Long non‑coding RNA TUG1 promotes the proliferation of colorectal cancer cells through regulating Wnt/β‑catenin pathway
- Authors:
- Published online on: August 3, 2018 https://doi.org/10.3892/ol.2018.9259
- Pages: 5317-5324
Abstract
Introduction
Colorectal cancer (CRC) is the third most common malignancy in the world (1). Numerous causes lead to the occurrence of CRC, including the mutation or alteration of expression of multiple genes, including proto-oncogenes and tumor suppressor genes. Whether the oncogenes controlling cell proliferation are highly expressed or the tumor suppressor genes are deleted or mutated, it can lead to the occurrence and development of CRC (2). However, the underlying molecular mechanism causing tumor initiation in CRC remains elusive.
Long non-coding RNAs (lncRNAs) are a class of non-protein coding transcripts >200 nucleotides in length (3). Evidence indicates that lncRNAs play critical roles in the cancer development by regulating the proliferation, metastasis, drug resistance, and apoptosis of cancer cells (4–7). The lncRNA taurine up-regulated gene 1 (TUG1) was originally identified as a transcript that is upregulated by taurine, which is highly conserved in mammals and was originally detected in a genomic screen in taurine-treated mouse retinal cells (8). Evidence has revealed that TUG1 is dysregulated in several cancer types (9), including bladder carcinoma (10–12), colon cancer (13,14), lung cancer (15), osteosarcoma (16), B-cell neoplasms (17) and esophageal squamous cell carcinoma (18). One recent study has demonstrated that, double-negative feedback loop between TUG1 and microRNA-145 (miR-145) promotes epithelial-to-mesenchymal transition and radioresistance in human bladder cancer cells (12). The present study aimed to investigate the biological role and clinical significance of TUG1 in the progression of CRC, providing targets for improving the therapeutic efficacy of CRC.
Materials and methods
Patient selection
The present study was a case-control pilot study developed at Nantong Hospital of Traditional Chinese Medicine (Nantong, China) with the analysis of 90 patients with CRC (38 female and 52 male cases; median age, 62 years old; age range, 48 to 79 years old), and 30 healthy donors (13 female and 17 male cases; median age, 61 years old; age range, 45 to 72 years old) were used as the control. Of the specimens, 63 were primary tumor (stage I and II) and 27 advanced tumor (stage III and IV) CRC. The protocols for tumor sample collection were approved by the Institutional Ethics Committee at Nantong Hospital of Traditional Chinese Medicine. Each patient provided written informed consent for inclusion in the present study.
Cell culture and lentivirus infection
SW620 and LoVo cell lines were purchased from the American Type Culture Collection (Manassas, VA, USA). SW620 cell lines were cultured in L-15 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and LoVo cell lines were cultured in F12K medium (Gibco; Thermo Fisher Scientific, Inc.). All mediums were supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin (Gibco; Thermo Fisher Scientific, Inc.) and 100 µg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.). All cells were cultured at 37°C in a humidified atmosphere containing 5% CO2. For the knockdown of TUG1, lentiviral vectors (2E+8 TU/ml) harboring TUG1 short hairpin RNAs (shRNAs) were constructed (Shanghai GeneChem Co., Ltd., Shanghai, China). The sequences were as follow: shRNA1, 5-GTCTGCATTGAGGATATAG-3; shRNA2, 5-GCCAAATAACTGAAGCTAT-3 and shRNA3, 5-GTACGTGTCTTGGAAGTCT-3. The negative targeted shRNA was a scrambled sequence: 5-CCTCTAGGTAAGCATAATTTT-3. Lentiviral particles were produced by co-transfecting the expression vector Lenti-KD-shRNA/TUG1 or Lenti-KD-shRNA/NT (Shanghai GeneChem Co., Ltd., Shanghai, China) with viral particle packaging helper vector into 293T cells using Lipofectamine 3000 (Thermo Fisher Scientific, Inc.). Human 293T cells (American Type Culture Collection) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 100 U/ml penicillin and 100 g/ml streptomycin at 37°C in a humidified atmosphere containing 5% CO2. The titers of the viral particles containing Lenti-KD-shRNA/TUG1 and Lenti-KD-shRNA/NT were determined by performing 10-fold serial dilutions in Eppendorf tubes for 8 consecutive dilutions. The dilution method was as follows: A total of 8 EP tubes (1.5 ml) were prepared for each lentivirus, and 90 µl L-15 medium was added to each tube. A total of 10 µl lentivirus stock solution was added to the first tube, mixed, and of this solution 10 µl was then pipetted into the second tube and mixed again, until a final dilution of 10×10−6. SW620 and LoVo cells were infected with the aforementioned packaged lentivirus. After 72 h, the efficiencies of knockdown were determined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR).
