Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
December-2017 Volume 14 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2017 Volume 14 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA‑132 expression

  • Authors:
    • Wen‑Jie Zhou
    • Hui‑Li Yang
    • Kai‑Kai Chang
    • Yi Meng
    • Ming‑Yan Wang
    • Min‑Min Yuan
    • Ming‑Qing Li
    • Feng Xie
  • View Affiliations / Copyright

    Affiliations: Laboratory for Reproductive Immunology, Hospital of Obstetrics and Gynecology, Fudan University, Shanghai 200011, P.R. China, Medical Center of Diagnosis and Treatment for Cervical Diseases, Hospital of Obstetrics and Gynecology, Fudan University, Shanghai 200011, P.R. China
  • Pages: 7910-7916
    |
    Published online on: October 23, 2017
       https://doi.org/10.3892/ol.2017.7260
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Thymic stromal lymphopoietin (TSLP), produced by cervical cancer (CC) cells, promotes angiogenesis, and the recruitment and functional regulation of eosinophils. It has been reported that microRNA (miR)‑132 is aberrantly decreased in CC tissues. However, the function and mechanism of TSLP on the biological behaviors of CC cells is largely unknown. The aim of the present study was to investigate the effect of TSLP on the expression of miR‑132 and the proliferation and invasion in vitro of CC cell lines, namely, HeLa and SiHa cells. The transcrpitional level of miR‑132 was analyzed using reverse transcription‑quantitative polymerase chaon reaction. The proliferation, invasion, and the expression of proliferation and invasion‑related molecules in HeLa and SiHa cells in vitro were evaluated using bromodeoxyuridine cell proliferation, Matrigel invasion assays, flow cytometry and ELISA, respectively. Here, it was revealed that recombinant human TSLP (rhTSLP) downregulated the expression levels of miR‑132 in HeLa and SiHa cells, and by contrast, the neutralizing antibodies for TSLP or TSLP receptor (TSLPR) upregulated miR‑132 expression levels in HeLa and SiHa cells. The overexpression of miR‑132 resulted in a lowered proliferation and invasiveness, decreased levels of proliferation‑associated molecules marker of proliferation Ki‑67 and proliferating cell nuclear antigen, and the decreased production of matrix metalloproteinase (MMP)2 and MMP9 in HeLa and SiHa cells. Compared with the control group, there was a higher level of proliferation and invasion in HeLa and SiHa cells following stimulation with rhTSLP. However, these effects induced by rhTSLP were significantly impaired in HeLa and SiHa cells with miR‑132 overexpression. The results of the present study indicated that TSLP produced by CC cells downregulated miR‑132 expression, and stimulated the proliferation and invasion of CC cells, thereby further promoting the development of CC.

Introduction

Cervical cancer (CC) is one of the most common gynecological malignancies with high rates of morbidity (0.001–0.05%) and mortality (0.0024–0.0175%), endangering the health and quality of life of women globally (1). Although the decreased incidence of CC has primarily been attributed to the widespread use of cytological screening, invasive CC remains an issue regarding the mortality rates of patients with CC. Thus, the elucidation of the molecular pathogenesis of CC is urgently required. The pathogenesis of CC remains enigmatic and may be connected with numerous factors, including infection with high-risk human papillomaviruses (HPVs) (2).

Thymic stromal lymphopoietin (TSLP) is primarily produced by stromal cells, epithelial cells, fibroblasts, keratinocytes, basophils and other types of cells, including mast cells, smooth muscle cells, fibroblasts, dendritic cells, trophoblasts, and cancer or cancer-associated cells (3–5). TSLP may trigger helper T-cell 2 cytokines, and is associated with airway inflammatory disease, immunoglobulin E production, allergic responses and eosinophilia (3,4,6). The TSLP receptor (TSLPR) is a typical heterodimeric cytokine receptor, including a TSLP binding subunit (TSLPRα) and α-subunit of the interleukin-7 receptor (7,8). A previous study reported that an aberrantly high level of TSLP present in cancer lesions, potentially mediated by hypoxia, was a notable regulator of the progression of CC by recruiting and licensing tumor-associated eosinophils (EOS) to CC lesions (9). In addition, TSLP produced by CC cells promotes angiogenesis in an EOS-dependent and -independent manner (10,11). Watanabe et al (12) reported that high TSLP expression levels indicate a poor prognosis in patients with gastric cancer. However, whether and how TSLP regulates the proliferation and invasion of CC cells remains unknown.

