Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-2017 Volume 13 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2017 Volume 13 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma

  • Authors:
    • Hai‑Ping Zhang
    • Jian Zou
    • Zhuo‑Qun Xu
    • Jun Ruan
    • Shu‑Dong Yang
    • Ying Yin
    • Hui‑Jun Mu
  • View Affiliations / Copyright

    Affiliations: Department of Derma Science Laboratory, Wuxi No. 2 People's Hospital Affiliated to Nanjing Medical University, Wuxi, Jiangsu 214002, P.R. China, Department of Clinical Laboratory Science, Wuxi People's Hospital Affiliated to Nanjing Medical University, Wuxi, Jiangsu 214023, P.R. China, Department of Urinary Surgery, Wuxi People's Hospital Affiliated to Nanjing Medical University, Wuxi, Jiangsu 214023, P.R. China, Department of Pathology, Wuxi People's Hospital Affiliated to Nanjing Medical University, Wuxi, Jiangsu 214023, P.R. China
  • Pages: 463-468
    |
    Published online on: November 22, 2016
       https://doi.org/10.3892/ol.2016.5408
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Although an association between obesity and the occurrence of renal cell carcinoma (RCC) has been identified, the mechanism by which obesity functions to increase this risk of cancer remains unclear. Leptin, visfatin, apelin, resistin and adiponectin are peptide hormones secreted by adipocytes; it is considered that these may affect RCC development by exerting effects on proliferation, cell growth and inflammation. The aim of the present study was to investigate the association between the aforementioned adipokine genes and clear cell RCC (CC‑RCC). The GSE6344 dataset was downloaded from the Gene Expression Omnibus database, and the relative expression levels of the adipokine genes were analyzed. To verify the results of the mRNA microarray, 77 paired samples of CC‑RCC and corresponding adjacent normal tissue were allocated into two groups. The extraction of total RNA was conducted, and the mRNA expression of adipokine genes was analyzed using reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR). The data from the GSE6344 dataset indicated that the expression of visfatin and apelin was upregulated (P<0.0001 and P<0.01, respectively), and adiponectin was downregulated (P<0.001) in the CC‑RCC tissues compared with the adjacent normal tissues. The data from RT‑qPCR demonstrated that visfatin and resistin gene expression was increased (P<0.01 and P<0.05, respectively) in the CC‑RCC tissues. Furthermore, the mRNA expression level of leptin and adiponectin in the adjacent normal tissue was higher than those in the cancer tissue (P<0.01). The current study verifies that visfatin and adiponectin are associated with an increased risk of CC‑RCC, which presents further insights into the molecular mechanisms of CC‑RCC tumorigenesis.

Introduction

Renal cell carcinoma (RCC) is one of the most lethal types of cancer within the urinary system, and up to one-third of patients with RCC already present with primary metastases at the time of diagnosis (1). RCC is categorized into four major subtypes according to the Heidelberg classification system (2): i) Clear cell RCC (CC-RCC); ii) papillary RCC: iii) chromophobe RCC; and iv) renal oncocytoma. CC-RCC is the most prevalent subtype of RCC, accounting for ~80% of cases (3). Specific molecular mechanisms have been identified in RCC tumorigenesis, including von Hipple-Lindau gene mutation (4). Somatic mutation of this gene has been associated with the development of ~60% of sporadic CC-RCC (5). However, no current theory is able to explain all cases of CC-RCC development. To understand the pathogenesis of CC-RCC in detail, further research is warranted.

A number of epidemiological studies have connected the occurrence of renal cancer to obesity (6–8). A specific association between obesity and RCC has been established, however, the mechanism by which obesity increases the risk of cancer remains unclear (9). Recently, certain obesity-associated biomarkers have been identified and are considered as a possible link between the two features (10). Among these biomarkers, the adipokines are of particular note. Adipokines, including adiponectin, leptin, resistin, visfatin and apelin, are peptide hormones secreted primarily by adipose tissue and are associated with metabolic syndrome (11). Studies have identified that adipokines affect various pro-neoplastic mechanisms, including inflammation, cell growth and proliferation (12,13). Studies have also demonstrated that adipokines are promising predictors of risk and progression in various types of cancer (14,15). Such evidence suggests that adipokines contribute to the initiation of carcinogenesis and tumor progression.

