Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
April-2016 Volume 11 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2016 Volume 11 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association between the methylation status of the MGMT promoter in bone marrow specimens and chemotherapy outcomes of patients with acute myeloid leukemia

  • Authors:
    • Qingxiao Hong
    • Xiaoying Chen
    • Huadan Ye
    • Annan Zhou
    • Yuting Gao
    • Danjie Jiang
    • Xiaodong Wu
    • Bingru Tian
    • Youfen Chen
    • Ming Wang
    • Jiping Xie
    • Yongming Xia
    • Shiwei Duan
  • View Affiliations / Copyright

    Affiliations: Department of Biochemistry and Molecular Biology, Zhejiang Provincial Key Laboratory of Pathophysiology, School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, P.R. China, Department of Hematology, Yuyao People's Hospital, Yuyao, Zhejiang 315400, P.R. China
  • Pages: 2851-2856
    |
    Published online on: March 9, 2016
       https://doi.org/10.3892/ol.2016.4317
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The O(6)-methylguanine-DNA methyltransferase (MGMT) gene is a tumor suppressor gene that is associated with the risk of developing acute myeloid leukemia (AML). However, the association between the methylation status of the MGMT promoter and the chemotherapeutic outcomes of patients with AML remains unknown. In the present study, 30 bone marrow samples derived from patients with AML were collected prior and subsequent to chemotherapy. The methylation status of the MGMT promoter in the bone marrow specimens was determined by methylation‑specific polymerase chain reaction. The results indicated that the methylation status of the MGMT promoter was influenced by different chemotherapeutic regimens. The MGMT methylation status of M4 patients (3 out of 6) were more chemosensitive, compared with that of patients with other AML subtypes (M1, 1 out of 3; M2, 0 out of 8; M3, 3 out of 7; M5, 0 out of 3; and M6, 1 out of 3). Age‑based analysis revealed that the group aged ≤60 years (7 out of 24 patients) exhibited more methylation changes than patients aged >60 years (1 out of 6). Male patients (4 out of 13) were more susceptible to chemotherapy‑induced methylation changes than female patients (4 out of 17). Thus, the methylation status of the MGMT promoter may serve as a potential biomarker to predict the therapeutic outcomes in male AML patients. However, further studies in larger sample sets are required to confirm the present findings.

Introduction

Acute myeloid leukemia (AML) is a highly heterogeneous hematologic malignancy, which is characterized by the rapid growth of abnormal white blood cells that accumulate in the peripheral blood, bone marrow and other tissues (1,2). AML is the most common form of acute leukemia in adults (3), and is treated initially with chemotherapy with the aim of inducing a remission (4). Demethylation agents such as azacitidine and decitabine have been previously used in the treatment of AML (5). Aberrant CpG island hypermethylation of tumor suppressor genes has been shown to be important in inducing transcriptional silencing of genes in leukemic cells (6). Therefore, the promoter methylation status of cancer-associated genes may serve as a predictive and prognostic biomarker in the pathogenesis of various types of cancer (7).

The O(6)-methylguanine-DNA methyltransferase (MGMT) gene encodes a unique DNA repair enzyme that removes mutagenic and cytotoxic alkyl adducts from the O(6) position of guanine (8). Hypermethylation of the MGMT promoter was identified in certain tumor cell lines such as non-Hodgkin lymphoma and AML (9). Targeted therapy was feasible in patients with AML who displayed low expression levels of MGMT (10). However, the frequency of MGMT promoter methylation in AML, and its potential prognostic value remain to be elucidated.

The aim of the present study was to evaluate whether the promoter methylation status of the MGMT gene would be influenced by chemotherapeutic agents, and whether the methylation changes induced by the treatment would be able to predict the chemotherapeutic outcomes of patients with AML.

Materials and methods

Samples

Bone marrow samples from 30 individuals with AML were collected by the members of the Department of Hematology of Yuyao People's Hospital (Ningbo, China) between January 2013 and June 2014. AML diagnosis was established in accordance with the revised French-American-British (FAB) classification (11). There were 13 male and 17 female AML patients, with a mean age of 47.8±15.4 years (range, 19–76 years). The present study was approved by the Ethics Committee of Yuyao People's Hospital, and all the donors signed the informed consent form for participation in the study.