Previously, an increasing number of studies have focused on the effect of microRNA (miRNA/miR) on CC (13). Zhao et al (14) reported that miR-132 expression was decreased in CC tissues compared with that in adjacent non-cancerous tissues. Transforming growth factor (TGF)-β is a multifunctional cytokine and may induce numerous important signaling pathways in several types of cancer cells (15,16). Furthermore, TGF-β may regulate the expression of TSLP in the intervertebral disc tissue (17) and regulate the expression of miR-132 in glioma cells (18). However, it remains unknown whether TSLP regulates the biological behaviors by modulating the expression of miR-132 in CC.

Therefore, the present study investigated the effect of TSLP on the expression of miR-132, and the proliferation and invasion of the CC HeLa and SiHa cell lines in vitro.

Materials and methods

Cell culture

Cervical epidermal carcinoma HeLa and SiHa cells were obtained from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China), and grown in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 5% fetal bovine serum (FBS; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) at 37°C in a humidified atmosphere containing 5% CO2.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Following treatment with a range of concentrations of recombinant human TSLP (rhTSLP; 1, 10, 100 ng/ml; R&D Systems, Inc., Minneapolis, MN, USA), the anti-human TSLP neutralizing antibodies (α-TSLP) or anti-human TSLPR neutralizing antibodies (α-TSLPR) (5 µg/ml; R&D Systems, Inc.) at 37°C in a humidified incubator containing 5% CO2 for 48 h, with 1% PBS used as a control. RT-qPCR was performed in order to determine the expression levels of miR-132 in the HeLa and SiHa cells. Total RNA was extracted from these cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. The total miRNA of HeLa and SiHa cells were harvested using the PureLink™ miRNA Isolation kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. miR-132 expression was detected using the TaqMan MicroRNA Assay kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The parameters of the PCR reaction were as follows: 94°C for 2 min, 1 cycle; 94°C for 20 sec, 60°C for 34 sec for 40 cycles. The relative expression levels of miR-132 were analyzed using the 2−ΔΔCq relative quantification method with human U6 small nuclear RNA used as an internal control (19). The sequences of primers and TaqMan probes are presented in Table I. All assays were performed in triplicate.

Table I.

Sequences of the primers and TaqMan probes.

Table I.

Sequences of the primers and TaqMan probes.

A, Primer sequence

GeneSequence (5′-3′)
miR-132
  Forward TGGATCCCCCCCAGTCCCCGTCCCTCAG
  Reverse TGAATTCGGATACCTTGGCCGGGAGGAC
U6
  Forward CTCGCTTCGGCAGCACA
  Reverse AACGCTTCACGAATTTGCGT

B, TaqMan probe sequence

GeneSequence (5′-3′)

miR-132 FAM-TGGATACGACCGACCAT-BHQ1
U6 FAM-TGCGCAAGGATGACACGCA-BHQ1

[i] miR, microRNA.

Overexpression of miR-132 in HeLa and SiHa cells

The miR-132 mimic lentivirus (miR-132-mimic) and its corresponding miRNA lentivirus negative control (miR-NC) were constructed by Shanghai GenePharma Co., Ltd. (Shanghai, China). miR-132 overexpression and corresponding control stable cell lines were then established. The recombinant virus was packaged using the Lentivector Expression system (GeneChem Co., Ltd.), and HeLa and SiHa cells were infected. For lentivirus infection, 3×105 HeLa or SiHa cells were cultured in 6-well plates and incubated for 24 h prior to be infected. Next, miR-132-mimic lentivirus or miR-NC lentivirus at a multiplicity of infection (MOI) of 20, was added to the cells. After three days, the efficiency of miR-132 overexpression was verified using RT-qPCR analysis. PCR cycling conditions were as follows: 94°C for 2 min, 1 cycle; 94°C for 20 sec, 60°C for 34 sec for 40 cycles. The subsequent experiments were performed using viruses at the aforementioned MOIs.

Bromodeoxyuridine (BrdU) cell proliferation and Matrigel invasion assays

The miR-NC and miR-132-mimic HeLa and SiHa cells were treated with rhTSLP (10 ng/ml) in a humidified incubator containing 5% CO2 at 37°C for 48 or 72 h. In addition, the vehicle (1% PBS) for the negative control was added. Next, the proliferation ability of the HeLa and SiHa cells was detected using a BrdU cell proliferation assay kit (Merck KGaA, Darmstadt, Germany) according to the manufacturer's protocol. The experiments were performed in triplicate, and repeated 4 times.

