Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
March-2017 Volume 13 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2017 Volume 13 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Promoter methylation and expression of Raf kinase inhibitory protein in esophageal squamous cell carcinoma

  • Authors:
    • Hong Wei
    • Zhijun Liu
    • Hongyan She
    • Baoguo Liu
    • Junxia Gu
    • Dongmin Wei
    • Xiangyang Zhang
    • Jiufeng Wang
    • Shujing Qi
    • Fumin Ping
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, The Affiliated Hospital of Hebei University of Engineering, Handan, Hebei 056000, P.R. China
  • Pages: 1866-1872
    |
    Published online on: January 18, 2017
       https://doi.org/10.3892/ol.2017.5617
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Raf kinase inhibitory protein (RKIP) regulates multiple cellular processes, and its downregulation is associated with distinct human cancers. In the present study, the status of RKIP promoter methylation, as well as its expression and clinical significance in esophageal squamous cell carcinoma (ESCC), were examined. The promoter methylation status in the 5'‑CpG island of the RKIP gene and the expression level of the RKIP protein were examined using a modified methylation‑specific polymerase chain reaction (MSP) method and immunohistochemical staining, respectively, in 77 ESCC samples and matched paratumor normal tissues. The incidence of RKIP promoter methylation was significantly higher in tumor samples (75.3%) than in the matched normal tissues (27.3%; P<0.001). A higher incidence of promoter methylation was also detected in poorly differentiated cancers (93.5%) compared with well‑differentiated cancers (50.0%; P<0.001), as well as in tumor samples with positive lymph node metastasis (86.7%) compared with those with negative lymph node metastasis (59.4%; P<0.001). Consistent with the promoter methylation status, the expression level of RKIP was significantly reduced in cancer tissues (36.4%) compared with matched normal tissues (76.6%; P<0.01), as well as in cancers with positive lymph node metastasis (24.4%) compared with those with negative lymph node metastasis (53.1%; P=0.01). Promoter methylation‑induced gene silencing significantly correlated with the down regulation of RKIP and the development of ESCC. The results of the present study suggested that the methylation status of the RKIP promoter, when combined with its expression level, may serve as a biomarker for predicting the biological behaviors of ESCC.

Introduction

Esophageal cancer is among the most prevalent cancers in China, ranking sixth in terms of incidence and fourth in terms of mortality, according to the 2011 Annual Report on the Status of Cancer in China (1). The highest morbidity rate of esophageal cancer in China reached 130 per 100,000 people in 2003 (2). Esophageal cancer can be further divided into two main pathological subtypes: Esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma (EAC), with the former being the predominant type and accounting for ~90% of esophageal cancer cases worldwide (3). Even though there have been significant advances in therapeutic approaches for ESCC, the prognosis of ESCC remains poor (the 5-year survival rate is <10%) (4). Therefore, it is essential to explore the pathogenesis of ESCC and to identify novel biomarkers for risk assessment, early detection and prognosis prediction.

Many genetic and epigenetic alterations have been implicated in the pathogenesis of ESCC. Among these alterations, DNA methylation-induced gene silencing of tumor suppressor genes plays significant roles in ESCC initiation, progression and metastasis; thus serving as important ESCC biomarkers (5). Although expression analysis alone is frequently used as the main approach to identify cancer biomarkers, Cheng et al recently proposed that integrating expression and epigenetic alteration analyses would provide a higher likelihood of identifying ESCC biomarkers (6).

Raf kinase inhibitory protein (RKIP) is a highly conserved, ubiquitously expressed and small cytoplasmic protein with various biological and pathological activities (7). RKIP inhibits Raf-1-mediated phosphorylation and activation of mitogen-activated protein kinase (MAPK) kinase (MEK)-1, as well as the subsequent MAPK and extracellular signal-regulated kinase activities (8). RKIP also negatively regulates nuclear factor (NF)-κB signaling and the signaling downstream of G protein-coupled receptor kinase (9,10). During cancer development, RKIP is characterized as a tumor suppressor gene because of its maintenance of chromosome stability, inhibition of cellular proliferation, promotion of cell differentiation and dynamic balancing of oncogene activities (11). Consistently, previous studies have reported RKIP absence or downregulation and its clinical significance in a variety of human cancers, such as prostate, breast and gastric cancers (12–14). These observations led to intensive studies on the mechanisms and functions of RKIP in cancers; however, few previous studies have analyzed the RKIP methylation and expression status in ESCC. Using immunohistochemical analysis, Kim et al demonstrated that 71.4% of ESCC metastatic lymph nodes, 50.0% of primary ESCC and 28.9% of carcinoma in situ showed the loss of RKIP expression, suggesting that RKIP plays an inhibitory role in the invasion and metastasis of ESCC (15). In addition, Gao et al reported that positive expression of RKIP in ESCC occurred significantly less often than in paratumor normal tissues, and that reduced RKIP expression was significantly correlated with a higher risk of recurrence, implying its importance in prognosis prediction (16). Furthermore, the expression level of RKIP was decreased in the order of dysplastic Barrett's mucosa, low-grade dysplasia, high-grade dysplasia and EAC, suggesting its involvement in esophageal carcinogenesis (17).