Microarray technology provides a wide range of information regarding molecules that have been associated with disease pathogenesis, and subsequently aids the elucidation of the underlying molecular mechanisms of disease. To gain insights into the pathogenesis of CC-RCC, several gene expression profiling studies have been conducted analyzing differences between tumor and normal tissue (16,17). Such studies have identified a number of differentially-expressed genes, including the adipokine genes. In the present study, to investigate the association between adipokine genes and the molecular mechanisms of RCC, gene expression profiles of 10 CC-RCC and 10 adjacent normal tissue controls were downloaded from the Gene Expression Omnibus (GEO) database, and the relevant adipokine gene data was analyzed. To verify the results of mRNA microarray, the expression of various adipokine genes were analyzed in 77 CC-RCC patients using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The present study aimed to identify the underlying mechanisms of obesity that may result in an increased risk of CC-RCC.

Materials and methods

Patients

In the current study, a total of 77 patients were enrolled, who had been histologically diagnosed with CC-RCC between December 2005 and September 2012. The patients consisted of 14 females and 63 males, with ages ranging from 17 to 85 years (mean ± standard deviation, 56.22±12.27 years).

All protocols were approved by the ethics committee of Wuxi People's Hospital Affiliated to Nanjing Medical University (Wuxi, China) prior to the initiation of the study, and the protocols conformed to the ethical guidelines of the 1975 Helsinki Declaration. Informed consent was obtained from each patient prior to surgery.

RNA extraction

Tumor tissue samples and corresponding adjacent normal tissues were obtained from resection surgical specimens, and were immediately dissociated into single cells using the Medimachine system (BD Biosciences, Franklin Lakes, NJ, USA). The cells were then dissolved in 1 ml Trizol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and stored at −80°C. Total cellular RNA was extracted using the Trizol reagent following the manufacturer's protocols. The quantity and purity of RNA were determined with the Beckman DU-640 Spectrophotometer (Beckman Coulter, Inc., Brea, CA, USA).

Reverse transcription reaction

Total RNA (2 µg) and 200 ng random primer (Sangon Biotech Co., Ltd., Shanghai, China) were added to 15 µl diethylpyrocarbonate (DEPC) treated with H2O; this was subsequently incubated at 65°C for 5 min and then cooled rapidly on ice. Following this, 2.0 µl DEPC H2O, 5.0 µl 5X RT buffer (containing 375 mM/l KCl, 250 mM/l Tris-HCl, 3 mM/l MgCl2 and 50 mM/l dithiothreitol), 1.25 µl 10 mM/l deoxynucleoside triphosphate (dNTP; Sangon Biotech Co., Ltd.), 0.75 µl 40 U/µl RNAsin (Sangon Biotech Co., Ltd.) and 1.0µl 200 U/µl MMLV Reverse Transcriptase (Promega Corporation, Madison, WI, USA) were added, centrifuged at 1,000 × g for 30 sec at 4°C and incubated at 37°C for 60 min, and finally stored at −20°C.

Gene expression analysis using RT-qPCR

RT-qPCR was performed using the LightCycler® 480 Real-Time PCR system (Roche Diagnostics, Basel, Switzerland). The primers utilized during PCR are presented in Table I. PCR was performed using a final volume of 20 µl, which contained 2 µl 25 mM/l MgCl2, 10 mM/µl sense and antisense primers (1.0 µl each), 0.4 µl 10 mmol/l dNTP, 1.0 µl EvaGreen® dye (Biotium Inc., Hayward, CA, USA), 2.0 µl 5X PCR buffer (Promega Corporation), 2.0 µl complementary DNA, 0.5 units Taq DNA Polymerase buffer (Promega Corporation) and up to 20 µl H2O. Following initial denaturation at 94°C for 2 min, a total of 40 cycles were performed. Each cycle consisted of denaturation at 94°C for 5 sec, annealing at 58°C for 20 sec and elongation at 72°C for 20 sec, followed by a single fluorescence measurement. Melting curve analyses of the amplified products were performed to confirm the specificity of qPCR assay. Samples were normalized using the housekeeping gene GAPDH.

Table I.

Sequences of primers used for reverse transcription-quantitative polymerase chain reaction analysis of the adipokine genes and the GAPDH gene.

Table I.