DNA isolation and bisulfite conversion

Genomic DNA was extracted using a nucleic acid extraction automatic analyzer (Lab-Aid 820; Zeesan Biotech, Xiamen, China). DNA concentration was measured with NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Inc., Wilmington, DE, USA). DNA samples were subjected to bisulfite conversion by EZ DNA Methylation-Gold™ kit (Zymo Research Corporation, Irvine, CA, USA), according to the manufacturer's protocol.

Methylation-specific polymerase chain reaction (MSP) and DNA sequencing

The methylation status of the MGMT promoter was determined by MSP (12). The reaction contained 1.5 µl sodium bisulfite-converted DNA, 0.5 µl forward primer, 0.5 µl reverse primer (13), 10 µl ZymoTaq™ PreMix (Zymo Research Corporation) and 7.5 µl DNAase/RNAase-free water (Zymo Research Corporation), in a final volume of 20 µl. The details of the methylated and unmethylated primers used are provided in Table I. DNA amplification was performed on Veriti® PCR machine (Applied Biosystems, Thermo Fisher Scientific, Inc.), and the following amplification conditions were used: 95°C for 10 min, followed by 30 or 35 cycles at 94°C for 30 sec, 55°C for 45 sec and 72°C for 1 min. PCR products were subjected to the Qsep100 DNA Analyzer (BiOptic Inc., Taiwan, China). Samples were considered as methylated or unmethylated when peaks were clearly visible by Q-Analyzer software (BiOptic Inc.) (Fig. 1). A number of DNA samples were randomly sequenced using the 3730 DNA Analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc.) to confirm a complete bisulfite conversion (Fig. 2).

Figure 1.

Methylation status of the O(6)-methylguanine-DNA methyltransferase gene in patients with acute myeloid leukemia prior or subsequent to chemotherapy, as analyzed by methylation-specific polymerase chain reaction using methylated or unmethylated primers. The methylated and unmethylated primer sets differentiate the methylation into full methylation (M/-), partial methylation (M/U) and unmethylated (−/U). Methylated; U, unmethylated; L, DNA ladders.

Figure 2.

Validation of the results obtained by methylation-specific polymerase chain reaction via DNA sequencing. Representative images of (A) methylated and (B) unmethylated O(6)-methylguanine-DNA methyltransferase gene. MGMT, O(6)-methylguanine-DNA methyltransferase; M, methylated; U, unmethylated.

Table I.

List of all primers and conditions used in polymerase chain reaction amplification.

Table I.

List of all primers and conditions used in polymerase chain reaction amplification.

Primer setPrimer sequence, 5′-3′Target size, bpTa, °CCycles, no.
Methylated 815535
  F TTTCGACGTTCGTAGGTTTTCGC
  R GCACTCTTCCGAAAACGAAACG
Unmethylated 935530
  F TTTGTGTTTTGATGTTTGTAGGTTTTTGT
  R AACTCCACACTCTTCCAAAAACAAAACA

[i] F, forward; R, reverse; Ta, annealing temperature.

Statistical analysis

Statistical analyses were performed using SPSS version 18.0 (SPSS, Inc., Chicago, IL, USA). MSP results were compared between prior and post-chemotherapy. A two-tailed P-value of <0.05 was considered to indicate a statistically significant difference.

Results

MSP analysis of bone marrow samples from AML patients

To determine whether the chemotherapy treatment would change the methylation status of the MGMT promoter in patients with AML, the pre- and post-chemotherapy bone marrow samples of 30 patients with AML were subjected to MSP analysis. The chemotherapy agents used to treat the patients, including cytarabine (Ara-C), idarubicin (IDA), arsenic trioxide (As2O3), all-trans retinoic acid (ATRA), homoharringtonine (HHT), granulocyte-colony stimulating factor (G-CSF), aclacinomycin (ACLA) and daunorubicin (DNR), are described in Table II. The details of the chemotherapy regimens of all patients are presented in Table III.

Table II.

Clinical parameters of patients with acute myeloid leukemia.

Table II.

Clinical parameters of patients with acute myeloid leukemia.