Although these studies all support the significance of RKIP in ESCC, minimal information is known regarding the mechanisms leading to RKIP silencing in ESCC. Considering that promoter hypermethylation is an important mechanism for gene silencing, and that it plays an important role in downregulating RKIP in gastric carcinoma (18,19), the authors of the present study hypothesized that promoter methylation may be a potential mechanism for downregulating RKIP in ESCC and is thus responsible for the biological behaviors of ESCC. To test this hypothesis, the RKIP promoter methylation status and its expression level in ESCC tissues and matched paratumor normal tissues were examined using methylation-specific polymerase chain reaction (MSP) and immunohistochemical staining, respectively. Furthermore, their correlations with distinct clinicopathological features of the patients were analyzed.

Materials and methods

Patients and tissue samples

The present study was approved by the Ethics Committee of Hebei Medical University (Shijiazhuang, China), where all data were collected, and written informed consent was obtained from all participants. A total of 77 patients (59 males and 18 females; mean age of 61.8±8.7 years) who underwent radical surgery of ESCC in the Fourth Hospital of Hebei Medical University between December 2008 and December 2010 were recruited to this study. No patients received pre-operative chemotherapy or radiotherapy. Among these patients, 29 were aged <60 years, while 49 were aged >60 years. According to the tumor, lymph node, metastasis (TNM) staging criteria from the Union for International Cancer Control and the American Joint Committee on Cancer (20), 33 cases were of stage I or II and 44 cases were of stage III or IV. According to the pathological grading system (21), 20 ESCC cases were well-differentiated, 26 were moderately-differentiated, and 31 were poorly-differentiated cancers. Among these ESCC cases, 45 showed positive lymph node metastasis, while 32 showed negative lymph node metastasis. The clinicopathological characteristics of the patients are summarized in Table I.

Table I.

Clinicopathological characteristics of esophageal squamous cell carcinoma cases in this study.

Table I.

Clinicopathological characteristics of esophageal squamous cell carcinoma cases in this study.

Characteristicn%
Gender
  Male5976.62
  Female1823.38
TNM stage
  I + II3342.86
  III+ IV4457.14
Pathological differentiation
  Well2025.97
  Moderate2633.77
  Poor3140.26
Age (years)
  <602937.66
  ≥604862.34
Lymph node metastasis
  Negative3242.86
  Positive4557.14

[i] TNM, tumor-node-metastasis.

During surgery, the cancer tissues and the matched normal tissues were obtained from the primary tumors and at least 5-cm away from the tumor, respectively. All tissues were immediately stored at −80°C, with some subsequently used for DNA extraction and some fixed in 10% formalin and embedded in paraffin for immunohistochemical staining. All matched normal tissues were confirmed by pathological examination to contain no invaded tumor cells.

Modified MSP method

Tissue samples were treated with proteinase K, and genomic DNA was extracted using phenol/chloroform. Using the TU-1800 PC UV-VIS spectrophotometer (Beijing, China) to measure the absorbance ratio at 260/280 nm, the total DNA purity was determined to be between 1.8 and 2.0. Bisulfite modification of 10 µg genomic DNA from each sample was performed as described previously (22). Briefly, genomic DNA was denatured using 2 M NaOH and then incubated with 10 M hydroquinone (Merck Millipore, Darmstadt, Germany) and 3 M sodium bisulfite at 50°C for 16 h. Modified DNA was purified using the Wizard DNA purification resin (Promega Corporation, Madison, WI, USA), according to the manufacturer's protocol. The MSP was performed using primers (Table II) under the following conditions: Predenaturation at 95°C for 12 min; 36 cycles at 95°C for 60 sec, 52°C for 45 sec and 72°C for 60 sec; and a final extension at 72°C for 10 min. The polymerase chain reaction (PCR) products were subsequently separated on 2% agarose gels by electrophoresis and analyzed using an ultraviolet light gel imaging system (FOTODYNE Incorporated, Hartland, WI, USA). The peripheral blood from a healthy individual without any diseases or tumors in the alimentary system was taken to isolate genomic DNA, which, following methylation treatment using DNA methyltransferase (Sss I; Beijing Solarbio Science & Technology, Co., Ltd., Beijing, China) was used as a positive control; that without Sss I treatment was used as a negative control. A water blank was also used as a negative control. The tissue samples showing positive PCR products only with methylated primers (full methylation) or with both methylated and unmethylated primers (semi-methylation) were defined as methylated samples (23).