In addition, the invasion ability of HeLa and SiHa cells was analyzed using a Matrigel invasion assay. Briefly, the cells inserts (8-µm pore size, 6.5-mm diameter; Corning Incorporated, Corning, NY, USA) coated with 25 µl Matrigel were placed in a 24-well plate. The miR-NC and miR-132-mimics HeLa and SiHa cells, at 2×104 cells per well, were plated in the upper chamber with 100 µl RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.). RhTSLP (10 ng/ml) or the vehicle was added. The lower chamber was filled with 800 µl RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) including 5% FBS. The cells were then incubated at 37°C for 48 h. The inserts were removed, washed in phosphate-buffered saline, and the non-invading cells together with the Matrigel were removed from the upper surface of the filter by wiping with a cotton bud. The inserts were then fixed in methanol for 10 min at room temperature and stained with hematoxylin for 30 min at room temperature. The result was observed under an Olympus BX51+P70 microscope (Olympus Corporation, Tokyo, Japan). The cells that migrated to the lower surfaces were counted in 5 predetermined fields using light microscopy at a magnification of ×200. Each experiment was performed in triplicate, and repeated 3 times.

Flow cytometry (FCM)

The expression of marker of proliferation Ki-67 and proliferating cell nuclear antigen (PCNA) in HeLa and SiHa cells was analyzed using FCM. Specifically, these cells were fixed with 4% paraformaldehyde and permeabilized with 70% ethanol. After centrifugation at 150 × g for 10 min at room temperature, the precipitate was resuspended in 1 ml of 0.9% physiological saline and centrifuged at 150 × g for 10 min at room temperature. The precipitate was then resuspended in 150 µl 0.9% physiological saline and blocked with human AB serum (Sigma-Aldrich; Merck KGaA) at 4°C for 30 min. Samples were then stained with allophycocyanin-conjugated anti-human Ki-67 antibody (1:30, cat. no. 350514; BioLegend, Inc., San Diego, CA, USA) and phycoerythrin-conjugated anti-human PCNA antibody (1:30, cat. no. 307908; BioLegend, Inc.) for 30 min at room temperature. Thereafter, the cells were washed twice, and resuspended in PBS for FCM analysis. In parallel, APC-conjugated Mouse IgG1, κ Isotype Control antibody (1:30, cat. no. 400119; BioLegend, Inc.) and PE-conjugated Mouse IgG2a, κ Isotype Control antibody (1:30, cat. no. 400211; BioLegend, Inc.) were used as controls. Samples were analyzed in a FACS Calibur flow cytometer (Becton Dickinson, New York, NY, USA) using Becton Dickinson CellQuest software (version 7.1; Becton Dickinson). Statistical analysis was conducted by using isotype matched controls as references.

Enzyme-linked immunosorbent assay (ELISA)

miR-NC and miR-132-mimic HeLa and SiHa cells were cultured in a humidified incubator containing 5% CO2 at 37°C for 72 h. Next, the cell culture supernatant was harvested, centrifuged at 300 × g at 4°C for 10 min to remove cellular debris, and stored at −80°C until assayed using an ELISA. The secretion level of matrix metalloproteinase (MMP)2 and MMP9 using the supernatant was detected using human MMP2 and MMP9 ELISA kits (Shanghai ExCell Biology, Inc., Shanghai, China) according to the manufacturer's protocols. The experiment was repeated three times.

Statistics

All data are presented as the mean ± the standard error of the mean. The data were analyzed using GraphPad Prism version 5 (GraphPad Software, Inc., La Jolla, CA, USA) using an unpaired Student's t-test, or one-way analysis of variance followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

TSLP downregulates the expression of miR-132 in HeLa and SiHa cells

In order to evaluate the effect of TSLP on the expression of miR-132 in CC cells, HeLa and SiHa cells were treated with with rhTSLP, α-TSLP or α-TSLPR. rhTSLP was revealed to downregulate the expression of miR-132 in HeLa and SiHa cells, with a signficant difference observed at concentrations of 10 and 100 ng/ml (P<0.05 or P<0.01; Fig. 1A and B). By contrast, blocking TSLP signaling using α-TSLP or α-TSLPR significantly upregulated the expression of miR-132 in the HeLa and SiHa cells (P<0.05 or P<0.01; Fig. 1A and B). These results indicate that exogenous and endogenous TSLP decrease the expression of miR-132 in CC cells, and may further regulate the biological behaviors of CC cells.

Figure 1.