CaseGenderAge, yearsSubtypeChemotherapy regimenRemissionMethylation level
  1Male55M1HHT+Ara-C+ACLAYesM/U to M/U
  2Male49M1IDA+Ara-CNoM/U to M
  3Male76M2Ara-C+ACLA+G-CSFNoM/U to M/U
  4Male66M2IDA+Ara-CYesM/U to M/U
  5Male23M3 ATRA+As2O3YesM to M/U
  6Male40M3 As2O3+DNR+ATRANoM to M
  7Male59M3HHT+Ara-CYesM to M
  8Male67M4 IDA+Ara-C+ACLA+G-CSF+HHTYesM/U to U
  9Male34M4HHT+Ara-CYesM/U to M/U
10Male68M5Ara-CYesM/U to M/U
11Male59M5Ara-C+ACLAYesM/U to M/U
12Male48M5HHT+Ara-C+ACLANoM/U to M/U
13Male52M6 HHT+Ara-C+G-CSFYesM to M/U
14Female59M1 Ara-C+ACLA+G-CSFNoM/U to M/U
15Female66M2 Ara-C+ACLA+G-CSFYesM/U to M/U
16Female56M2 Ara-C+ACLA+G-CSFYesM/U to M/U
17Female48M2HHT+Ara-C+ACLAYesM/U to M/U
18Female50M2 HHT+Ara-C+G-CSF+IDAYesM/U to M/U
19Female19M2HHT+Ara-C+ACLAYesM/U to M/U
20Female53M2HHT+Ara-CYesM/U to M/U
21Female51M3 ATRA+As2O3+HHT+Ara-CYesM to M/U
22Female42M3IDA+Ara-CNoM to M/U
23Female30M3Ara-CYesM/U to M/U
24Female31M3Ara-CYesM/U to M/U
25Female30M4IDAYesM/U to M/U
26Female30M4IDA+Ara-CNoM to M/U
27Female19M4HHT+Ara-C+ACLAYesM to M/U
28Female42M4Ara-CYesM/U to M/U
29Female64M6HHT+Ara-CNoM/U to M/U
30Female50M6Ara-CYesM/U to M/U

[i] M, full methylation; M/U, partial methylation; U, unmethylation; Ara-C, cytarabine; IDA, idarubicin; As2O3, arsenic trioxide; ATRA, all-trans retinoic acid; HHT, homoharringtonine; G-CSF, granulocyte-colony stimulating factor; ACLA, aclacinomycin; DNR, daunorubicin.

Table III.

Details of the chemotherapy regimens of all the acute myeloid leukemia patients.

Table III.

Details of the chemotherapy regimens of all the acute myeloid leukemia patients.