Sequences of primers used for reverse transcription-quantitative polymerase chain reaction analysis of the adipokine genes and the GAPDH gene.

GeneOrientationPrimer sequence (5′-3′)
GAPDHForward CAACTTTGGTATCGTGGAAGGACTC
ReverseAGG GATGATGTTCTGGAGAGCC
LeptinForward CGTTAAGGGAAGGAACTCTGG
Reverse TGGCTTAGAGGAGTCAGGGA
ResistinForward GTGTGCCGGATTTGGTTAGC
Reverse AGGAGGAGGAGACAGAGAGC
VisfatinForward CTTCGGTTCTGGTGGAGGTT
Reverse ATCGGCCCTTTTTGGACCTT
ApelinForward GCTGACAGTTCGCCCTTACT
Reverse ATATGTGGGCATGGGGACAC
AdiponectinForward ATGGCCCCTGCACTACTCTA
Reverse CAGGGATGAGTTCGGCACTT
Affymetrix microarray analysis

The gene expression profile of GSE6344 was downloaded from the National Center for Biotechnology Information GEO database, which is based on the Affymetrix Human Genome U133A Array platform (Affymetrix, Inc., Santa Clara, CA, USA). A total of 20 samples, including 10 CC-RCC and 10 adjacent normal tissue specimens, were available for GSE6344 microarray analysis. The original mRNA expression profile was standardized using rank value, and the relative expression levels of adipokine genes were analyzed.

Statistical analysis

Changes in adipokine genes expression between CC-RCC and adjacent normal tissues were determined by the comparative ΔΔCq method (18), using GAPDH as an internal reference. ΔΔCq = ΔCq (CC-RCC group) - ΔCq (normal group) for RNA samples. Quantification cycle (Cq) is defined as an index of the number of cycles required for the fluorescent signal to cross the threshold. ΔCq represents the difference in Cq values derived from the target gene (in each sample assayed) and the GAPDH gene, while ΔΔCq represents the difference between the paired samples. The n-fold differential ratio was expressed as 2-ΔΔCq. Comparisons between the samples (CC-RCC vs. adjacent normal tissue) were performed using a one-way analysis of variance. All statistical data were analyzed using SPSS software v15.0 (SPSS, Inc., Chicago, IL, USA). P<0.05 was used to indicate a statistically significant difference. As compared with the adjacent normal tissue, genes in the CC-RCC tissue with statistically significant differences at P<0.05 and a fold change of ≥1.5 were considered as upregulated, whereas those with P<0.05 with a fold change of ≤0.75 were considered as downregulated. Comparisons between the samples (CC-RCC vs. adjacent normal tissue) in the GSE6344 dataset were performed using a non-parametric Mann-Whitney U test.

Results

Expression of leptin, visfatin, apelin, resistin and adiponectin mRNA in CC-RCC with Affymetrix microarray analysis

Analysis of leptin, visfatin, apelin, resistin and adiponectin relative expression was performed between the CC-RCC and adjacent normal tissues from the GSE6344 microarray dataset (Fig. 1). The GSE6344 dataset demonstrated that the expression of visfatin and apelin was upregulated (P<0.0001 and P<0.01, respectively), whilst adiponectin was downregulated (P<0.001) in the CC-RCC tissues compared with the adjacent normal tissues, relative to GAPDH. However, the expression of leptin and resistin exhibited no significant difference between the CC-RCC and adjacent normal tissues (P>0.05).

Figure 1.

Analysis of (A) leptin, (B) visfatin, (C) apelin, (D) resistin and (E) adiponectin mRNA expression profiles in CC-RCC and adjacent normal tissues in the GSE6344 dataset. CC-RCC, clear cell renal cell carcinoma.

Expression of leptin, visfatin, apelin, resistin and adiponectin mRNA in CC-RCC and adjacent normal tissue samples with RT-qPCR

RT-qPCR was used to confirm the results of gene microarray for the selected adipokine genes. Table II presents the mRNA expression of leptin, visfatin, apelin, resistin and adiponectin between the CC-RCC and adjacent normal tissues. The data demonstrated that visfatin and resistin gene expression was upregulated in the CC-RCC tissues (P<0.01 and P<0.05, respectively). However, the mRNA expression level of leptin and adiponectin in adjacent normal tissue was higher than that in the cancer tissue (P<0.01). The data also indicated that the expression of apelin was not significantly different between the CC-RCC and adjacent normal tissues (P>0.05).