RT-qPCR
Total RNAs were extracted from cells using RNAiso Plus reagent (Takara Biotechnology Co., Ltd., Dalian, China). The cDNA was synthesized using PrimeScript™ RT reagent kit with gDNA Eraser kit (Takara Biotechnology Co., Ltd.). The mRNA level was determined using SYBR® Premix Ex Taq™ II (Takara Biotechnology Co., Ltd.) by ABI 7500 real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). GAPDH was used as an internal control. The thermocycling conditions used were as follows: 95°C for 5 min, followed by 40 two-step cycles (95°C for 20 sec and 60°C for 30 sec). Relative mRNA levels were calculated using the 2−ΔΔCq method (19). The sequences of primers are as follows: TUG1 forward, TAGCAGTTCCCCAATCCTTG and reverse, CACAAATTCCCATCATTCC; and GAPDH forward, CCACCCATGGCAAATTCCATGGCA and reverse, TCTAGACGGCAGGTCAGGTCCACC.
Cell proliferation and survival assays
Cell proliferation was determined using an MTT assay kit (cat no. C0009; Beyotime Institute of Biotechnology, Haimen, China) according to manufacturer's instructions. Once the cells were cultured for 24, 48, 72 and 96 h, MTT solution (0.5%, dissolved in dimethyl sulfoxide) was added into each well and the cells were incubated for another 4 h at 37°C, followed by absorbance detection. The absorbance in each well was measured using a microplate reader at a wavelength of 490 nm (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
Tumorigenesis assay
The animal experiments were performed in accordance with the guidelines by the U.S. National Institute of Health Guide for the Care and Use of Laboratory Animals (20). The protocol was approved by the Animal Care and Ethics Committee of Nantong Hospital of Traditional Chinese Medicine. Scramble shRNA, or TUG1 shRNA-infected SW620 or LoVo cells (~5×106) were injected subcutaneously in the female BALB/c nude mice (4–6 weeks old, ~20 g) obtained from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China) and maintained in pathogen-free conditions of temperature (22 ± 2°C), humidity (55 ± 5%) and a 12 h/12 h light-dark cycle with free access to food and water. The length (L) and width (W) of each tumor was measured with calipers and the volume was calculated using the equation: V=(L × W2) × 0.5 for 42 days after the injection of cancer cells. Mice were sacrificed after 42 days using cervical dislocation following CO2 inhalation.
Immunofluorescence and immunohistochemical staining
The subcutaneous transplantation tumor tissues or cells (SW620 and LoVo) were fixed with 4% paraformaldehyde for 20 min at room temperature, permeabilized by 0.1% Triton X-100 and washed with PBS three times followed by blocking with 10% normal goat serum plus 1% bovine serum albumin for 45 min at room temperature and incubated with rabbit anti-β-catenin (1:100; cat no. #9562; Cell Signaling Technology Inc., Danvers, MA, USA) at 4°C overnight. After washing three times with PBS, the tissue slices were further incubated with Cy3-conjugated goat anti-rabbit (cat no. A0516; Beyotime Institute of Biotechnology) or HRP-conjugated goat anti-rabbit secondary antibodies (cat no. A0208; Beyotime Institute of Biotechnology) for 1 h at 37°C. Subsequently, the slides were cover slipped with mounting medium (Dako; Agilent Technologies, Inc., Santa Clara, CA, USA) containing DAPI to counterstain the nuclei and imaged with a fluorescence or bright field microscope (at a magnification of ×100 for immunofluorescence or ×200 for immunohistochemical staining).