CaseChemotherapy regimen, dose, treatment duration (route of administration, frequency)
  1HHT: 3 mg, D1-D5 (ivgtt, qd); Ara-C: 75 mg, D1-D5 (ih, q12h); ACLA: 20 mg, D1-D5 (ivgtt, qd)
  2IDA: 15 mg, D1-D3 (ivgtt, qd); Ara-C: 100 mg, D1-D5 (ih, q12h)
  3Ara-C: 15 mg, D1-D14 (ih, q12h); ACLA: 10 mg, D1-D4 (ivgtt, qod); G-CSF: 200 µg (ih, q12h)
  4IDA: 10 mg, D1-D3 (ivgtt, qd); Ara-C: 75 mg, D1-D7 (ih, q12h)
  5ATRA: 10 mg, D1-D14 (po, tid); As2O3: 10 mg, D1-D14 (ivgtt, qod)
  6 As2O3: 9 mg, D1-D14 (ivgtt, qd); DNR: 60 mg, D1-D3 (ivgtt, qd); ATRA: 10 mg, D1-D14 (po, bid)
  7HHT: 3.8 mg, D1-D7 (ivgtt, qd); Ara-C: 95 mg, D1-D5 (ih, q12h)
  8IDA: 10 mg, D1-D2 (ivgtt, qd); Ara-C: 75 mg, D1-D3 (ih, q12h); ACLA: 10 mg, D1-D5 (ivgtt, qod); G-CSF: 300 µg (ih, qd); HHT: 2 mg, D1-D5 (ivgtt, qd)
  9HHT: 2 mg, D1-D5 (ivgtt, qd); Ara-C: 100 mg, D1-D5 (ih, q12h)
10Ara-C: 22.5 mg, D1-D3 (ih, q12h)
11Ara-C: 100 mg, D1-D5 (ih, q12h); ACLA: 100 mg, D1-D5 (ivgtt, qod)
12HHT: 2 mg, D1-D3 (ivgtt, qd); Ara-C: 100 mg, D1-D3 (ih, q12h); ACLA: 100 mg, D1-D3 (ivgtt, qod)
13HHT: 2 mg, D1-D5 (ivgtt, qd); Ara-C: 100 mg, D1-D5 (ih, q12h); G-CSF 400 µg (ih, qd)
14Ara-C: 16 mg, D1-D14 (ih, q12h); ACLA: 20 mg, D1-D4 (ivgtt, qod); G-CSF: 300 µg (ih, qd)
15Ara-C: 15 mg, D1-D14 (ih, q12h); ACLA: 20 mg, D1-D7 (ivgtt, qod); G-CSF: 300 µg (ih, qd)
16Ara-C: 16 mg, D1-D14 (ih, q12h); ACLA: 20 mg, D1-D4 (ivgtt, qod); G-CSF: 300 µg (ih, qd)
17HHT: 2.8 mg, D1-D5 (ivgtt, qd); Ara-C: 70 mg, D1-D7 (ih, q12h); ACLA: 20 mg, D1-D5 (ivgtt, qd)
18HHT: 3 mg, D1-D7 (ivgtt, qd); Ara-C: 15 mg, D1-D14 (ih, q12h); G-CSF: 200 mg (ih, qd); IDA: 10 mg, D1-D4 (ivgtt, qd)
19HHT: 3 mg, D1-D5 (ivgtt, qd); Ara-C: 75 mg, D1-D5 (ih, q12h); ACLA: 20 mg, D1-D5 (ivgtt, qd)
20HHT: 2 mg, D1-D5 (ivgtt, qd); Ara-C: 100 mg, D1-D5 (ih, q12h)
21ATRA: 20 mg, D1-D14 (po, bid); As2O3: 10 mg, D1-D14 (ivgtt, qd); HHT: 3 mg, D1-D5 (ivgtt, qd); Ara-C: 15 mg, D1-D5 (ivgtt, qd)
22IDA: 10 mg, D1-D3 (ivgtt, qd); Ara-C: 146 mg, D1-D5 (ih, q12h)
23Ara-C: 12.5 mg, D1-D3 (ih, q12h)
24Ara-C: 100 mg, D1-D3 (ih, q12h);
25IDA: 15 mg, D1-D3 (ivgtt, qd)
26IDA: 15 mg, D1-D3 (ivgtt, qd); Ara-C: 400 mg, D1-D7 (ih, q12h)

[i] HHT, homoharringtonine; D, day; ivgtt, intravenous drip; qd, administered once per day; Ara-C, cytarabine; ih, hypodermic injection; q12h, administered once every 12 hours; ACLA, aclacinomycin; IDA, idarubicin; qod, administered once every other day; G-CSF, granulocyte-colony stimulating factor; ATRA, all-trans retinoic acid; po, oral; tid, three times a day; As2O3, arsenic trioxide; DNR, daunorubicin; bid, administered twice per day.

Regimen-based subgroup analysis of methylation changes in patients with AML

A total of 8 patients subjected to 6 different chemotherapy regimens presented chemotherapy-induced methylation changes, including 1 patient with induced hypermethylation and 7 patients with induced hypomethylation. Among the 3 patients under IDA+Ara-C treatment, 1 exhibited induced hypermethylation and poor prognosis, in contrast to the other 2 patients, who exhibited induced hypomethylation and poor prognosis. The remaining 5 patients with induced hypomethylation and good prognosis were under ATRA+As2O3, IDA+Ara-C+ACLA+G-CSF+HHT, HHT+Ara-C+G-CSF, ATRA+As2O3+HHT+Ara-C and HHT+Ara-C+ACLA treatment, respectively.