Table II.

Sequences, Tm and amplicon sizes of primers used for RKIP methylation-specific PCR.

Table II.

Sequences, Tm and amplicon sizes of primers used for RKIP methylation-specific PCR.

Primer sequences, 5′-3′Tm, °CPCR product size, bp
MF TTTAGCGATATTTTTTGAGATACGA52.5205
R GCTCCCTAACCTCTAATTAACCG
UF TTTAGTGATATTTTTTGAGATATGA52.5205
R CACTCCCTAACCTCTAATTAACCAA

[i] M, methylated RKIP; U, unmethylated RKIP; Tm, melting temperature; F, forward; R, reverse; RKIP, Raf kinase inhibitory protein.

Immunohistochemical staining

Immunohistochemical staining for RKIP was performed on 4-µm formalin-fixed, paraffin-embedded tissue sections using the Immunohistochemical Streptavidin-Peroxidase kit (ZSGB-BIO, Beijing, China), according to the manufacturer's protocol. Briefly, the tissue sections were dewaxed, dehydrated and treated with 3% hydrogen peroxidase to block endogenous peroxidase activity. Following antigen retrieval in EDTA solution (pH 8.5) in a pressure cooker for 3 min, the sections were blocked with 10% normal goat serum at 37°C for 40 min, followed by incubation with the primary rabbit anti-human RKIP antibody (catalog no., bs-1436R; dilution, 1:500; Bioss, Beijing, China) and then horseradish peroxidase-labeled streptavidin. Final color development was achieved using a 3,3′-diaminobenzidine solution, and the slides were counterstained with 1% Meyer's hematoxylin. The use of phosphate-buffered saline instead of the primary antibody served as a negative control.

Positive RKIP staining appeared as yellowish to brownish granules in the cytoplasm. The staining was scored and averaged by three independent clinical pathologists according to a scoring system modified from that proposed by Fromowitz et al (24). Briefly, five random fields were imaged from each slide under a BX41 light microscope (Olympus, Tokyo, Japan). A score was assigned based on the percentage of positive tumor cells averaged from all five fields: Score 0, ≤25%; score 1, 26–50%; score 2, 51–75%; and score 3, >75%. In addition, the staining was graded based on the intensity of the majority of the positively stained cells: 0, no staining; 1, weak yellowish staining; 2, moderate brownish staining; and 3, dark brownish staining. The final score was obtained by adding the percentage score and intensity grade, and stratified as: ‘-’=0; ‘+’=1–2; ‘++’=3–4; and ‘+++’=5–6, where ‘-’ and ‘+’ were classified as negative expression, while ‘++’ and ‘+++’ were classified as positive expression.

Statistical analysis

All statistical analyses were performed using SPSS software version 13.0 (SPSS, Inc., Chicago, IL, USA). Quantitative data are presented as a percentage or ratio of the total sample. The association between groups was assessed using the χ2 test. P<0.05 was considered to indicate a statistically significant difference.

Results

RKIP promoter methylation and protein expression in ESCC and paratumor normal tissues

To examine the status of RKIP promoter methylation in ESCC, MSP analysis on 77 ESCC tumor tissues and matched paratumor normal tissues was performed (Fig. 1). The incidence of RKIP promoter methylation in ESCC tissues was 75.3%, which was significantly higher compared with the matched normal tissues (27.3%; P<0.001; Table III). Given that methylation-induced gene silencing is an important mechanism for downregulating many tumor suppressor genes during cancer development (25,26), the expression level of RKIP in ESCC and normal tissues was also profiled by immunohistochemistry (Fig. 2). The incidence of positive RKIP expression in the ESCC tissues was 36.4%, which was significantly reduced compared with the matched normal tissues (76.6%; P<0.001; Table III).

Figure 1.

MSP analysis of RKIP promoter methylation in three representative ESCC tissues (T) and the matched paratumor normal tissues (N). The letters m and u indicate that the primers for methylated and unmethylated RKIP were used, respectively. RKIP, Raf kinase inhibitory protein.

Figure 2.

Immunohistochemical staining of Raf kinase inhibitory protein (brown signals) in (A) a representative ESCC tissue and (B) the matched paratumor normal tissue (magnification, ×200).

Table III.

Methylation status and protein expression of RKIP in 77 ESCC tissues and the matched paratumor normal tissues.

Table III.

Methylation status and protein expression of RKIP in 77 ESCC tissues and the matched paratumor normal tissues.

RKIP promoter methylationRKIP protein expression


TissuesMethylationNo methylationPositiveNegative
ESCC (n=77)58 (75.32%)19 (24.67%)28 (36.36%)49 (63.64%)
Normal (n=77)21 (27.27%)54 (72.73%)59 (76.62%)18 (23.38%)
χ235.58225.389
P-valueP<0.001P<0.001

[i] RKIP, Raf kinase inhibitory protein; ESCC, esophageal squamous cell carcinoma.