Table II.

mRNA expression profiles of adipokine in 77 patients with CC-RCC, acquired through reverse transcription-quantitative polymerase chain reaction.

Table II.

mRNA expression profiles of adipokine in 77 patients with CC-RCC, acquired through reverse transcription-quantitative polymerase chain reaction.

GeneCC-RCC tissue, mean ± SDAdjacent normal tissue, mean ± SD 2−ΔΔCq
Leptina30.61±1.6230.63±2.460.37
Resistinb30.76±2.0532.90±1.311.62
Visfatina22.73±0.8825.24±1.072.09
Ampelin28.31±1.6130.02±2.021.20
Adiponectina31.57±1.9931.55±2.640.37
GAPDH20.48±1.1821.92±0.80

{ label (or @symbol) needed for fn[@id='tfn1-ol-0-0-5408'] } All results are expressed as the mean ± SD of Cq.

a P<0.01

b P<0.05, CC-RCC vs. adjacent normal tissues. CC-RCC, clear cell renal cell carcinoma; SD, standard deviation.

Discussion

Although obesity is recognized as a potent risk factor for RCC development (19), the mechanism through which it functions to increase RCC risk is unclear. Recently, adipokines have been thoroughly investigated as novel biomarkers that may indicate cancer risk. Adipokines, derived from adipose tissue, serve roles in lipid and glucose metabolism, regulation of energy balance and inflammatory processes (20). Adipokines are understood to be involved in certain obesity-associated forms of cancer, and serve a key role in tumorigenesis and prognosis (21,22). To the best of our knowledge, the current study is the first to identify a difference in visfatin and apelin expression levels in CC-RCC and control tissues. Furthermore, several studies have reported a difference in leptin, resistin and adiponectin serum levels in CC-RCC tissues (23,24). However, the physiological role of leptin and adiponectin in CC-RCC remains controversial. Therefore, in the present study, the mRNA expression variation of visfatin, resistin, apelin, leptin and adiponectin was investigated in CC-RCC.

Leptin is a multifunctional peptide hormone that regulates energy expenditure (25), promotes proliferation (26) and angiogenesis (27), and inhibits cell apoptosis (28). Studies have demonstrated that leptin levels are higher in lung cancer (15), breast cancer (29) and RCC (30), whilst other studies have reported that serum leptin levels are inversely associated with RCC risk (23) or are not significantly associated with RCC (24,31). These contradictory results, and the serum level features, suggest that further investigation is required. The microarray analysis from the present study demonstrated that the expression of leptin exhibited no significant difference between the CC-RCC and adjacent normal tissues. However, it was also identified that the mRNA expression level of leptin in the CC-RCC tissues was significantly lower than that in the adjacent normal tissues with RT-qPCR.

Visfatin is an adipokine associated with obesity and glucose regulation. Visfatin was originally identified as a cytokine and was termed pre-B cell-enhancing factor, also known as Nampt (32). The adipokine possesses nicotinamide adenine dinucleotide biosynthetic activity and regulates mammalian cell growth and apoptosis (33); it is also known to promote novel blood vessel formation and migration (34). The function of visfatin in carcinogenesis and as a chemotherapeutic target has gained the increasing attention of researchers. Studies have reported that the expression of visfatin is correlated with various types of cancer, including breast (35), colorectal (36) and gastric (37) cancer. However, to the best of our knowledge, the association between visfatin and CC-RCC has not been confirmed until now. In the present study, the GSE6344 dataset demonstrated that the expression of visfatin was upregulated in the CC-RCC tissues compared to the adjacent normal tissues. The RT-qPCR data of 77 CC-RCC patients also indicated that visfatin gene expression was upregulated.

Apelin, a recently described adipokine, is a mitogenic factor expressed in endothelial cells (38). Apelin is involved in the process of cell proliferation (39) and stimulates cancer angiogenesis (40). A case-control study observed that serum apelin levels increased significantly in patients with gastroesophageal cancer (41). However, there is no epidemiological data regarding the association between apelin and CC-RCC risk. The GSE6344 dataset demonstrates that the expression of apelin was upregulated in the CC-RCC tissues compared to the adjacent normal tissues. However, the RT-qPCR data indicated that the expression of apelin was not significantly different between the CC-RCC and adjacent normal tissues (P>0.05).