AML subtype-based subgroup analysis of methylation changes in patients with AML

The present cohort included 3 M1, 8 M2, 7 M3, 6 M4, 3 M5 and 3 M6 AML subtypes. The outcomes of chemotherapy-induced methylation changes differed among the various AML subtypes. Chemotherapy-induced methylation changes were more frequent among M4 subtype patients (50.0%, 3 out of 6 patients), compared with other subtypes (M1, 33.3%, 1 out of 3 patients; M2, 0.0%, 0 out of 8 patients; M3, 42.9%, 3 out of 7 patients; M5, 0.0%, 0 out of 3 patients; and M6, 33.3%, 1 out of 3 patients). Of the aforementioned M4 cases, 2 patients who had received IDA+Ara-C+ACLA+G-CSF+HHT and HHT+Ara-C+ACLA treatment, respectively, presented chemotherapy-induced hypomethylation and good prognosis, whereas 1 patient who had been treated with IDA+Ara-C exhibited chemotherapy-induced hypomethylation and poor prognosis.

Age-based subgroup analysis of methylation changes in patients with AML

In the present study, there were 24 AML patients aged ≤60 years and 6 AML patients aged >60 years. Analysis by age revealed that chemotherapy-induced methylation changes were more often observed among AML patients aged ≤60 years (29.2%, 7 out of 24 patients), compared with those aged >60 years (16.7%, 1 out of 6 patients). Among the patients aged ≤60 years, 1 M1 patient (IDA+Ara-C, aged 49 years) exhibited chemotherapy-induced hypermethylation and poor prognosis; 2 M3 patients (ATRA+As2O3, aged 23 years; and ATRA+As2O3+HHT+Ara-C, aged 51 years) presented chemotherapy-induced hypomethylation and remission; 1 M3 patient (aged 42 years) experienced worsening of the condition following IDA+Ara-C treatment; 1 M4 patient (IDA+Ara-C, aged 30 years) exhibited chemotherapy-induced hypomethylation and aggravation of the condition; 1 M4 patient (HHT+Ara-C+ACLA, aged 19 years) displayed chemotherapy-induced hypomethylation along with remission; and 1 M6 patient (HHT+Ara-C+G-CSF, aged 52 years) presented chemotherapy-induced hypomethylation along with remission. Only 1 M4 patient aged >60 years (IDA+Ara-C+ACLA+G-CSF+HHT, aged 67 years) exhibited chemotherapy-induced hypomethylation and remission.

Gender-based subgroup analysis of methylation changes in patients with AML

In total, 4 out of 13 male patients and 4 out of 17 female patients who had been subjected to different combined regimens exhibited chemotherapy-induced methylation changes in the promoter of the MGMT gene. Among the male patients, 1 M1 patient (IDA+Ara-C) presented hypermethylation along with poor prognosis, whereas 1 M3 patient (ATRA+As2O3), 1 M4 patient (IDA+Ara-C+ACLA+G-CSF+HHT) and 1 M6 patient (HHT+Ara-C+G-CSF) presented chemotherapy-induced hypomethylation along with remission. The remaining 9 male patients (2 of which had been treated with HHT+Ara-C+ACLA, 1 with HHT+Ara-C, 1 with Ara-C+ACLA+G-CSF, 1 with IDA+Ara-C, 1 with As2O3+DNR+ATRA, 1 with Ara-C and 1 with Ara-C+ACLA) did not exhibit any methylation changes induced by the chemotherapeutic agents.

In the female subgroup, 1 M3 patient who had been treated with ATRA+As2O3+HHT+Ara-C) and 1 M4 patient who had been treated with HHT+Ara-C+ACLA presented chemotherapy-induced hypomethylation along with good prognosis, while 2 female patients (1 M3 and 1 M4 who had been treated with IDA+Ara-C) exhibited chemotherapy-induced hypomethylation and poor prognosis. The remaining 13 female patients (4 of which had been treated with Ara-C, 3 with Ara-C+ACLA+G-CSF, 2 with HHT+Ara-C, 2 with Ara-C+ACLA+G-CSF, 1 with HHT+Ara-C+G-CSF+IDA and 1 with IDA) did not exhibit any induced methylation changes following chemotherapy.