Correlation between RKIP promoter methylation and the clinicopathological characteristics of ESCC

The correlation between RKIP promoter methylation in ESCC and various clinicopathological characteristics is shown in Table IV. The incidence of RKIP promoter methylation was not significantly correlated with the age (P=0.528), gender (P=1.000) or TNM stage (P=0.321), although it was significantly correlated with the differentiation status of the tumor (50.0% in well-differentiated tumors, 73.1% in moderately-differentiated tumors and 93.5% in poorly differentiated tumors; P=0.002), as well as the lymph node status (86.7 and 59.4% in ESCC patients with and without positive lymph node metastasis, respectively; P=0.006).

Table IV.

Correlation between RKIP promoter methylation and the clinicopathological characteristics.

Table IV.

Correlation between RKIP promoter methylation and the clinicopathological characteristics.

RKIP promoter methylation

CharacteristicnMUχ2P-value
Age (years) 0.528
  <602923  60.398
  ≥60483513
Gender 1.000
  Male5944150.076
  Female1814  4
Clinical stage 0.321
  I+II3323100.984
  III+IV4435  9
Degree of differentiation 0.002
  Well20101012.511
  Moderate2619  7
  Poor3129  2
Lymph node metastasis 0.006
  Negative3219137.494
  Positive4539  6

[i] M, methylated RKIP; U, unmethylated RKIP; RKIP, Raf kinase inhibitory protein.

Correlation between RKIP protein expression and the clinicopathological characteristics of ESCC

The analysis of the correlation between the incidence of RKIP protein expression in ESCC and various clinicopathological characteristics showed that the expression of RKIP in the tumor tissues was only significantly correlated with lymph node metastasis (24.4 and 53.1% in ESCC patients with and without positive lymph node metastasis, respectively; P=0.01); it was not significantly associated with age (P=0.540), gender (P=0.760), TNM stage (P=0.056) or the differentiation status of the tumor (P=0.282; Table V).

Table V.

Correlation between RKIP protein expression and clinicopathological characteristics.

Table V.

Correlation between RKIP protein expression and clinicopathological characteristics.

RKIP protein expression

CharacteristicnPositiveNegativeχ2P-value
Age, years 0.5710.450
  <6029  920
  ≥60481929
Gender 0.0930.760
  Male592237
  Female18  612
Clinical stage 3.6670.056
  I + II331617
  III + IV441232
Degree of differentiation 2.5350.282
  Well20  911
  Moderate261115
  Poor31  823
Lymph node metastasis 6.6480.010
  Negative321715
  Positive451134

[i] RKIP, Raf kinase inhibitory protein.

Association between RKIP promoter methylation and protein expression

Among the 58 ESCC tissues positive for RKIP promoter methylation, 29.3% were positive for RKIP protein expression. Of the 19 ESCC tissues negative for RKIP promoter methylation, 57.9% were positive for RKIP protein expression. There was a significant negative association between RKIP promoter methylation and protein expression (P=0.001; Table VI).

Table VI.

Association between RKIP promoter methylation and protein expression in esophageal squamous cell carcinoma tissues.

Table VI.

Association between RKIP promoter methylation and protein expression in esophageal squamous cell carcinoma tissues.

RKIP protein expression

RKIP methylation status+–Totalχ2P-value
Methylated17415817.3080.001
Unmethylated11  819
Total284977

[i] RKIP, Raf kinase inhibitory protein.

Discussion

The present study examined the status of RKIP promoter methylation and its expression in ESCC and matched paratumor normal tissues, and demonstrated that RKIP promoter methylation was significantly enhanced, while its protein expression level was significantly reduced, in the tumor tissues compared with the normal tissues. Functionally, RKIP promoter methylation was significantly correlated with the status of tumor differentiation and lymph node metastasis, while RKIP protein expression was associated with lymph node metastasis only. Consistent with these observations, RKIP promoter methylation was negatively associated with its protein expression in ESCC tissues.

Tumorigenesis is a complicated process involving numerous factors, multiple steps and genetic as well as epigenetic alterations in various genes. The pathogenesis of ESCC has been mainly attributed to environmental factors, including malnutrition, smoking, alcohol use and inflammation (27–29). However, recent studies have revealed that genetic and epigenetic alterations also play significant roles in the development of multiple cancers, including ESCC (30–32). Among various epigenetic alterations, aberrant DNA methylation (including hypomethylation of oncogenes and hypermethylation of tumor suppressor genes) is the best characterized and most crucial mechanism modulating chromatin structure and the expression levels of oncogenes or tumor suppressor genes, contributing to tumor initiation and further development (33). Hypermethylation of the CpG islands within the promoter regions of tumor suppressor genes is a well-demonstrated molecular mechanism for transcriptional silencing and subsequent tumor progression (34). The presence of promoter CpG island hypermethylation in preneoplastic lesions of malignant cancers supports its significance in neoplastic transformation and tumor initiation (35–38).

