Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
October-2019 Volume 18 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2019 Volume 18 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Dysregulation of the miRNA biogenesis components DICER1, DROSHA, DGCR8 and AGO2 in clear cell renal cell carcinoma in both a Korean cohort and the cancer genome atlas kidney clear cell carcinoma cohort

  • Authors:
    • Sang Su Lee
    • Hyeonji Min
    • Ji Yong Ha
    • Byung Hoon Kim
    • Mi Sun Choi
    • Shin Kim
  • View Affiliations / Copyright

    Affiliations: Department of Internal Medicine, Dongsan Medical Center, Keimyung University, Jung‑gu, Daegu 41931, Republic of Korea, Department of Immunology, School of Medicine, Keimyung University, Dalseo‑gu, Daegu 42601, Republic of Korea, Department of Urology, Dongsan Medical Center, Keimyung University, Jung‑gu, Daegu 41931, Republic of Korea, Department of Pathology, School of Medicine, Keimyung University, Dalseo‑gu, Daegu 42601, Republic of Korea
  • Pages: 4337-4345
    |
    Published online on: August 16, 2019
       https://doi.org/10.3892/ol.2019.10759
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Impairment of microRNA (miRNA) biogenesis may be involved in clear cell renal cell carcinoma (ccRCC). The objective of the present study was to investigate the mRNA levels of important miRNA machinery components, DICER1, DROSHA, DiGeroge syndrome critical region gene 8 (DGCR8), and Argonaute 2 (AGO2), and their correlations with clinicopathological characteristics of ccRCC using mRNA expression data from The Cancer Genome Atlas kidney clear cell carcinoma (TCGA KIRC) cohort and a Korean ccRCC cohort. mRNA levels of DICER1, DROSHA, and DGCR8 were significantly decreased in both cohorts. However, AGO2 was significantly downregulated only in the Korean ccRCC cohort. Additionally, positive correlations were observed between the altered mRNA levels of DICER1 and DROSHA as well as DROSHA and DGCR8 in both cohorts. In the TCGA KIRC cohort, alterations in the mRNA levels of DICER1 were significantly correlated with histological grade. Furthermore, the altered mRNA levels of DGCR8 showed significant associations with sex and histologic grades. However, in the Korean ccRCC cohort, no factors were significantly associated with any clinicopathological parameters, including sex, age, T stage, Fuhrman grade/The International Society of Urological Pathology grade, lymphovascular invasion, and peri‑renal fat invasion. Taken together, these findings indicate that DICER1, DROSHA, DGCR8 and AGO2 are significantly dysregulated in ccRCC, suggesting that they are important in the pathophysiology of this malignancy.

Introduction

Renal cell carcinoma (RCC), which originates from renal parenchyma, is the most common malignant kidney tumor in adults (87% of all renal malignancies) (1). An estimated 65,340 new cases of kidney and renal pelvis cancers will be diagnosed in the US in 2018 (42,680 in men and 22,660 in women), of which 14,970 will be fatal (2). Among the World Health Organization histological RCC subtypes, clear cell RCC (ccRCC) is the most common subtype (80–90%) (3). Because of the high aggressiveness of ccRCC, approximately 30% of patients show metastasis at the time of diagnosis, and the prognosis is typically very poor (4). Thus, studies of the underlying molecular characteristics of ccRCC are necessary to develop new biomarkers and therapeutic strategies.

MicroRNAs (miRNAs), which are short non-coding RNA molecules, regulate gene expression by cleaving transcribed target mRNAs and/or repressing protein translation. miRNA biogenesis is a well-organized process, involving ‘miRNA machinery’ (5) and is regulated by various miRNA biogenesis components including the RNase III endonuclease DROSHA (RNASEN), a double-stranded RNA binding protein known as DiGeroge syndrome critical region gene 8 (DGCR8), the RNase III ribonuclease DICER, and a component of the RNA-induced silencing complex known as Argonaute 2 (AGO2) (6). Accumulating evidence reveals that dysregulated miRNA biogenesis components have pathophysiological importance in various human cancers (7–11). Furthermore, Dicer has been reported to be down-regulated in and to suppress the malignant phenotype of ccRCC (12,13). Interestingly, significant associations were observed between haplotypes/diplotypes of the DROSHA SNPs (rs6877842 and rs10719) and ccRCC recurrence (14). However, there is still very little published study on the mRNA levels of other miRNA biogenesis components, such as DROSHA, DGCR8, and AGO2, and their clinicopathological associations in ccRCC.