Resistin is a member of the recently identified family of cysteine-rich proteins; it is the primary product of macrophages that infiltrates into adipose tissue (42), and has been associated with adiposity, inflammation and insulin resistance (43). Resistin serum concentrations have been observed to be significantly higher in patients with cancer than in controls (41,44). However, one study has reported that circulating levels of resistin are not associated with RCC (24). In the present study, the GSE6344 dataset demonstrated that the expression of resistin exhibited no significant difference between the CC-RCC and adjacent normal tissues. However, the RT-qPCR data indicated that the mRNA expression level of resistin in the CC-RCC tissues was significantly higher than that in the adjacent normal tissues.

Adiponectin is a circulating adipokine secreted by mature adipocytes. The circulating level of adiponectin is inversely associated with insulin resistance and obesity (45). Abundant evidence indicates that adiponectin suppresses the growth of cancer cells and reduces the risk of cancer (14,46). Studies have reported that serum adiponectin levels are inversely associated with RCC, and breast and colon cancer (47,48). While the preponderance of evidence suggests that an inverse association exists between adiponectin and malignancy, another study reported that higher levels of serum adiponectin were associated with RCC risk, specifically among African-American males (31). Enhanced adiponectin serum concentrations appear to indicate inflammatory status and advanced stages of malignancy (49,50). However, all aforementioned studies were confined to studying adiponectin levels within the circulatory system. In the present study, the RT-qPCR data indicated that the mRNA expression level of adiponectin in the CC-RCC tissues was significantly lower than that of the adjacent normal tissues, which was consistent with the GSE6344 dataset.

Microarray technology provides a wide range of information regarding molecules that are associated with disease pathogenesis. However, the high cost of detection limits the application in larger samples, which may lead to reduced sensitivity. RT-qPCR is the gold standard for verification of microarray data. In the present study, the data regarding visfatin and adiponectin is consistent between microarray and RT-qPCR. However, the data concerning leptin, resistin and apelin from RT-qPCR cannot verify the results from the GSE6344 microarray dataset. This may be attributed to the small sample size of the GSE6344 microarray. Furthermore, it was demonstrated in another study that the expression level of leptin varies in different ethnicities (31), which may lead to the contradictory results.

In conclusion, such findings suggest that visfatin and resistin are high-risk factors for the development of CC-RCC. By contrast, leptin and adiponectin are inversely associated with CC-RCC risk. The present study may provide novel information concerning the role of adipokines in CC-RCC risk. Due to the relatively small number of patients and contradictory results from microarray data, further studies are required to investigate the etiological significance of adipokine levels in CC-RCC risk.

Acknowledgements

The study was funded by a grant from the Wuxi Hospital Management Center (no. YGZ1102).

References

1 

Fujioka T and Obara W: Committee for Establishment of the Clinical Practice Guideline for the Management of Renal Cell Carcinoma and the Japanese Urological Association: Evidence-based clinical practice guideline for renal cell carcinoma: The Japanese Urological Association 2011 update. Int J Urol. 19:496–503. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Kovacs G, Akhtar M, Beckwith BJ, Bugert P, Cooper CS, Delahunt B, Eble JN, Fleming S, Ljungberg B, Medeiros LJ, et al: The Heidelberg classification of renal cell tumours. J Pathol. 183:131–133. 1997. View Article : Google Scholar : PubMed/NCBI

3 

Shenoy N and Pagliaro L: Sequential pathogenesis of metastatic VHL mutant clear cell renal cell carcinoma: Putting it together with a translational perspective. Ann Oncol. 27:1685–1695. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Razafinjatovo C, Bihr S, Mischo A, Vogl U, Schmidinger M, Moch H and Schraml P: Characterization of VHL missense mutations in sporadic clear cell renal cell carcinoma: Hotspots, affected binding domains, functional impact on pVHL and therapeutic relevance. BMC Cancer. 16:6382016. View Article : Google Scholar : PubMed/NCBI

5 

Arjumand W and Sultana S: Role of VHL gene mutation in human renal cell carcinoma. Tumour Biol. 33:9–16. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Adams KF, Leitzmann MF, Albanes D, Kipnis V, Moore SC, Schatzkin A and Chow WH: Body size and renal cell cancer incidence in a large US cohort study. Am J Epidemiol. 168:268–277. 2008.PubMed/NCBI