Many studies have corroborated the nature of RKIP as a tumor suppressor gene. Li et al reported that promoter hypermethylation of the RKIP gene led to its silencing in colorectal cancer, which may underlie tumor metastasis (39). Al-Mulla et al demonstrated that chromosome loss in colorectal cancer was inversely proportional to RKIP expression levels, the silencing of which was mainly caused by methylation of the RKIP promoter (40). Consistently, other studies have supported the importance of RKIP promoter hypermethylation in the loss of its activity (41,42). In contrast, few studies have investigated the status or clinical significance of RKIP promoter methylation in ESCC. To address this issue, the present study compared promoter methylation of the RKIP gene in ESCC tissues and the matched normal tissues of 77 patients with ESCC, and showed that RKIP promoter hypermethylation was significantly enhanced in the tumor tissues compared with the normal tissues, supporting its potential involvement in tumor initiation. Furthermore, RKIP promoter hypermethylation was significantly correlated with tumor differentiation and lymph node metastasis, suggesting its value in predicting ESCC metastasis and prognosis.

In the paratumor normal tissues, 27.3% were positive for RKIP promoter methylation, and all these cases were semi-methylated (data not shown). One potential explanation for this was that we used the highly sensitive nested MSP for this study, which is capable of detecting alleles comprising <5% of the total genomic DNA (43). Therefore, minor invasion of the tumor tissue into the normal tissue (although negative in the pathological examinations) may have led to semi-methylation. Among the 58 ESCC samples positive for RKIP promoter methylation, 3 were semi-methylated (data not shown), which may be related to the degree of transcriptional silencing of RKIP; that is, an incomplete methylation corresponds to incomplete gene silencing (44).

In addition to promoter methylation, reduced or loss of RKIP expression has been associated with cancer development. Immunohistochemical analysis has demonstrated that the loss of RKIP expression is a key phenotype for many human cancers, including colorectal cancer, breast cancer, melanoma, prostate cancer and hepatocellular carcinoma, modulating distant metastasis, lymphatic metastasis, vascular infiltration and cancer mortality (45–49). Consistent with these studies, the present study showed that the incidence of positive RKIP expression in ESCC tissues was significantly less compared with the matched normal tissues, and that it was clinically correlated with lymph node metastasis. A further association analysis revealed that promoter methylation-induced RKIP silencing may be a major mechanism for downregulating RKIP and subsequent ESCC development.

The potential involvement of RKIP as a tumor suppressor gene in tumor invasiveness and metastasis has been well demonstrated in multiple cancers. Keller et al reported that RKIP expression was at its highest in normal prostate tissues, decreased in primary prostate cancers and was not detectable in metastatic tissues from prostate cancer (50). In addition, Schuierer et al demonstrated that RKIP expression was decreased concomitantly with the metastasis of melanoma (47). Mechanistic studies have suggested that RKIP is a metastasis suppressor gene that is responsible for blocking several signaling pathways in the metastatic cascade, including MEK, G proteins and NF-κB (51). Similarly, the present study showed that the percentage of RKIP expression in ESCC tumors with lymph node metastasis was significantly less compared with tumors without lymph node metastasis.

In summary, this study showed that promoter methylation may be responsible for RKIP downregulation and the oncogenesis of ESCC. Therefore, the incidence of RKIP promoter methylation may serve as a biomarker for the differentiation status and prognosis of ESCC. This study extends the molecular understanding of the pathogenesis of ESCC and provides a novel target for the early diagnosis and treatment of ESCC.

Acknowledgements

This study was supported by the Research Project of Science and Technology of Handan (grant no. 1123108079-4).

References

1 

Chen W, Zheng R, Zeng H, Zhang S and He J: Annual report on status of cancer in China, 2011. Chin J Cancer Res. 27:2–12. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Li H: Modern esophageal surgery. People's Military Medical Press; Beijing: pp. 331–332. 2004

3 

Esophageal cancer, . Epidemiology, pathogenesis and prevention. Nat Clin Pract Gastroenterol Hepatol. 5:517–526. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Holmes RS and Vaughan TL: Epidemiology and pathogenesis of esophageal cancer. Semin Radiat Oncol. 17:2–9. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Li JS, Ying JM, Wang XW, Wang ZH, Tao Q and Li LL: Promoter methylation of tumor suppressor genes in esophageal squamous cell carcinoma. Chin J Cancer. 32:3–11. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Cheng CP, Kuo IY, Alakus H, Frazer KA, Harismendy O, Wang YC and Tseng VS: Network-based analysis identifies epigenetic biomarkers of esophageal squamous cell carcinoma progression. Bioinformatics. 30:3054–3061. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Bernier I and Jollés P: Purification and characterization of a basic 23 kDa cytosolic protein from bovine brain. Biochim Biophys Acta. 790:174–181. 1984. View Article : Google Scholar : PubMed/NCBI