TSLP downregulates the expression levels of miR-132 of HeLa and SiHa cells. Following treatment with differing concentrations of rhTSLP (1, 10 and 100 ng/ml), α-TSLP or α-TSLPR (5 µg/ml), or no treatment for 48 h, the mRNA expression levels of miR-132 in (A) HeLa and (B) SiHa cells were analyzed using reverse transcription-quantitative polymerase chain reaction analysis. *P<0.05 or **P<0.01 vs. the control. TSLP, thymic stromal lymphopoietin; rhTSLP, recombinant human TSLP; α-TSLP, anti-human TSLP neutralizing antibody; α-TSLPR, anti-human TSLP receptor neutralizing antibody; miR, microRNA; Ctrl, control.

miR-132 inhibits the proliferation and invasion of HeLa and SiHa cells

To investigate the potential function of miR-132 in CC cells, miR-132 was first overexpressed in HeLa and SiHa cells by transfection, and miR-132 overexpression was obtained in miR-132-mimic stable HeLa and SiHa cell lines, compared with the negative control (P<0.001; Fig. 2A). Next, it was revealed that there were lower levels of proliferation in the miR-132-overexpressed HeLa and SiHa cells compared with the control cells, with a greater signficant difference observed at 72 h (P<0.05, P<0.01 or P<0.001; Fig. 2B). Furthermore, miR-132 overexpression resulted in a lower invasiveness of HeLa and SiHa cells compared with that of the control cells (P<0.001; Fig. 2C and D). This data suggest that miR-132 may suppress the proliferation and invasion of CC cells in vitro.

Figure 2.

miR-132 inhibits the proliferation and invasion of HeLa and SiHa cells. (A) The overexpression of miR-132 in HeLa and SiHa cells was successfully constructed by transfection, and verified using reverse transcription-quantiative polymerase chain reaction. The (B) proliferation and (C and D) invasiveness of HeLa and SiHa cells was analyzed between miR-132-mimic and miR-NC stable HeLa and SiHa cell lines using a bromodeoxyuridine cell proliferation assay for 48 and 72 h, and a Matrigel invasion assay for 48 h, respectively. Original magnification, ×200. *P<0.05, **P<0.01 or ***P<0.001 vs. miR-NC. miR, microRNA; NC, negative control; NS, not significant.

miR-132 downregulates the expression of Ki-67, PCNA, MMP2 and MMP9 in HeLa and SiHa cells

To explore the potential mechanism of miR-132 in regulating the proliferation and invasion of CC cells, the expression of proliferation-associated molecules Ki-67 and PCNA, and invasion-associated molecules MMP2 and MMP9 were analyzed between miR-132-overexpressed HeLa and SiHa cells and control cells. As presented, the overexpression of miR-132 resulted in the significantly lower expression of Ki-67 and PCNA (P<0.05, P<0.01 or P<0.001; Fig. 3A and B), and MMP2 and MMP9 (P<0.05 or P<0.01; Fig. 3C) in the HeLa and SiHa cells. Together, these data suggest that miR-132 may inhibit the proliferation and invasion of CC cells, potentially via the downregulation of Ki-67, PCNA, MMP2 and MMP9 in vitro.

Figure 3.

miR-132 downregulates the expression of Ki-67, PCNA, MMP2 and MMP9 of HeLa and SiHa cells. (A) The expression of Ki-67 and PCNA in miR-NC and miR-132-mimic HeLa and SiHa cells was detected using flow cytometry, (B) and quantified. (C) The secretion level of MMP2 and MMP9 of the supernatants of miR-NC and miR-132-mimic HeLa and SiHa cells was analyzed using an ELISA. *P<0.05, **P<0.01 or ***P<0.001 vs. miR-NC. miR, microRNA; Ki-67, marker of proliferation Ki-67; PCNA, proliferating cell nuclear antigen; MMP, matrix metalloproteinase; NC, negative control.

TSLP stimulates the proliferation and invasion of HeLa and SiHa cells by the downregulation of miR-132

To further explore the function and mechanism of TSLP in CC cells, the miR-132-overexpressed HeLa and SiHa cells and the control cells were incubated with rhTSLP or were left untreated. As presented, rhTSLP markedly stimulated the proliferation and invasion of HeLa and SiHa cells (P<0.05 or P<0.01; Fig. 4A and B). However, the overexpression of miR-132 could partly abrogate the effects of rhTSLP on the proliferation and invasion ability of the HeLa and SiHa cells (Fig. 4A and B). The results of the present study suggest that TSLP promotes the proliferation and invasion of CC cells, and that these effects are partly dependent on the downregulation of miR-132.

Figure 4.