T-cell factor/lymphoid enhancer factor (TCF/LEF) promoter activity analysis
To test the LEF/TCF promoter activity, SW620 or LoVo cells were co-transfected with the recombinant plasmid pGL3-basic-LEF/TCF promoter with a control positive plasmid pRL-SV40, and the TCF/LEF promoter activity analysis was performed according to the protocol of Ji et al (21). The promoter activity was analyzed using a commercial dual-luciferase assay kit (Beyotime Institute of Biotechnology, China) according to the manufacturer's protocol.
Western blot analysis
The protein expression levels of β-catenin were analyzed with western blot. Following transfection, cells were harvested in Radioimmunoprecipitation Assay lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China) supplemented with protease inhibitor cocktail (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). A total of 40 µg protein from each sample concentration determined using the BCA protein assay reagent kit (cat no. 23225; Pierce; Thermo Fisher Scientific, Inc.) and molecular weight determined by the Prestained Protein Molecular Weight Marker (cat no. 26612; Fermentas; Thermo Fisher Scientific, Inc., Pittsburgh, PA, USA, β-catenin: 92kD, β-actin: 42kD] was resolved in 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane. Membranes were blocked with 5% non-fat dry milk in TBS-0.05% Tween-20 (TBST) buffer for 2 h at room temperature and incubated with primary antibodies rabbit anti-β-catenin (cat no. #9562; Cell Signaling Technology, Inc.) and rabbit anti-β-actin (cat no. #4970; Cell Signaling Technology, Inc.), each diluted to 1:1,000] at 4°C overnight. After washing 3 times with TBST buffer, the membranes were incubated HRP-conjugated goat anti-rabbit secondary antibody (1:5,000; cat no. A0516; Beyotime Institute of Biotechnology) for 1 h at room temperature. Next, the membranes were washed, developed using Millipore Western Blot chemiluminescence HRP substrate (cat no. WBKLS0010; Merck KGaA), and images were captured a using DMI3000B inverted microscope (Leica Microsystems GmbH, Wetzlar, Germany).
Statistical analysis
Data are presented as mean ± standard error of the mean of at least three independent experiments. Significance of the mean between two groups was determined using an unpaired Student's t-test. Differences at different time points between groups were evaluated using a one-way analysis of variance followed by a Dunnett's test. P<0.05 was considered to indicate a statistically significant difference. Analyses were performed using SPSS 20.0 software (IBM Corp., Armonk, NY, USA).
Results
Association between the TUG1 expression and clinicopathological characteristics in CRC
Significant upregulation of TUG1 expression was observed in CRC tissues compared with normal controls (Fig. 1A). Expression of TUG1 expression was significantly higher in stages III/IV than in stage I/II of CRC, indicating a positive association between the advanced stage of CRC and TUG1 expression (Fig. 1B). Correspondingly, the overall survival (OS) and disease-free survival (DFS) times were low in CRC patients with high TUG1 expression levels when compared with those expressing low levels of TUG1 (Fig. 1C and D). These results indicated that TUG1 might contribute to CRC development.
TUG1 increased the proliferation ability of CRC cells
To study the contribution of TUG1 to the proliferation of CRC, the expression of TUG1 was examined in the SW620 and LoVo cell lines. As depicted in Fig. 2A, the expression level of TUG1 was significant high in SW620 and LoVo cells in compared with other CRC cells. To assess the contribution of TUG1 to cellular proliferation, TUG1 expression levels were successfully knocked down in SW620 and LoVo cells (Fig. 2B), and it was found that the proliferation rate was significantly decreased in the two cell lines (Fig. 2C and D). These data indicated that TUG1 expression contributes to the proliferation of CRC cells.