Discussion

Increasing evidence has demonstrated that epigenetics, including DNA methylation, is important in the pathogenesis of cancer (14). The dysregulation of critical genes involved in cell growth, differentiation, apoptosis and repair of DNA lesions may increase the incidence of malignant phenotypes (15). As a DNA repair enzyme, MGMT mainly participates in maintaining genomic stability if spontaneous mutagenesis occurs (10). However, the association between chemotherapy-induced methylation changes in the MGMT promoter and pathogenesis of AML has not been fully elucidated thus far. The aim of the present study was to explore the association between the chemotherapeutic outcomes of patients with AML and the chemotherapy-induced methylation changes in the promoter of the MGMT gene that occur in the bone marrow of AML patients during chemotherapeutic treatment.

The results of the present study demonstrated that the methylation status of the MGMT promoter changed during the treatment with different chemotherapeutic regimens. MGMT was observed to be more often hypomethylated (7 patients out of 8) than hypermethylated (1 patient out of 8) by the different chemotherapeutic regimens. Among the AML patients, M4 (3 out of 6 patients) and M3 patients (3 out of 7 patients) exhibited chemotherapy-induced methylation changes more frequently than patients with other AML subtypes. Age-based subgroup analysis revealed that patients aged ≤60 years (7 out of 24 patients) presented methylation changes more frequently than patients aged >60 years (1 out of 6 patients). In addition, male patients appeared to be more susceptible to chemotherapy-induced methylation changes than female patients.

Different subtypes of AML may exhibit different responses to multiple chemotherapeutics, which may influence DNA methylation and remission (16). According to the FAB classification, M3 is the best curable subtype of AML, due to its sensitivity toward ATRA treatment, which causes the differentiation of promyelocytes (17). The present findings revealed 3 hypomethylated patients, of which, 2 (who had been treated with ATRA+As2O3 and ATRA+As2O3+HHT+Ara-C, respectively) experienced emission, while 1 (wo had been subjected to IDA+Ara-C treatment) experienced aggravation of the condition, suggesting individual differences during chemotherapy. In addition, M4 patients presented chemotherapy-induced methylation changes more often than other subtypes, which suggests that the association between the methylation status of the MGMT promoter and the chemotherapeutic outcomes of patients with AML may depend on the AML subtype.

Age may be an important risk factor in the selection of therapy for AML (18). Decreased visceral function, drug resistance and poor reactivity among the elders may lead to poor prognosis and high recurrence rate, which results in a poor overall 5-year survival rate for elderly AML patients (3). The analysis by age conducted in the present study demonstrated that chemotherapy-induced hypomethylation events were more frequent among AML patients aged ≤60 years than among those aged >60 years, suggesting that young patients may be more sensitive to chemotherapeutic drugs.

Gender discrepancy must be considered when referring to cancer prognosis (19). A previous study emphasized the significantly higher incidence rates of acute leukemia in male patients, compared with female patients (20). In the present study, chemotherapy-induced hypomethylation of MGMT along with good prognosis occurred more often in males than in females, suggesting the potential of this gene to serve as a biomarker to predict the chemotherapeutic outcomes in male patients with AML. Furthermore, IDA+Ara-C regimen led to worse outcomes among female patients, compared with males.

In conclusion, the outcomes of chemotherapy-induced methylation of the MGMT gene in AML patients varied among the different AML subtypes, gender and age of patients in the present study. MGMT promoter methylation may serve as a prognostic value for individualized chemotherapy in the future. However, further studies in larger sample sets are required to confirm the present findings.

Acknowledgements

The present study was supported by grants from the National Natural Science Foundation of China (Beijing, China; grant nos. 31100919 and 81371469), Zhejiang Provincial Natural Science Foundation (Hangzhou, China; grant no. LR13H020003), Ningbo City Medical Science and Technology Projects (Ningbo, China; grant no. 2014A20) and K. C. Wong Magna Fund in Ningbo University, Ningbo, China.