7 

Luo J, Margolis KL, Adami HO, Lopez AM, Lessin L and Ye W: Women's Health Initiative Investigators: Body size, weight cycling, and risk of renal cell carcinoma among postmenopausal women: The Women's Health Initiative (United States). Am J Epidemiol. 166:752–759. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Lipworth L, Tarone RE, Lund L and McLaughlin JK: Epidemiologic characteristics and risk factors for renal cell cancer. Clin Epidemiol. 1:33–43. 2009.PubMed/NCBI

9 

Calle EE and Kaaks R: Overweight, obesity and cancer: Epidemiological evidence and proposed mechanisms. Nat Rev Cancer. 4:579–591. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Fischer-Posovszky P, Wabitsch M and Hochberg Z: Endocrinology of adipose tissue - an update. Horm Metab Res. 39:314–321. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Raucci R, Rusolo F, Sharma A, Colonna G, Castello G and Costantini S: Functional and structural features of adipokine family. Cytokine. 61:1–14. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Balistreri CR, Caruso C and Candore G: The role of adipose tissue and adipokines in obesity-related inflammatory diseases. Mediators Inflamm. 2010:8020782010. View Article : Google Scholar : PubMed/NCBI

13 

Riondino S, Roselli M, Palmirotta R, Della-Morte D, Ferroni P and Guadagni F: Obesity and colorectal cancer: Role of adipokines in tumor initiation and progression. World J Gastroenterol. 20:5177–5190. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Ye J, Jia J, Dong S, Zhang C, Yu S, Li L, Mao C, Wang D, Chen J and Yuan G: Circulating adiponectin levels and the risk of breast cancer: A meta-analysis. Eur J Cancer Prev. 23:158–165. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Song CH, Liao J, Deng ZH, Zhang JY, Xue H, Li YM, Liang C, Han M, Zhang K and Yan GT: Is leptin a predictive factor in patients with lung cancer? Clin Biochem. 47:230–232. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Tun HW, Marlow LA, von Roemeling CA, Cooper SJ, Kreinest P, Wu K, Luxon BA, Sinha M, Anastasiadis PZ and Copland JA: Pathway signature and cellular differentiation in clear cell renal cell carcinoma. PLoS One. 5:e106962010. View Article : Google Scholar : PubMed/NCBI

17 

Lenburg ME, Liou LS, Gerry NP, Frampton GM, Cohen HT and Christman MF: Previously unidentified changes in renal cell carcinoma gene expression identified by parametric analysis of microarray data. BMC Cancer. 3:312003. View Article : Google Scholar : PubMed/NCBI

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Gati A, Kouidhi S, Marrakchi R, El Gaaied A, Kourda N, Derouiche A, Chebil M, Caignard A and Perier A: Obesity and renal cancer: Role of adipokines in the tumor-immune system conflict. OncoImmunology. 3:e278102014. View Article : Google Scholar : PubMed/NCBI

20 

Gulen ST, Karadag F, Karul AB, Kilicarslan N, Ceylan E, Kuman NK and Cildag O: Adipokines and systemic inflammation in weight-losing lung cancer patients. Lung. 190:327–332. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Ntikoudi E, Kiagia M, Boura Pand and Syrigos KN: Hormones of adipose tissue and their biologic role in lung cancer. Cancer Treat Rev. 40:22–30. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Gonullu G, Kahraman H, Bedir A, Bektas A and Yücel I: Association between adiponectin, resistin, insulin resistance, and colorectal tumors. Int J Colorectal Dis. 25:205–212. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Spyridopoulos TN, Petridou ET, Dessypris N, Terzidis A, Skalkidou A, Deliveliotis C and Chrousos GP: Obesity and Cancer Oncology Group: Inverse association of leptin levels with renal cell carcinoma: Results from a case-control study. Hormones (Athens). 8:39–46. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Liao LM, Weinstein SJ, Pollak M, Li Z, Virtamo J, Albanes D, Chow WH and Purdue MP: Prediagnostic circulating adipokine concentrations and risk of renal cell carcinoma in male smokers. Carcinogenesis. 34:109–112. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Shimizu H and Mori M: Role of leptin and its receptor in the regulation of appetite and body fat. Nihon Rinsho. 59:421–426. 2001.(In Japanese). PubMed/NCBI