TSLP stimulates the proliferation and invasion of HeLa and SiHa cells via the downregulation of miR-132. The miR-NC and miR-132-mimic HeLa and SiHa cells were treated with or without rhTSLP (10 ng/ml), and then the proliferation and invasion of these cells were analyzed using (A) a BrdU cell proliferation assay for 72 h and (B) a Matrigel invasion assay for 48 h. *P<0.05, **P<0.01 and ***P<0.001 vs. miR-NC. NS, #P<0.05 or ##P<0.01 vs. the no rhTSLP group. TSLP, thymic stromal lymphopoietin; miR, microRNA; NC, negative control; rhTSLP, recombinant human TSLP; NS, not significant; ctrl, control.

Discussion

As a class of small, highly-conserved non-coding RNAs, miRNAs are known to regulate gene expression at the post-transcriptional level by complementarity with the biding sites in the 3′-untranslated region of the target mRNA (20). It has been reported that miRNAs serve functions in numerous physiological and pathological processes, including cell development, differentiation, proliferation, apoptosis and metastasis. An accumulating body of evidence has indicated that miRNAs serve vital functions in the progression of CC and that they directly contribute to the growth and metastasis of CC cells via the targeting of a large number of critical protein-coding genes. miR-132 is located on human chromosome 17p13.3, which is associated with various types of human cancer including osteosarcoma, gastric cancer (21), colorectal cancer (22), prostate cancer (23), breast cancer (24,25), hepatocellular carcinoma (26), pancreatic cancer (27,28) and glioma (29). Zhao et al (14) reported that the expression levels of miR-132 in CC tissues were lower compared with those in adjacent non-cancerous tissues, and it was revealed that miR-132 downregulated SMAD family member (SMAD)2 expression in order to suppress the G1/S phase transition of the cell cycle and the epithelial to mesenchymal transition (EMT) in CC cells. However, the mechanism resulting in the low expression of miR-132 in CC remains largely unknown.

Previous research has established that TSLP is aberrantly highly expressed in CC cells, indirectly promoting their growth by recruiting and regulating tumor-associated EOS, and stimulating angiogenesis in CC lesions (9–11). Additionally, hypoxia may contribute to the increase in the TSLP expression level in CC cells. In the present study, it was revealed that exogenous and endogenous TSLP decreased the level of miR-132 expression in HeLa and SiHa cells, and further stimulated the proliferation and invasion of CC cells in vitro. In addition, the inhibitory effects of miR-132 on the proliferation and invasion of CC cells were associated with the regulation of Ki-67, PCNA, MMP2 and MMP9.

TGF-β may upregulate the miR-132 expression level in dose- and time-dependent manners, and may further enhance the activation of TGF-β signaling by inhibiting SMAD7 expression in glioma cells (18). TGF-β additionally serves important regulatory functions in CC, as for example, the oncoproteins of HPVs may stimulate TGF-β1 expression in CC cells, which in turn suppresses the host immune surveillance towards CC, and triggers the EMT process, migration and metastasis of CC cells (30–33). Endogenous TGF-β activity has been reported to limit the expression in of TSLP in intervertebral disc tissue in a steady state by suppressing nuclear factor-κB activation (17). Therefore, TGF-β upregulates the expression of miR-132, potentially by suppressing TSLP production, and the association between TGF-β, TSLP and miR-132 in CC cells requires further research.

The high level of TSLP production is associated with local hypoxia (9). Notably, hypoxia also results in the upregulation of miR-132 (34,35). Thus, hypoxia may regulate CC cells in a dual-directional manner by upregulating TSLP and miR-132. The precise association and mechanism of hypoxia with TSLP and miR-132 in CC should be further studied for clarification.

Antigen Ki-67 is a nuclear protein that is associated with, and may be necessary for, cellular proliferation. Ki-67 and PCNA are considered to be prognostic markers in CC (36,37). A number of studies have demonstrated that miR-132 inhibits the growth of tumor cells by suppressing the expression of Ki-67 (26,38). Cancer cell migration from the tissue of origin to either the surrounding or distant organs is vital for the progression of tumors. An association has been found between MMP2 and MMP9 and the processes of tumor cell invasion and metastasis in multiple types of human cancer, including uterine neoplasms (39). Jasińska et al (40) reported that miR-132 regulated the structural plasticity of dendritic spines through directly repressing the expression of MMP9. In the present study, miR-132 significantly downregulated the expression of proliferation-associated proteins Ki-67 and PCNA, and invasion-associated enzymes MMP2 and MMP9 in CC cells, and further suppressed the proliferation and invasion of CC cells in vitro.