8 

Yeung K, Seitz T, Li S, Janosch P, McFerran B, Kaiser C, Fee F, Katsanakis KD, Rose DW, Mischak H, et al: Suppression of Raf-1 kinase activity and MAP kinase signalling by RKIP. Nature. 401:173–177. 1999. View Article : Google Scholar : PubMed/NCBI

9 

Yeung KC, Rose DW, Dhillon AS, Yaros D, Gustafsson M, Chatterjee D, McFerran B, Wyche J, Kolch W and Sedivy JM: Raf kinase inhibitor protein interacts with NF-kappaB-inducing kinase and TAK1 and inhibits NF-kappaB activation. Mol Cell Biol. 21:7207–7217. 2001. View Article : Google Scholar : PubMed/NCBI

10 

Deiss K, Kisker C, Lohse MJ and Lorenz K: Raf kinase inhibitor protein (RKIP) dimer formation controls its target switch from Raf1 to G protein-coupled receptor kinase (GRK) 2. J Biol Chem. 287:23407–23417. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Escara-Wilke J, Yeung K and Keller ET: Raf kinase inhibitor protein (RKIP) in cancer. Cancer Metastasis Rev. 31:615–620. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Fu Z, Smith PC, Zhang L, Rubin MA, Dunn RL, Yao Z and Keller ET: Effects of raf kinase inhibitor protein expression on suppression of prostate cancer metastasis. J Natl Cancer Inst. 95:878–889. 2003. View Article : Google Scholar : PubMed/NCBI

13 

Zhao Z, Lu P, Zhang H, Xu H, Gao N, Li M and Liu C: Nestin positively regulates the Wnt/β-catenin pathway and the proliferation, survival and invasiveness of breast cancer stem cells. Breast Cancer Res. 16:4082014. View Article : Google Scholar : PubMed/NCBI

14 

Liu C, Lu P, Lu Y, Xu H, Wang S and Chen J: Clinical implications of metastatic lymph node ratio in gastric cancer. BMC Cancer. 7:2002007. View Article : Google Scholar : PubMed/NCBI

15 

Kim HS, Won KY, Kim GY, Kim SC, Park YK and Kim YW: Reduced expression of Raf-1 kinase inhibitory protein predicts regional lymph node metastasis and shorter survival in esophageal squamous cell carcinoma. Pathol Res Pract. 208:292–299. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Gao C, Pang L, Ren C and Ma T: Prognostic value of raf kinase inhibitor protein in esophageal squamous cell carcinoma. Pathol Oncol Res. 18:471–477. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Birner P, Jesch B, Schultheis A and Schoppmann SF: RAF-kinase inhibitor protein (RKIP) downregulation in esophageal cancer and its metastases. Clin Exp Metastasis. 29:551–559. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Guo W, Dong Z, Guo Y, Lin X, Chen Z, Kuang G and Yang Z: Aberrant methylation and loss expression of RKIP is associated with tumor progression and poor prognosis in gastric cardia adenocarcinoma. Clin Exp Metastasis. 30:265–275. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Li DX, Cai HY, Wang X, Feng YL and Cai SW: Promoter methylation of Raf kinase inhibitory protein: A significant prognostic indicator for patients with gastric adenocarcinoma. Exp Ther Med. 8:844–850. 2014.PubMed/NCBI

20 

Edge SB and Compton CC: The American Joint Committee on Cancer: The 7th edition of the AJCC cancer staging manual and the future of TNM. Ann Surg Oncol. 17:1471–1474. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Rice TW, Blackstone EH and Rusch VW: 7th edition of the AJCC Cancer Staging Manual: Esophagus and esophagogastric junction. Ann Surg Oncol. 17:1721–1724. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Herman JG, Graff JR, Myöhänen S, Nelkin BD and Baylin SB: Methylation-specific PCR: A novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA. 93:9821–9826. 1996. View Article : Google Scholar : PubMed/NCBI

23 

Glickman JF, Flynn J and Reich NO: Purification and characterization of recombinant baculovirus-expressed mouse DNA methyltransferase. Biochem Biophys Res Commun. 230:280–284. 1997. View Article : Google Scholar : PubMed/NCBI

24 

Fromowitz FB, Viola MV, Chao S, Oravez S, Mishriki Y, Finkel G, Grimson R and Lundy J: ras p21 expression in the progression of breast cancer. Hum Pathol. 18:1268–1275. 1987. View Article : Google Scholar : PubMed/NCBI

25 

Baylin SB: DNA methylation and gene silencing in cancer. Nat Clin Pract Oncol. 2:(Suppl 1). S4–S11. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Kulis M and Esteller M: DNA methylation and cancer. Adv Genet. 70:27–56. 2010.PubMed/NCBI

27 

Yang CS: Vitamin nutrition and gastroesophageal cancer. J Nutr. 130:(Suppl 2S). S338–S339. 2000.