References

1 

Estey EH: Acute myeloid leukemia: 2013 update on risk-stratification and management. Am J Hematol. 88:318–327. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Davis AS, Viera AJ and Mead MD: Leukemia: An overview for primary care. Am Fam Physician. 89:731–738. 2014.PubMed/NCBI

3 

Thein MS, Ershler WB, Jemal A, Yates JW and Baer MR: Outcome of older patients with acute myeloid leukemia: An analysis of SEER data over 3 decades. Cancer. 119:2720–2727. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Stringaris K, Sekine T, Khoder A, Alsuliman A, Razzaghi B, Sargeant R, Pavlu J, Brisley G, de Lavallade H, Sarvaria A, et al: Leukemia-induced phenotypic and functional defects in natural killer cells predict failure to achieve remission in acute myeloid leukemia. Haematologica. 99:836–847. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Maurillo L, Venditti A, Spagnoli A, Gaidano G, Ferrero D, Oliva E, Lunghi M, D'Arco AM, Levis A, Pastore D, et al: Azacitidine for the treatment of patients with acute myeloid leukemia: Report of 82 patients enrolled in an Italian Compassionate Program. Cancer. 118:1014–1022. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Boultwood J and Wainscoat JS: Gene silencing by DNA methylation in haematological malignancies. Br J Haematol. 138:3–11. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Tuominen R, Jewell R, van den Oord JJ, Wolter P, Stierner U, Lindholm C, Johansson Hertzman C, Lindén D, Johansson H, Frostvik Stolt M, et al: MGMT promoter methylation is associated with temozolomide response and prolonged progression-free survival in disseminated cutaneous melanoma. Int J Cancer. 136:2844–2853. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Iyama T and Wilson DM 3rd: DNA repair mechanisms in dividing and non-dividing cells. DNA Repair (Amst). 12:620–636. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Kraguljac Kurtović N, Krajnović M, Bogdanović A, Suvajdžić N, Jovanović J, Dimitrijević B, Colović M and Krtolica K: Concomitant aberrant methylation of p15 and MGMT genes in acute myeloid leukemia: Association with a particular immunophenotype of blast cells. Med Oncol. 29:3547–3556. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Brandwein JM, Kassis J, Leber B, Hogge D, Howson-Jan K, Minden MD, Galarneau A and Pouliot JF: Phase II study of targeted therapy with temozolomide in acute myeloid leukaemia and high-risk myelodysplastic syndrome patients pre-screened for low O (6)-methylguanine DNA methyltransferase expression. Br J Haematol. 167:664–670. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Fasan A, Alpermann T, Haferlach C, Grossmann V, Roller A, Kohlmann A, Eder C, Kern W, Haferlach T and Schnittger S: Frequency and prognostic impact of CEBPA proximal, distal and core promoter methylation in normal karyotype AML: A study on 623 cases. PLoS One. 8:e543652013. View Article : Google Scholar : PubMed/NCBI

12 

Chen C, Wang L, Liao Q, Huang Y, Ye H, Chen F, Xu L, Ye M and Duan S: Hypermethylation of EDNRB promoter contributes to the risk of colorectal cancer. Diagn Pathol. 8:1992013. View Article : Google Scholar : PubMed/NCBI

13 

Vidal DO, Paixão VA, Brait M, Souto EX, Caballero OL, Lopes LF and Vettore AL: Aberrant methylation in pediatric myelodysplastic syndrome. Leuk Res. 31:175–181. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Reid T, Oronsky B, Scicinski J, Scribner CL, Knox SJ, Ning S, Peeh DM, Korn R, Stirn M, Carter CA, et al: Safety and activity of RRx-001 in patients with advanced cancer: A first-in-human, open-label, dose-escalation phase 1 study. Lancet Oncol. 16:1133–1142. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Malonia SK, Sinha S, Lakshminarasimhan P, Singh K, Jalota-Badhwar A, Rampalli S, Kaul-Ghanekar R and Chattopadhyay S: Gene regulation by SMAR1: Role in cellular homeostasis and cancer. Biochim Biophys Acta. 1815:1–12. 2011.PubMed/NCBI