Based on the results of the present study and other studies, as presented in Fig. 5, it may be concluded that the high level of TSLP may be attributed to hypoxia and/or TGF-β. This high level increases EOS infiltration and tumor angiogenesis, and downregulates the expression level of miR-132 in CC cells. miR-132 may decrease the expression of Ki-67, PCNA, MMP2 and MMP9, and limit the proliferation and invasion of CC cells. Therefore, these numerous effects of TSLP contribute to the development of CC. The results of the present study further contribute to the present understanding on the biological function and manner of TSLP/miR-132 signaling in CC progression.

Figure 5.

Function of TSLP/miR-132 signaling in CC cells. CC cells secrete high levels of TSLP. TSLP then downregulates the level of miR-132 in CC cells. As a result, miR-132 suppresses the expression of proliferation-associated molecules Ki-67 and PCNA, and invasion-associated molecules MMP2 and MMP9, and further inhibits the proliferation and invasion of CC cells. Therefore, TSLP/miR-132 signaling contributes to the progression of CC. TSLP, thymic stromal lymphopoietin; miR, microRNA; CC, cervial cancer; Ki-67, marker of proliferation Ki-67; PCNA, proliferating cell nuclear antigen; MMP, matrix metalloproteinase.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant nos. 81302260 and 31600735) and the Shanghai Natural Science Foundation (grant no. 17ZR1403200), and the Program for Zhuoxue of Fudan University.

References

1 

Ferlay J, Shin HR, Bray F, Forman D, Mathers C and Parkin DM: Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 127:2893–2917. 2010. View Article : Google Scholar : PubMed/NCBI

2 

zur Hausen H: Human papillomaviruses in the pathogenesis of anogenital cancer. Virology. 184:9–13. 1991. View Article : Google Scholar : PubMed/NCBI

3 

Liu YJ, Soumelis V, Watanabe N, Ito T, Wang YH, Malefyt Rde W, Omori M, Zhou B and Ziegler SF: TSLP: An epithelial cell cytokine that regulates T cell differentiation by conditioning dendritic cell maturation. Annual Annu Rev Immunol. 25:193–219. 2007. View Article : Google Scholar

4 

Sokol CL, Barton GM, Farr AG and Medzhitov R: A mechanism for the initiation of allergen-induced T helper type 2 responses. Nat Immunol. 9:310–318. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Rochman Y and Leonard WJ: Thymic stromal lymphopoietin: A new cytokine in asthma. Curr Opin Pharmacol. 8:249–254. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Liu YJ: Thymic stromal lymphopoietin and OX40 ligand pathway in the initiation of dendritic cell-mediated allergic inflammation. J Allergy Clin Immunol. 120:238–246. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Park LS, Martin U, Garka K, Gliniak B, Di Santo JP, Muller W, Largaespada DA, Copeland NG, Jenkins NA, Farr AG, et al: Cloning of the murine thymic stromal lymphopoietin (TSLP) receptor: Formation of a functional heteromeric complex requires interleukin 7 receptor. J Exp Med. 192:659–670. 2000. View Article : Google Scholar : PubMed/NCBI

8 

Reche PA, Soumelis V, Gorman DM, Clifford T, Liu Mr, Travis M, Zurawski SM, Johnston J, Liu YJ, Spits H, et al: Human thymic stromal lymphopoietin preferentially stimulates myeloid cells. J Immunol. 167:336–343. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Xie F, Liu LB, Shang WQ, Chang KK, Meng YH, Mei J, Yu JJ, Li DJ and Li MQ: The infiltration and functional regulation of eosinophils induced by TSLP promote the proliferation of cervical cancer cell. Cancer Lett. 364:106–117. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Xie F, Meng YH, Liu LB, Chang KK, Li H, Li MQ and Li DJ: Cervical carcinoma cells stimulate the angiogenesis through TSLP promoting growth and activation of vascular endothelial cells. Am J Reprod Immunol. 70:69–79. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Zhang B, Wei CY, Chang KK, Yu JJ, Zhou WJ, Yang HL, Shao J, Yu JJ, Li MQ and Xie F: TSLP promotes angiogenesis of human umbilical vein endothelial cell by strengthening crosstalk between cervical cancer cells and eosinophils. Oncol Lett. DOI: 10.3892/ol.2017.7121.

