1 in hepatocellular carcinomas predicts poor prognosis of HCC patients. Int J Cancer. 124:653–658. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Engers R, Mueller M, Walter A, Collard JG, Willers R and Gabbert HE: Prognostic relevance of Tiam1 protein expression in prostate carcinomas. Br J Cancer. 95:1081–1086. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Zhong D, Li Y, Peng Q, Zhou J, Zhou Q, Zhang R and Liang H: Expression of Tiam1 and VEGF-C correlates with lymphangiogenesis in human colorectal carcinoma. Cancer Biol Ther. 8:689–695. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Cao-Hong, Shibayama-Imazu T, Masuda Y, Shinki T, Nakajo S and Nakaya K: Involvement of Tiam1 in apoptosis induced by bufalin in HeLa cells. Anticancer Res. 27:245–249. 2007.PubMed/NCBI

15 

Minard ME, Ellis LM and Gallick GE: Tiam1 regulates cell adhesion, migration and apoptosis in colon tumor cells. Clin Exp Metastasis. 23:301–313. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Adam L, Vadlamudi RK, McCrea P and Kumar R: Tiam1 overexpression potentiates heregulin-induced lymphoid enhancer factor-1/β-catenin nuclear signaling in breast cancer cells by modulating the intercellular stability. J Biol Chem. 276:28443–28450. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Engers R, Springer E, Michiels F, Collard JG and Gabbert HE: Rac affects invasion of human renal cell carcinomas by upregulating tissue inhibitor of metalloproteinases (TIMP)-1 and TIMP-2 expression. J Biol Chem. 276:41889–41897. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Bourguignon LY, Zhu H, Shao L and Chen YW: Ankyrin-Tiam1 interaction promotes Rac1 signaling and metastatic breast tumor cell invasion and migration. J Cell Biol. 150:177–191. 2000. View Article : Google Scholar : PubMed/NCBI

19 

Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J and Vardiman JW: WHO Classification of Tumours of Haematopoietic and Lymphoid Tissue (4th). Lyon, France: IARC Press. 179–350. 2008.

20 

Bierman PJ, Harris N and Armitage JO: Non-Hodgkin's lymphoma. Cecil Medicine. Goldman L and Ausiello D: (23rd). (Philadelphia). Saunders Elsevier. 1408–1425. 2008.

21 

Komabayashi Y, Kishibe K, Nagato T, Ueda S, Takahara M and Harabuchi Y: Downregulation of miR-15a due to LMP1 promotes cell proliferation and predicts poor prognosis in nasal NK/T-cell lymphoma. Am J Hematol. 89:25–33. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Huang HB, Zhan R, Wu SQ, Xu ZZ and Fan LP: Expression of MCL-1 and microRNA-29a in extranodal NK/T-cell lymphoma tissue. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 21:95–98. 2013.(In Chinese). PubMed/NCBI

23 

Motsch N, Alles J, Imig J, Zhu J, Barth S, Reineke T, Tinguely M, Cogliatti S, Dueck A, Meister G, et al: MicroRNA profiling of Epstein-Barr virus-associated NK/T-cell lymphomas by deep sequencing. PLoS One. 7:e421932012. View Article : Google Scholar : PubMed/NCBI

24 

Ti HJ, Nong L, Wang W, Zhang S and Li T: Expression of microRNA in extranodal NK/T cell lymphoma, nasal type. Zhonghua Bing Li Xue Za Zhi. 40:610–615. 2011.(In Chinese). PubMed/NCBI

25 

Paik JH, Jang JY, Jeon YK, Kim WY, Kim TM, Heo DS and Kim CW: MicroRNA-146a downregulates NFκB activity via targeting TRAF6 and functions as a tumor suppressor having strong prognostic implications in NK/T cell lymphoma. Clin Cancer Res. 17:4761–4771. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Zhu S, Deng S, Ma Q, Zhang T, Jia C, Zhuo D, Yang F, Wei J, Wang L, Dykxhoorn DM, et al: MicroRNA-10A* and MicroRNA-21 modulate endothelial progenitor cell senescence via suppressing high-mobility group A2. Circ Res. 112:152–164. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Long MJ, Wu FX, Li P, Liu M, Li X and Tang H: MicroRNA-10a targets CHL1 and promotes cell growth, migration and invasion in human cervical cancer cells. Cancer Lett. 324:186–196. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Ohuchida K, Mizumoto K, Lin C, Yamaguchi H, Ohtsuka T, Sato N, Toma H, Nakamura M, Nagai E, Hashizume M and Tanaka M: MicroRNA-10a is overexpressed in human pancreatic cancer and involved in its invasiveness partially via suppression of the HOXA1 gene. Ann Surg Oncol. 19:2394–2402. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Tan Y, Zhang B, Wu T, Skogerbø G, Zhu X, Guo X, He S and Chen R: Transcriptional inhibiton of Hoxd4 expression by miRNA-10a in human breast cancer cells. BMC Mol Biol. 10:122009. View Article : Google Scholar : PubMed/NCBI