26 

Yuan HJ, Sun KW and Yu K: Leptin promotes the proliferation and migration of human breast cancer through the extracellular-signal regulated kinase pathway. Mol Med Rep. 9:350–354. 2014.PubMed/NCBI

27 

Zhou W, Guo S and Gonzalez-Perez RR: Leptin pro-angiogenic signature in breast cancer is linked to IL-1 signalling. Br J Cancer. 104:128–137. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Chen C, Chang YC, Lan MS and Breslin M: Leptin stimulates ovarian cancer cell growth and inhibits apoptosis by increasing cyclin D1 and Mcl-1 expression via the activation of the MEK/ERK1/2 and PI3K/Akt signaling pathways. Int J Oncol. 42:1113–1119. 2013.PubMed/NCBI

29 

Mohammadzadeh G, Ghaffari MA, Bafandeh A and Hosseini SM: Association of serum soluble leptin receptor and leptin levels with breast cancer. J Res Med Sci. 19:433–438. 2014.PubMed/NCBI

30 

Horiguchi A, Sumitomo M, Asakuma J, Asano T, Zheng R, Asano T, Nanus DM and Hayakawa M: Increased serum leptin levels and over expression of leptin receptors are associated with the invasion and progression of renal cell carcinoma. J Urol. 176:1631–1635. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Liao LM, Schwartz K, Pollak M, Graubard BI, Li Z, Ruterbusch J, Rothman N, Davis F, Wacholder S, Colt J, et al: Serum leptin and adiponectin levels and risk of renal cell carcinoma. Obesity (Silver Spring). 21:1478–1485. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Stastny J, Bienertova-Vasku J and Vasku A: Visfatin and its role in obesity development. Diabetes Metab Syndr. 6:120–124. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Bi TQ and Che XM: Nampt/PBEF/visfatin and cancer. Cancer Biol Ther. 10:119–125. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Li Y, Li X, Liu KR, Zhang JN, Liu Y and Zhu Y: Visfatin derived from ascites promotes ovarian cancer cell migration through Rho/ROCK signaling-mediated actin polymerization. Eur J Cancer Prev. 24:231–239. 2014. View Article : Google Scholar

35 

Li XY, Tang SH, Zhou XC, Ye YH, Xu XQ and Li RZ: Preoperative serum visfatin levels and prognosis of breast cancer among Chinese women. Peptides. 51:86–90. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Nakajima TE, Yamada Y, Hamano T, Furuta K, Matsuda T, Fujita S, Kato K, Hamaguchi T and Shimada Y: Adipocytokines as new promising markers of colorectal tumors: Adiponectin for colorectal adenoma, and resistin and visfatin for colorectal cancer. Cancer Sci. 101:1286–1291. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Lu GW, Wang QJ, Xia MM and Qian J: Elevated plasma visfatin levels correlate with poor prognosis of gastric cancer patients. Peptides. 58:60–64. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Sorli SC, Le Gonidec S, Knibiehler B and Audigier Y: Apelin is a potent activator of tumour neoangiogenesis. Oncogene. 26:7692–7699. 2007. View Article : Google Scholar : PubMed/NCBI

39 

Yang L, Su T, Lv D, Xie F, Liu W, Cao J, Sheikh IA, Qin X, Li L and Chen L: ERK1/2 mediates lung adenocarcinoma cell proliferation and autophagy induced by apelin-13. Acta Biochim Biophys Sin (Shanghai). 46:100–111. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Heo K, Kim YH, Sung HJ, Li HY, Yoo CW, Kim JY, Park JY, Lee UL, Nam BH, Kim EO, et al: Hypoxia-induced up-regulation of apelin is associated with a poor prognosis in oral squamous cell carcinoma patients. Oral Oncol. 48:500–506. 2012. View Article : Google Scholar : PubMed/NCBI

41 

Diakowska D, Markocka-Mączka K, Szelachowski P and Grabowski K: Serum levels of resistin, adiponectin, and apelin in gastroesophageal cancer patients. Disease Markers. 2014:6196492014. View Article : Google Scholar : PubMed/NCBI