TUG1 enhanced the activation of the Wnt/β-catenin signaling pathway
The Wnt/β-catenin signaling pathway is involved in the promotion of proliferation of CRC cells. To investigate the mechanism underlying the regulation by TUG1, the expression and location of β-catenin was examined in CRC cells treated with TUG1 shRNA by immunofluorescence staining. As shown in Fig. 3A and B, TUG1 shRNA significantly inhibited the expression of β-catenin protein in the nucleus of SW620 and LoVo cells. Furthermore, the western blot analysis also revealed that the levels of β-catenin were downregulated in the nuclear compartment when the CRC cells were treated with TUG1 shRNA (Fig. 3C and D). However, transfection with TUG1 shRNA did not affect the total expression of β-catenin (Fig. 3C and D). Accordingly, the TCF/LEF reporter assay also demonstrated that the Wnt/β-catenin signaling was significantly inhibited by TUG1 shRNA (Fig. 3E and F).
TUG1 promoted the tumorigenicity of CRC cells
To confirm the aforementioned effects of TUG1 on CRC cells in vivo, the effect of knockdown of TUG1 on the tumorigenicity of SW620 and LoVo cells was analyzed using the subcutaneous xenograft mouse model. As depicted in Fig. 4A and B, the size of tumors was greatly reduced at each time point in mice injected with CRC cells transfected with TUG1 shRNA. At day 42, the tumors were taken out and measured. The size and weight of tumors were significantly decreased by knockdown of TUG1 in SW620 and LoVo cells (Fig. 4C and D). These results indicated that TUG1 could promote the tumorigenicity of CRC cells.
TUG1 promoted the nuclear localization of β-catenin in patient tissues and the xenograft model
Since TUG1 could regulate the nuclear localization of β-catenin in CRC cells, β-catenin expression was examined in different stages of CRC patients. Consistent with the results of the aforementioned in vitro experiments, immunohistochemical staining revealed that β-catenin expression was higher in the nuclei of patients with stage III and IV CRC tumor tissues than that in stage I and II CRC patients (Fig. 5A and B).
Immunohistochemical staining and western blot analysis revealed that there was lower β-catenin expression in the nuclei from the excised tumors in mice generated by CRC cells transfected with TUG1 shRNA (Fig. 5C and D). These data indicated that TUG1 promotes the nuclear translocation of β-catenin in advanced CRC patients (stage III and IV) and in the in vivo mice model.
Discussion
CRC, as one of the most common malignant tumors in the world, is typically classified as cancer of the proximal colon, distal colon or rectum (1). A considerable number of patients with CRC are diagnosed at advanced stages and have a poor prognosis (1). The treatment modalities for CRC include surgical resection, chemotherapy, immunotherapy and other alternative methods such as traditional Chinese medicine (22). Numerous causes can bring about the occurrence of CRC, including the mutation or altered expression of proto-oncogenes and tumor suppressor genes. However, to the best of our knowledge, the underlying molecular mechanism leading to tumor initiation in CRC remains unclear.
Evidence has demonstrated that lncRNAs serve notable roles in different aspects of cancer biology and can contribute to the development of different cancer types (9). The lncRNA TUG1 was originally characterized as a transcript whose expression was upregulated by taurine, and was later observed to be overexpressed in a number of cancer tissues, including bladder carcinoma (10–12), colon cancer (13,14), lung cancer (15), osteosarcoma (16), B-cell neoplasms (17), and esophageal squamous cell carcinoma (18). Tan et al (12) demonstrated that TUG1 promoted bladder cancer cell metastasis and radioresistance via negatively regulating miR-145 expression by acting as a miRNA sponge. In esophageal carcinoma, TUG1 promoted proliferation and migration in vitro (18–22). Gezer et al (23), found that TUG1 were highly enriched in secreted exosomes of HeLa and MCF-7 cells. These data indicated that TUG1 might promote cancer progression. Nevertheless, the function and mechanism of TUG1 in CRC remain unknown. The present study demonstrated that the expression of TUG1 was upregulated in the tumor tissues of advanced-stage patients with CRC, and was positively associated with the mortality of CRC patients. In addition, high TUG1 expression was also detected in several CRC cells, including SW620 and LoVo cells. Together, these data indicated that TUG1 might serve notable roles in the development of CRC, although the detailed mechanism was unclear.