12 

Watanabe J, Saito H, Miyatani K, Ikeguchi M and Umekita Y: TSLP expression and high serum TSLP level indicate a poor prognosis in gastric cancer patients. Yonago Acta Med. 58:137–143. 2015.PubMed/NCBI

13 

Deftereos G, Corrie SR, Feng Q, Morihara J, Stern J, Hawes SE and Kiviat NB: Expression of mir-21 and mir-143 in cervical specimens ranging from histologically normal through to invasive cervical cancer. PLoS One. 6:e284232011. View Article : Google Scholar : PubMed/NCBI

14 

Zhao JL, Zhang L, Guo X, Wang JH, Zhou W, Liu M, Li X and Tang H: miR-212/132 downregulates SMAD2 expression to suppress the G1/S phase transition of the cell cycle and the epithelial to mesenchymal transition in cervical cancer cells. IUBMB Life. 67:380–394. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Miyazono K, Suzuki H and Imamura T: Regulation of TGF-beta signaling and its roles in progression of tumors. Cancer Sci. 94:230–234. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Massagué J: TGFβ in cancer. Cell. 134:215–230. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Zhu Y, Ohba T, Ando T, Fujita K, Koyama K, Nakamura Y, Katoh R, Haro H and Nakao A: Endogenous TGF-β activity limits TSLP expression in the intervertebral disc tissue by suppressing NF-κB activation. J Orthop Res. 31:1144–1149. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Wang ZH, Zhang QS, Duan YL, Zhang JL, Li GF and Zheng DL: TGF-β induced miR-132 enhances the activation of TGF-β signaling through inhibiting SMAD7 expression in glioma cells. Biochem Biophys Res Commun. 463:187–192. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Liu X, Yu H, Cai H and Wang Y: The expression and clinical significance of miR-132 in gastric cancer patients. Diagn Pathol. 9:572014. View Article : Google Scholar : PubMed/NCBI

22 

Zheng YB, Luo HP, Shi Q, Hao ZN, Ding Y, Wang QS, Li SB, Xiao GC and Tong SL: miR-132 inhibits colorectal cancer invasion and metastasis via directly targeting ZEB2. World J Gastroenterol. 20:6515–6522. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Formosa A, Lena AM, Markert EK, Cortelli S, Miano R, Mauriello A, Croce N, Vandesompele J, Mestdagh P, Finazzi-Agrò E, et al: DNA methylation silences miR-132 in prostate cancer. Oncogene. 32:127–134. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Zhang ZG, Chen WX, Wu YH, Liang HF and Zhang BX: MiR-132 prohibits proliferation, invasion, migration, and metastasis in breast cancer by targeting HN1. Biochem Biophys Res Commun. 454:109–114. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Li S, Meng H, Zhou F, Zhai L, Zhang L, Gu F, Fan Y, Lang R, Fu L, Gu L and Qi L: MicroRNA-132 is frequently down-regulated in ductal carcinoma in situ (DCIS) of breast and acts as a tumor suppressor by inhibiting cell proliferation. Pathol Res Pract. 209:179–183. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Zhang X, Tang W, Li R, He R, Gan T, Luo Y, Chen G and Rong M: Downregulation of microRNA-132 indicates progression in hepatocellular carcinoma. Exp Ther Med. 12:2095–2101. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Zhang S, Hao J, Xie F, Hu X, Liu C, Tong J, Zhou J, Wu J and Shao C: Downregulation of miR-132 by promoter methylation contributes to pancreatic cancer development. Carcinogenesis. 32:1183–1189. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Luo G, Long J, Cui X, Xiao Z, Liu Z, Shi S, Liu L, Liu C, Xu J, Li M and Yu X: Highly lymphatic metastatic pancreatic cancer cells possess stem cell-like properties. Int J Oncol. 42:979–984. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Liu Q, Liao F, Wu H, Cai T, Yang L, Wang ZF and Zou R: Upregulation of miR-132 expression in glioma and its clinical significance. Tumor Biol. 35:12299–12304. 2014. View Article : Google Scholar

30 

Zhu H, Luo H, Shen Z, Hu X, Sun L and Zhu X: Transforming growth factor-β1 in carcinogenesis, progression, and therapy in cervical cancer. Tumor Biol. 37:7075–7083. 2016. View Article : Google Scholar

31 

Sun SH, Liu D, Deng YT, Zhang XX, Wan DY, Xi BX, Huang W, Chen Q, Li MC, Wang MW, et al: SIX1 coordinates with TGFβ signals to induce epithelial-mesenchymal transition in cervical cancer. Oncol Lett. 12:1271–1278. 2016.PubMed/NCBI