30 

Grady WM, Parkin RK, Mitchell PS, Lee JH, Kim YH, Tsuchiya KD, Washington MK, Paraskeva C, Willson JK, Kaz AM, et al: Epigenetic silencing of the intronic microRNA hsa-miR-342 and its host gene EVL in colorectal cancer. Oncogene. 27:3880–3888. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Haapa-Paananen S, Chen P, Hellström K, Kohonen P, Hautaniemi S, Kallioniemi O and Perälä M: Functional profiling of precursor MicroRNAs identifies MicroRNAs essential for glioma proliferation. PLoS One. 8:e609302013. View Article : Google Scholar : PubMed/NCBI

32 

Buffa FM, Camps C, Winchester L, Snell CE, Gee HE, Sheldon H, Taylor M, Harris AL and Ragoussis J: MicroRNA-associated progression pathways and potential therapeutic targets identified by integrated mRNA and microRNA expression profiling in breast cancer. Cancer Res. 71:5635–5645. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Xu L, Liang YN, Luo XQ, Liu XD and Guo HX: Association of miRNAs expression profiles with prognosis and relapse in childhood acute lymphoblastic leukemia. Zhonghua Xue Ye Xue Za Zhi. 32:178–181. 2011.(In Chinese). PubMed/NCBI

34 

Ballabio E, Mitchell T, van Kester MS, Taylor S, Dunlop HM, Chi J, Tosi I, Vermeer MH, Tramonti D, Saunders NJ, et al: MicroRNA expression in Sezary syndrome: Identification, function, and diagnostic potential. Blood. 116:1105–1113. 2010. View Article : Google Scholar : PubMed/NCBI

35 

Wu Y, Li XF, Yang JH, Liao XY and Chen YZ: microRNAs expression profile in acute promyelocytic leukemia cell differentiation induced by all-trans retinoic acid and arsenic trioxide. Zhonghua Xue Ye Xue Za Zhi. 33:546–551. 2012.(In Chinese). PubMed/NCBI

36 

Leivonen SK, Sahlberg KK, Mäkelä R, Due EU, Kallioniemi O, Børresen-Dale AL and Perälä M: High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol. 8:93–104. 2014. View Article : Google Scholar : PubMed/NCBI

37 

Wang H, Wu J, Meng X, Ying X, Zuo Y, Liu R, Pan Z, Kang T and Huang W: MicroRNA-342 inhibits colorectal cancer cell proliferation and invasion by directly targeting DNA methyltransferase 1. Carcinogenesis. 32:1033–1042. 2011. View Article : Google Scholar : PubMed/NCBI

38 

He YJ, Wu JZ, Ji MH, Ma T, Qiao EQ, Ma R and Tang JH: miR-342 is associated with estrogen receptor-α expression and response to tamoxifen in breast cancer. Exp Ther Med. 5:813–818. 2013.PubMed/NCBI

39 

Kim CH, Kim HK, Rettig RL, Kim J, Lee ET, Aprelikova O, Choi IJ, Munroe DJ and Green JE: miRNA signature associated with outcome of gastric cancer patients following chemotherapy. BMC Med Genomics. 4:792011. View Article : Google Scholar : PubMed/NCBI

40 

Wu S, Huang S, Ding J, Zhao Y, Liang L, Liu T, Zhan R and He X: Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3 untranslated region. Oncogene. 29:2302–2308. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

January-2016
Volume 11 Issue 1

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Huang H, Fan L, Zhan R, Wu S and Niu W: Expression of microRNA-10a, microRNA-342-3p and their predicted target gene TIAM1 in extranodal NK/T-cell lymphoma, nasal type. Oncol Lett 11: 345-351, 2016.
APA
Huang, H., Fan, L., Zhan, R., Wu, S., & Niu, W. (2016). Expression of microRNA-10a, microRNA-342-3p and their predicted target gene TIAM1 in extranodal NK/T-cell lymphoma, nasal type. Oncology Letters, 11, 345-351. https://doi.org/10.3892/ol.2015.3831
MLA
Huang, H., Fan, L., Zhan, R., Wu, S., Niu, W."Expression of microRNA-10a, microRNA-342-3p and their predicted target gene TIAM1 in extranodal NK/T-cell lymphoma, nasal type". Oncology Letters 11.1 (2016): 345-351.
Chicago
Huang, H., Fan, L., Zhan, R., Wu, S., Niu, W."Expression of microRNA-10a, microRNA-342-3p and their predicted target gene TIAM1 in extranodal NK/T-cell lymphoma, nasal type". Oncology Letters 11, no. 1 (2016): 345-351. https://doi.org/10.3892/ol.2015.3831