β-catenin, as the key transcriptional activation factor of the Wnt/β-catenin signal pathway, can, when activated, translocate to the nucleus from the cytoplasm in coordination with other transcription factors, including TCF, LEF, Pygo, and B-cell CLL/lymphoma 9 to activate its target genes, including cyclin D1, c-Myc, cluster of differentiation 44, and matrix metalloproteinase-7 (MMP-7), which serve notable roles in the initiation and development of tumors (24–27). The current study demonstrated that the shRNA-mediated knockdown of TUG1 evidently reduced the proliferation abilities of CRC cells. Knockdown of TUG1 inhibited the translocation of β-catenin from the cytoplasm to the nucleus, resulting in decreases in the expression of c-Myc and MMP-7, whereas overexpression of TUG1 brought about the contrary. The TCF/LEF family is a group of transcription factors that is involved in the Wnt/β-catenin signaling pathway, which bind to DNA through a high-mobility group domain and recruit the co-activator β-catenin to enhancer elements of target genes (28). By using LEF/TCF promoter dual-luciferase reporter construct, it was demonstrated that knockdown of TUG1 downregulated the promoter activity of LEF/TCF, whereas it was enhanced by overexpression of TUG1. Together, these results indicated that, TUG1 might promote the proliferation of CRC cells by regulating the Wnt/β-catenin signaling and downstream gene expression.
The in vivo results presented in the current study also indicated that silence of TUG1 could inhibit the CRC tumor growth in the subcutaneously transplanted tumor model, and lower nuclear β-catenin expression was detected in the excised tumors generated by TUG1 shRNA cells. Furthermore, β-catenin was also found to be overexpressed in the nuclei of tumor tissues from patients with advanced (stage III and IV) CRC compared with that of stage I and II CRC patients. The results of the present study corresponded with previous studies into CRC (29,30). The aforementioned data indicated that TUG1 serves a notable in an in vivo mouse model, in vitro and in advanced CRC patients.
In conclusion, the results of the present study revealed that TUG1 altered the nuclear localization of β-catenin, resulting in lowered Wnt/β-catenin signaling and the eventual inhibition of proliferation. These results indicated that prevention and treatment of CRC could be performed by targeting the TUG1 and Wnt/β-Catenin signaling pathway.
Acknowledgements
Not applicable.
Funding
No funding was received.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Authors' contributions
JFY was responsible for the study design and the acquisition of data, CYG performed data analysis, CHX and HZY performed the functional experiments. ZMW and HYC assisted in designing the experiments and interpret the data. WBL and JFY performed project design and manuscript revisions.
Ethics approval and consent to participate
The protocols for tumor sample collection were approved by the Institutional Ethics Committee at Nantong Hospital of Traditional Chinese Medicine. Each patient provided written informed consent for inclusion in the present study.
Patient consent for publication
All the patients provided consent for publication.
Competing interests
The authors declare that they have no competing interests.