32 

Torres-Poveda K, Bahena-Román M, Madrid-González C, Burguete-García AI, Bermúdez-Morales VH, Peralta-Zaragoza O and Madrid-Marina V: Role of IL-10 and TGF-β1 in local immunosuppression in HPV-associated cervical neoplasia. World J Clin Oncol. 5:753–763. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Lin H, Huang CC, Ou YC, Huang EY, Changchien CC, Tseng CW, Fu HC, Wu CH, Li CJ and Ma YY: High immunohistochemical expression of TGF-β1 predicts a poor prognosis in cervical cancer patients who harbor enriched endoglin microvessel density. Int J Gynecol Pathol. 31:482–489. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Yao C, Shi X, Zhang Z, Zhou S, Qian T, Wang Y, Ding F, Gu X and Yu B: Hypoxia-Induced upregulation of miR-132 promotes schwann cell migration after sciatic nerve injury by targeting PRKAG3. Mol Neurobiol. 53:5129–5139. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Hong S, Lee J, Seo HH, Lee CY, Yoo KJ, Kim SM, Lee S, Hwang KC and Choi E: Na(+)-Ca(2+) exchanger targeting miR-132 prevents apoptosis of cardiomyocytes under hypoxic condition by suppressing Ca(2+) overload. Biochem Biophys Res Commun. 460:931–937. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Piri R, Ghaffari A, Azami-Aghdash S, Ali-Akbar YP, Saleh P and Naghavi-Behzad M: Ki-67/MIB-1 as a prognostic marker in cervical cancer-a systematic review with meta-analysis. Asian Pac J Cancer Prev. 16:6997–7002. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Astudillo H, Lopez T, Castillo S, Gariglio P and Benitez L: p53, Bcl-2, PCNA expression, and apoptotic rates during cervical tumorigenesis. Ann N Y Acad Sci. 1010:771–774. 2003. View Article : Google Scholar : PubMed/NCBI

38 

Luo J, Meng C, Tang Y, Zhang S, Wan M, Bi Y and Zhou X: miR-132/212 cluster inhibits the growth of lung cancer xenografts in nude mice. Int J Clin Exp Med. 7:4115–4122. 2014.PubMed/NCBI

39 

Libra M, Scalisi A, Vella N, Clementi S, Sorio R, Stivala F, Spandidos DA and Mazzarino C: Uterine cervical carcinoma: Role of matrix metalloproteinases (Review). Int J Oncol. 34:897–903. 2009. View Article : Google Scholar : PubMed/NCBI

40 

Jasińska M, Miłek J, Cymerman IA, Łęski S, Kaczmarek L and Dziembowska M: miR-132 regulates dendritic spine structure by direct targeting of matrix metalloproteinase 9 mRNA. Mol Neurobiol. 53:4701–4712. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhou WJ, Yang HL, Chang KK, Meng Y, Wang MY, Yuan MM, Li MQ and Xie F: Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA‑132 expression. Oncol Lett 14: 7910-7916, 2017.
APA
Zhou, W., Yang, H., Chang, K., Meng, Y., Wang, M., Yuan, M. ... Xie, F. (2017). Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA‑132 expression. Oncology Letters, 14, 7910-7916. https://doi.org/10.3892/ol.2017.7260
MLA
Zhou, W., Yang, H., Chang, K., Meng, Y., Wang, M., Yuan, M., Li, M., Xie, F."Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA‑132 expression". Oncology Letters 14.6 (2017): 7910-7916.
Chicago
Zhou, W., Yang, H., Chang, K., Meng, Y., Wang, M., Yuan, M., Li, M., Xie, F."Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA‑132 expression". Oncology Letters 14, no. 6 (2017): 7910-7916. https://doi.org/10.3892/ol.2017.7260
Copy and paste a formatted citation
x
Spandidos Publications style
Zhou WJ, Yang HL, Chang KK, Meng Y, Wang MY, Yuan MM, Li MQ and Xie F: Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA‑132 expression. Oncol Lett 14: 7910-7916, 2017.
APA
Zhou, W., Yang, H., Chang, K., Meng, Y., Wang, M., Yuan, M. ... Xie, F. (2017). Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA‑132 expression. Oncology Letters, 14, 7910-7916. https://doi.org/10.3892/ol.2017.7260
MLA
Zhou, W., Yang, H., Chang, K., Meng, Y., Wang, M., Yuan, M., Li, M., Xie, F."Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA‑132 expression". Oncology Letters 14.6 (2017): 7910-7916.
Chicago
Zhou, W., Yang, H., Chang, K., Meng, Y., Wang, M., Yuan, M., Li, M., Xie, F."Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA‑132 expression". Oncology Letters 14, no. 6 (2017): 7910-7916. https://doi.org/10.3892/ol.2017.7260
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team