28 

Yokokawa Y, Ohta S, Hou J, Zhang XL, Li SS, Ping YM and Nakajima T: Ecological study on the risks of esophageal cancer in Ci-Xian, China: The importance of nutritional status and the use of well water. Int J Cancer. 83:620–624. 1999. View Article : Google Scholar : PubMed/NCBI

29 

Launoy G, Milan CH, Faivre J, Pienkowski P, Milan CI and Gignoux M: Alcohol, tobacco and oesophageal cancer: Effects of the duration of consumption, mean intake and current and former consumption. Br J Cancer. 75:1389–1396. 1997. View Article : Google Scholar : PubMed/NCBI

30 

Gao YB, Chen ZL, Li JG, Hu XD, Shi XJ, Sun ZM, Zhang F, Zhao ZR, Li ZT, Liu ZY, et al: Genetic landscape of esophageal squamous cell carcinoma. Nat Genet. 46:1097–1102. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Sasaki Y, Tamura M, Koyama R, Nakagaki T, Adachi Y and Tokino T: Genomic characterization of esophageal squamous cell carcinoma: Insights from next-generation sequencing. World J Gastroenterol. 22:2284–2293. 2016.PubMed/NCBI

32 

Kailasam A, Mittal SK and Agrawal DK: Epigenetics in the pathogenesis of esophageal adenocarcinoma. Clin Transl Sci. 8:394–402. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Ma K, Cao B and Guo M: The detective, prognostic, and predictive value of DNA methylation in human esophageal squamous cell carcinoma. Clin Epigenetics. 8:432016. View Article : Google Scholar : PubMed/NCBI

34 

Shames DS, Minna JD and Gazdar AF: DNA methylation in health, disease, and cancer. Curr Mol Med. 7:85–102. 2007. View Article : Google Scholar : PubMed/NCBI

35 

Jones PA, Rideout WM III, Shen JC, Spruck CH and Tsai YC: Methylation, mutation and cancer. Bioessays. 14:33–36. 1992. View Article : Google Scholar : PubMed/NCBI

36 

Pogribny I, Raiche J, Slovack M and Kovalchuk O: Dose-dependence, sex- and tissue-specificity, and persistence of radiation-induced genomic DNA methylation changes. Biochem Biophys Res Commun. 320:1253–1261. 2004. View Article : Google Scholar : PubMed/NCBI

37 

Brooks JD, Weinstein M, Lin X, Sun Y, Pin SS, Bova GS, Epstein JI, Isaacs WB and Nelson WG: CG island methylation changes near the GSTP1 gene in prostatic intraepithelial neoplasia. Cancer Epidemiol Biomarkers Prev. 7:531–536. 1998.PubMed/NCBI

38 

Chan AO and Rashid A: CpG island methylation in precursors of gastrointestinal malignancies. Curr Mol Med. 6:401–408. 2006. View Article : Google Scholar : PubMed/NCBI

39 

Li FF, Song SJ and Zhang RN: Phosphatidylethanolamine-binding protein (PEBP) in basic and clinical study. Sheng Li Ke Xue Jin Zhan. 40:214–218. 2009.(In Chinese). PubMed/NCBI

40 

Al-Mulla F, Hagan S, Al-Ali W, Jacob SP, Behbehani AI, Bitar MS, Dallol A and Kolch W: Raf kinase inhibitor protein: Mechanism of loss of expression and association with genomic instability. J Clin Pathol. 61:524–529. 2008. View Article : Google Scholar : PubMed/NCBI

41 

Eves EM, Shapiro P, Naik K, Klein UR, Trakul N and Rosner MR: Raf kinase inhibitory protein regulates aurora B kinase and the spindle checkpoint. Mol Cell. 23:561–574. 2006. View Article : Google Scholar : PubMed/NCBI

42 

Martinho O, Gouveia A, Silva P, Pimenta A, Reis RM and Lopes JM: Loss of RKIP expression is associated with poor survival in GISTs. Virchows Arch. 455:277–284. 2009. View Article : Google Scholar : PubMed/NCBI

43 

Licchesi JD and Herman JG: Methylation-specific PCR. Methods Mol Biol. 507:305–323. 2009. View Article : Google Scholar : PubMed/NCBI

44 

Bird A: Molecular biology. Methylation talk between histones and DNA. Science. 294:2113–2115. 2001. View Article : Google Scholar : PubMed/NCBI