References
Siegel RL, Miller KD and Jemal A: Cancer statistics, 2017. CA Cancer J Clin. 67:7–30. 2017. View Article : Google Scholar : PubMed/NCBI | |
Watson AJ and Collins PD: Colon cancer: A civilization disorder. Dig Dis. 29:222–228. 2011. View Article : Google Scholar : PubMed/NCBI | |
Wilusz JE: Long noncoding RNAs: Re-writing dogmas of RNA processing and stability. Biochim Biophys Acta. 1859:128–138. 2015. View Article : Google Scholar : PubMed/NCBI | |
Sun M, Nie F, Wang Y, Zhang Z, Hou J, He D, Xie M, Xu L, De W, Wang Z and Wang J: LncRNA HOXA11-AS Promotes Proliferation and Invasion of Gastric Cancer by Scaffolding the Chromatin Modification Factors PRC2, LSD1, and DNMT1. Cancer Res. 76:1–6310. 2016. View Article : Google Scholar | |
Okugawa Y, Toiyama Y, Hur K, Toden S, Saigusa S, Tanaka K, Inoue Y, Mohri Y, Kusunoki M, Boland CR and Goel A: Metastasis-associated long non-coding RNA drives gastric cancer development and promotes peritoneal metastasis. Carcinogenesis. 35:1–2739. 2014. View Article : Google Scholar | |
Xia H and Hui KM: Mechanism of cancer drug resistance and the involvement of noncoding RNAs. Curr Med Chem. 21:3029–3041. 2014. View Article : Google Scholar : PubMed/NCBI | |
Luo HL, Huang MD, Guo JN, Fan RH, Xia XT, He JD and Chen XF: AFAP1-AS1 is upregulated and promotes esophageal squamous cell carcinoma cell proliferation and inhibits cell apoptosis. Cancer Med. 5:1–2885. 2016. View Article : Google Scholar | |
Xue M, Chen W and Li X: Urothelial cancer associated 1: A long noncoding RNA with a crucial role in cancer. J Cancer Res Clin Oncol. 142:1407–1419. 2015. View Article : Google Scholar : PubMed/NCBI | |
Young TL, Matsuda T and Cepko CL: The noncoding RNA taurine upregulated gene 1 is required for differentiation of the murine retina. Curr Biol. 15:1–512. 2005. View Article : Google Scholar : PubMed/NCBI | |
Wang XS, Zhang Z, Wang HC, Cai JL, Xu QW, Li MQ, Chen YC, Qian XP, Lu TJ, Yu LZ, et al: Rapid identification of TUG1 as a very sensitive and specific unique marker for human bladder carcinoma. Clin Cancer Res. 12:4851–4858. 2006. View Article : Google Scholar : PubMed/NCBI | |
Fan Y, Shen B, Tan M, Mu X, Qin Y, Zhang F and Liu Y: Long non-coding RNA TUG1 increases chemoresistance of bladder cancer cells by regulating Wnt signaling. FEBS J. 281:1750–1758. 2014. View Article : Google Scholar : PubMed/NCBI | |
Tan J, Qiu K, Li M and Liang Y: Double-negative feedback loop between long non-coding RNA TUG1 and miR-145 promotes epithelial to mesenchymal transition and radioresistance in human bladder cancer cells. FEBS Lett. 589:3175–3181. 2015. View Article : Google Scholar : PubMed/NCBI | |
Tuo YL, Li XM and Luo J: Long noncoding RNA TUG1 modulates colorectal cancer cell growth and apoptosis through decreasing tumor suppressive miR-143. Eur Rev Med Pharmacol Sci. 19:3403–3411. 2015.PubMed/NCBI | |
Huang J, Zhou N, Watabe K, Lu Z, Wu F, Xu M and Mo YY: Long non-coding RNA TUG1 promotes colorectal tumor growth by suppression of p27 (Kip1). Cell Death Dis. 5:e10082014. View Article : Google Scholar : PubMed/NCBI | |
Zhang EB, Yin DD, Sun M, Kong R, Liu XH, You LH, Han L, Xia R, Wang KM, Yang JS, et al: P53-regulated long non-coding RNA TUG1 affects cell proliferation in human non-small cell lung cancer, partly through epigenetically regulating HOXB7 expression. Cell Death Dis. 5:e12432014. View Article : Google Scholar : PubMed/NCBI | |