16 

Johannes Z, Ina Radtke, Timothy S, Pardee, Zhen Zhao, Amy R, Rappaport, Weijun Luo, Mila E, McCurrach, Yang MM, Dolan ME, Kogan SC, et al: Mouse models of human AML accurately predict chemotherapy response. Genes Dev. 23:877–889. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Poddighe PJ, Wessels H, Merle P, Westers M, Bhola S, Loonen A, Zweegman S, Ossenkoppele GJ and Wondergem MJ: Genomic amplification of MYC as double minutes in a patient with APL-like leukemia. Mol Cytogenet. 7:672014. View Article : Google Scholar : PubMed/NCBI

18 

Ofran Y and Rowe JM: Acute myeloid leukemia in adolescents and young adults: Challenging aspects. Acta Haematol. 132:292–297. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Pui CH: Acute leukemias with the t(4;11)(q21;q23). Leuk Lymphoma. 7:173–179. 1992. View Article : Google Scholar : PubMed/NCBI

20 

Shahab F and Raziq F: Clinical presentations of acute leukemia. J Coll Physicians Surg Pak. 24:472–476. 2014.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hong Q, Chen X, Ye H, Zhou A, Gao Y, Jiang D, Wu X, Tian B, Chen Y, Wang M, Wang M, et al: Association between the methylation status of the MGMT promoter in bone marrow specimens and chemotherapy outcomes of patients with acute myeloid leukemia. Oncol Lett 11: 2851-2856, 2016.
APA
Hong, Q., Chen, X., Ye, H., Zhou, A., Gao, Y., Jiang, D. ... Duan, S. (2016). Association between the methylation status of the MGMT promoter in bone marrow specimens and chemotherapy outcomes of patients with acute myeloid leukemia. Oncology Letters, 11, 2851-2856. https://doi.org/10.3892/ol.2016.4317
MLA
Hong, Q., Chen, X., Ye, H., Zhou, A., Gao, Y., Jiang, D., Wu, X., Tian, B., Chen, Y., Wang, M., Xie, J., Xia, Y., Duan, S."Association between the methylation status of the MGMT promoter in bone marrow specimens and chemotherapy outcomes of patients with acute myeloid leukemia". Oncology Letters 11.4 (2016): 2851-2856.
Chicago
Hong, Q., Chen, X., Ye, H., Zhou, A., Gao, Y., Jiang, D., Wu, X., Tian, B., Chen, Y., Wang, M., Xie, J., Xia, Y., Duan, S."Association between the methylation status of the MGMT promoter in bone marrow specimens and chemotherapy outcomes of patients with acute myeloid leukemia". Oncology Letters 11, no. 4 (2016): 2851-2856. https://doi.org/10.3892/ol.2016.4317
Copy and paste a formatted citation
x
Spandidos Publications style
Hong Q, Chen X, Ye H, Zhou A, Gao Y, Jiang D, Wu X, Tian B, Chen Y, Wang M, Wang M, et al: Association between the methylation status of the MGMT promoter in bone marrow specimens and chemotherapy outcomes of patients with acute myeloid leukemia. Oncol Lett 11: 2851-2856, 2016.
APA
Hong, Q., Chen, X., Ye, H., Zhou, A., Gao, Y., Jiang, D. ... Duan, S. (2016). Association between the methylation status of the MGMT promoter in bone marrow specimens and chemotherapy outcomes of patients with acute myeloid leukemia. Oncology Letters, 11, 2851-2856. https://doi.org/10.3892/ol.2016.4317
MLA
Hong, Q., Chen, X., Ye, H., Zhou, A., Gao, Y., Jiang, D., Wu, X., Tian, B., Chen, Y., Wang, M., Xie, J., Xia, Y., Duan, S."Association between the methylation status of the MGMT promoter in bone marrow specimens and chemotherapy outcomes of patients with acute myeloid leukemia". Oncology Letters 11.4 (2016): 2851-2856.
Chicago
Hong, Q., Chen, X., Ye, H., Zhou, A., Gao, Y., Jiang, D., Wu, X., Tian, B., Chen, Y., Wang, M., Xie, J., Xia, Y., Duan, S."Association between the methylation status of the MGMT promoter in bone marrow specimens and chemotherapy outcomes of patients with acute myeloid leukemia". Oncology Letters 11, no. 4 (2016): 2851-2856. https://doi.org/10.3892/ol.2016.4317
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team