45 

Minoo P, Zlobec I, Baker K, Tornillo L, Terracciano L, Jass JR and Lugli A: Loss of raf-1 kinase inhibitor protein expression is associated with tumor progression and metastasis in colorectal cancer. Am J Clin Pathol. 127:820–827. 2007. View Article : Google Scholar : PubMed/NCBI

46 

Hagan S, Al-Mulla F, Mallon E, Oien K, Ferrier R, Gusterson B, García JJ and Kolch W: Reduction of Raf-1 kinase inhibitor protein expression correlates with breast cancer metastasis. Clin Cancer Res. 11:7392–7397. 2005. View Article : Google Scholar : PubMed/NCBI

47 

Schuierer MM, Bataille F, Hagan S, Kolch W and Bosserhoff AK: Reduction in Raf kinase inhibitor protein expression is associated with increased Ras-extracellular signal-regulated kinase signaling in melanoma cell lines. Cancer Res. 64:5186–5192. 2004. View Article : Google Scholar : PubMed/NCBI

48 

Fu Z, Kitagawa Y, Shen R, Shah R, Mehra R, Rhodes D, Keller PJ, Mizokami A, Dunn R, Chinnaiyan AM, et al: Metastasis suppressor gene Raf kinase inhibitor protein (RKIP) is a novel prognostic marker in prostate cancer. Prostate. 66:248–256. 2006. View Article : Google Scholar : PubMed/NCBI

49 

Schuierer MM, Bataille F, Weiss TS, Hellerbrand C and Bosserhoff AK: Raf kinase inhibitor protein is downregulated in hepatocellular carcinoma. Oncol Rep. 16:451–456. 2006.PubMed/NCBI

50 

Keller ET, Fu Z, Yeung K and Brennan M: Raf kinase inhibitor protein: A prostate cancer metastasis suppressor gene. Cancer Lett. 207:131–137. 2004. View Article : Google Scholar : PubMed/NCBI

51 

Keller ET: Metastasis suppressor genes: A role for raf kinase inhibitor protein (RKIP). Anticancer Drugs. 15:663–669. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wei H, Liu Z, She H, Liu B, Gu J, Wei D, Zhang X, Wang J, Qi S, Ping F, Ping F, et al: Promoter methylation and expression of Raf kinase inhibitory protein in esophageal squamous cell carcinoma. Oncol Lett 13: 1866-1872, 2017.
APA
Wei, H., Liu, Z., She, H., Liu, B., Gu, J., Wei, D. ... Ping, F. (2017). Promoter methylation and expression of Raf kinase inhibitory protein in esophageal squamous cell carcinoma. Oncology Letters, 13, 1866-1872. https://doi.org/10.3892/ol.2017.5617
MLA
Wei, H., Liu, Z., She, H., Liu, B., Gu, J., Wei, D., Zhang, X., Wang, J., Qi, S., Ping, F."Promoter methylation and expression of Raf kinase inhibitory protein in esophageal squamous cell carcinoma". Oncology Letters 13.3 (2017): 1866-1872.
Chicago
Wei, H., Liu, Z., She, H., Liu, B., Gu, J., Wei, D., Zhang, X., Wang, J., Qi, S., Ping, F."Promoter methylation and expression of Raf kinase inhibitory protein in esophageal squamous cell carcinoma". Oncology Letters 13, no. 3 (2017): 1866-1872. https://doi.org/10.3892/ol.2017.5617
Copy and paste a formatted citation
x
Spandidos Publications style
Wei H, Liu Z, She H, Liu B, Gu J, Wei D, Zhang X, Wang J, Qi S, Ping F, Ping F, et al: Promoter methylation and expression of Raf kinase inhibitory protein in esophageal squamous cell carcinoma. Oncol Lett 13: 1866-1872, 2017.
APA
Wei, H., Liu, Z., She, H., Liu, B., Gu, J., Wei, D. ... Ping, F. (2017). Promoter methylation and expression of Raf kinase inhibitory protein in esophageal squamous cell carcinoma. Oncology Letters, 13, 1866-1872. https://doi.org/10.3892/ol.2017.5617
MLA
Wei, H., Liu, Z., She, H., Liu, B., Gu, J., Wei, D., Zhang, X., Wang, J., Qi, S., Ping, F."Promoter methylation and expression of Raf kinase inhibitory protein in esophageal squamous cell carcinoma". Oncology Letters 13.3 (2017): 1866-1872.
Chicago
Wei, H., Liu, Z., She, H., Liu, B., Gu, J., Wei, D., Zhang, X., Wang, J., Qi, S., Ping, F."Promoter methylation and expression of Raf kinase inhibitory protein in esophageal squamous cell carcinoma". Oncology Letters 13, no. 3 (2017): 1866-1872. https://doi.org/10.3892/ol.2017.5617
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team