42 

Curat CA, Wegner V, Sengenès C, Miranville A, Tonus C, Busse R and Bouloumié A: Macrophages in human visceral adipose tissue: Increased accumulation in obesity and a source of resistin and visfatin. Diabetologia. 49:744–747. 2006. View Article : Google Scholar : PubMed/NCBI

43 

Hivert MF, Sullivan LM, Fox CS, Nathan DM, D'Agostino RB Sr, Wilson PW and Meigs JB: Associations of adiponectin, resistin, and tumor necrosis factor-alpha with insulin resistance. J Clin Endocrinol Metab. 93:3165–3172. 2008. View Article : Google Scholar : PubMed/NCBI

44 

Dalamaga M, Sotiropoulos G, Karmaniolas K, Pelekanos N, Papadavid E and Lekka A: Serum resistin: A biomarker of breast cancer in postmenopausal women? Association with clinicopathological characteristics, tumor markers, inflammatory and metabolic parameters. Clin Biochem. 46:584–590. 2013. View Article : Google Scholar : PubMed/NCBI

45 

Yildiz Y, Ozaksit G, Unlu B Serdar, Ozgu E, Energin H, Kaba M and Ugur M: Serum adiponectin level and clinical, metabolic, and hormonal markers in patients with polycystic ovary syndrome. Int J Fertil Steril. 7:331–336. 2014.PubMed/NCBI

46 

Hebbard L and Ranscht B: Multifaceted roles of adiponectin in cancer. Best Pract Res Clin Endocrinol Metab. 28:59–69. 2014. View Article : Google Scholar : PubMed/NCBI

47 

Spyridopoulos TN, Petridou ET, Skalkidou A, Dessypris N, Chrousos GP and Mantzoros CS: Obesity and Cancer Oncology Group: Low adiponectin levels are associated with renal cell carcinoma: A case-control study. Int J Cancer. 120:1573–1578. 2007. View Article : Google Scholar : PubMed/NCBI

48 

Gulcelik MA, Colakoglu K, Dincer H, Dogan L, Yenidogan E and Gulcelik NE: Associations between adiponectin and two different cancers: Breast and colon. Asian Pac J Cancer Prev. 13:395–398. 2012. View Article : Google Scholar : PubMed/NCBI

49 

Dalamaga M, Diakopoulos KN and Mantzoros CS: The role of adiponectin in cancer: A review of current evidence. Endocr Rev. 33:547–594. 2012. View Article : Google Scholar : PubMed/NCBI

50 

Izadi V, Farabad E and Azadbakht L: Serum adiponectin level and different kinds of cancer: A review of recent evidence. ISRN Oncol. 2012:9827692012.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang HP, Zou J, Xu ZQ, Ruan J, Yang SD, Yin Y and Mu HJ: Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma. Oncol Lett 13: 463-468, 2017.
APA
Zhang, H., Zou, J., Xu, Z., Ruan, J., Yang, S., Yin, Y., & Mu, H. (2017). Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma. Oncology Letters, 13, 463-468. https://doi.org/10.3892/ol.2016.5408
MLA
Zhang, H., Zou, J., Xu, Z., Ruan, J., Yang, S., Yin, Y., Mu, H."Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma". Oncology Letters 13.1 (2017): 463-468.
Chicago
Zhang, H., Zou, J., Xu, Z., Ruan, J., Yang, S., Yin, Y., Mu, H."Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma". Oncology Letters 13, no. 1 (2017): 463-468. https://doi.org/10.3892/ol.2016.5408
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang HP, Zou J, Xu ZQ, Ruan J, Yang SD, Yin Y and Mu HJ: Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma. Oncol Lett 13: 463-468, 2017.
APA
Zhang, H., Zou, J., Xu, Z., Ruan, J., Yang, S., Yin, Y., & Mu, H. (2017). Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma. Oncology Letters, 13, 463-468. https://doi.org/10.3892/ol.2016.5408
MLA
Zhang, H., Zou, J., Xu, Z., Ruan, J., Yang, S., Yin, Y., Mu, H."Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma". Oncology Letters 13.1 (2017): 463-468.
Chicago
Zhang, H., Zou, J., Xu, Z., Ruan, J., Yang, S., Yin, Y., Mu, H."Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma". Oncology Letters 13, no. 1 (2017): 463-468. https://doi.org/10.3892/ol.2016.5408
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team