Zhang Q, Geng PL, Yin P, Wang XL, Jia JP and Yao J: Down-regulation of long non-coding RNA TUG1 inhibits osteosarcoma cell proliferation and promotes apoptosis. Asian Pac J Cancer Prev. 14:1–2315. 2013.PubMed/NCBI | |
Isin M, Ozgur E, Cetin G, Erten N, Aktan M, Gezer U and Dalay N: Investigation of circulating lncRNAs in B-cell neoplasms. Clin Chim Acta. 431:1–259. 2014. View Article : Google Scholar : PubMed/NCBI | |
Xu Y, Wang J, Qiu M and Xu L, Li M, Jiang F, Yin R and Xu L: Upregulation of the long noncoding RNA TUG1 promotes proliferation and migration of esophageal squamous cell carcinoma. Tumour Biol. 36:1–1651. 2015. | |
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:1–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals, . Guide for the Care and Use of Laboratory Animals. 8th. Washington, DC: National Academies Press (US); 2011, PubMed/NCBI | |
Ji Q, Liu X, Fu X, Zhang L, Sui H, Zhou L, Sun J, Cai J, Qin J, Ren J and Li Q: Resveratrol Inhibits invasion and metastasis of colorectal cancer cells via MALAT1 mediated Wnt/β-catenin signal pathway. PLoS One. 8:e787002013. View Article : Google Scholar : PubMed/NCBI | |
Venook AP: Advances in Adjuvant Therapy for Colon Cancer: P value or Practical Value. J Clin Oncol. 36:1–1462. 2018. View Article : Google Scholar : PubMed/NCBI | |
Gezer U, Ozgur E, Cetinkaya M, Isin M and Dalay N: Long noncoding RNAs with low expression levels in cells are enriched in secreted exosomes. Cell Biol Int. 38:1–1079. 2014.PubMed/NCBI | |
Li ZR, Wu YF, Ma CY, Nie SD, Mao XH and Shi YZ: Down-regulation of c-Myc expression inhibits the invasion of bile duct carcinoma cells. Cell Biol Int. 35:799–802. 2011. View Article : Google Scholar : PubMed/NCBI | |
Zhang J, Gill AJ, Issacs JD, Atmore B, Johns A, Delbridge LW, Lai R and McMullen TP: The Wnt/β-catenin pathway drives increased cyclin D1 levels in lymph node metastasis in papillary thyroid cancer. Hum Pathol. 43:1044–1050. 2012. View Article : Google Scholar : PubMed/NCBI | |
Villar J, Cabrera NE, Valladares F, Casula M, Flores C, Blanch L, Quilez ME, Santana-Rodríguez N, Kacmarek RM and Slutsky AS: Activation of the Wnt/β-Catenin signaling pathway by mechanical ventilation is associated with ventilator-induced pulmonary fibrosis in healthy lungs. PLoS One. 6:e239142011. View Article : Google Scholar : PubMed/NCBI | |
Zeilstra J, Joosten SP, Dokter M, Verwiel E, Spaargaren M and Pals ST: Deletion of the WNT target and cancer stem cell marker CD44 in Apc(Min/+) mice attenuates intestinal tumorigenesis. Cancer Res. 68:3655–3661. 2008. View Article : Google Scholar : PubMed/NCBI | |
Brantjes H, Barker N, van Es J and Clevers H: TCF: Lady Justice casting the final verdict on the outcome of Wnt signalling. Biol Chem. 383:1–261. 2002. View Article : Google Scholar : PubMed/NCBI | |
Brabletz T, Jung A, Reu S, Porzner M, Hlubek F, Kunz-Schughart LA, Knuechel R and Kirchner T: Variable betacatenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci USA. 98:1–10361. 2001. View Article : Google Scholar : PubMed/NCBI | |
Hlubek F, Brabletz T, Budczies J, Pfeiffer S, Jung A and Kirchner T: Heterogeneous expression of Wnt/beta-catenin target genes within colorectal cancer. Int J Cancer. 121:1–1948. 2007. View Article : Google Scholar : PubMed/NCBI |