In the present study, we investigated the mRNA levels of four important miRNA biogenesis components using mRNA expression data from The Cancer Genome Atlas (TCGA) KIRC cohorts and a Korean ccRCC dataset and evaluated the clinical relevance of the altered expression in both cohorts.

Materials and methods

Gene expression databases and cluster analysis

The gene expression RNA-Seq dataset (level 3) and clinical data for TCGA Kidney Clear Cell Carcinoma (TCGA KIRC) cohort were downloaded from the UCSC Xena database (xena.ucsc.edu, dataset ID is TCGA.KIRC.sampleMap/HiSeqV2). Nearly all data (496 patients) in TCGA KIRC cohort were described in detail previously (15). The four miRNA component genes present in TCGA KIRC cohort were DICER1, DROSHA (RNASEN), DGCR8, and AGO2 (EIF2C2). Comprehensive genetic information was available for 537 patients with ccRCC in TCGA KIRC cohort. Among the total data, we selected 72 paired data sets with mRNA level data for analysis of miRNA biogenesis-related genes (6) and the four miRNA biogenesis components in ccRCC tissues and adjacent non-neoplastic surround tissues (ST) from patients with ccRCC. Clinicopathological parameters of TCGA KIRC was downloaded from the UCSC Xena database (xena.ucsc.edu, dataset ID is TCGA.KIRC.sampleMap/KIRC_clinicalMatrix). This study meets the publication guidelines provided by TCGA. Cluster analysis was performed using Cluster 3.0 to classify the samples into statistically similar groups, and the resulting heatmaps were visualized in TreeView 1.6 (www.eisenlab.org/eisen).

Patients and tissues

Fifty-three patients diagnosed with ccRCC were included in this retrospective study. ccRCC tissues and adjacent non-neoplastic tissues were obtained from patients undergoing surgery in Dongsan Medical Center (Daegu, Korea) between April 2008 and November 2013. The clinicopathological characteristics and oncological outcome data were retrospectively collected from the Colorectal Cancer Database in the Department of Colorectal Cancer Surgery, Dongsan Medical Center (Daegu, Korea) and the Pathological Diagnosis Database in the Department of Pathology, Dongsan Medical Center (Daegu, Korea), respectively. Enrolled patients with ccRCC were classified according to the American Joint Committee on Cancer Tumor-Node-Metastasis (TNM) staging criteria (16). After surgery, tissue samples were immediately frozen in liquid nitrogen and stored at −196°C until RNA isolation. Tissue samples were provided by the Keimyung Human Bio-resource Bank, Korea.

RNA isolation and reverse transcription-quantitative (RT-q) PCR

Total cellular RNA was extracted from tissues using TRIzol reagent (Molecular Research Center, Inc., Cincinnati, OH, USA). RNAs were quantified using a NanoDrop 1000 (Thermo Scientific, Waltham, MA, USA). Each cDNA was synthesized from 1 µg of total RNA using Moloney murine leukemia virus reverse transcriptase (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocol. Using the specific primer pairs shown in Table I and SYBR Green Premix (Toyobo, Japan), qPCR was performed on a LightCycler® 480 real-time PCR system (Roche Diagnostics GmbH, Mannheim, Germany). The following thermocycling conditions were maintained: Pre-incubation, 5 min at 95°C; amplification, 45 cycles with 10 sec at 95°C, 10 sec at 55°C, and 15 sec at 72°C; melting curve, gradually from 65°C to 95°C; cooling, 10 min at 37°C. β-Actin was used as a housekeeping gene for normalization, and a no-template sample was used as a negative control. qPCR data were analyzed using the 2−∆∆Cq method (17) in Microsoft Excel (Microsoft Corporation, Redmond, WA., USA). Three replicates were evaluated and showed similar results.

Table I.

Primer sequences of microRNA machinery components used in quantitative PCR.

Table I.

Primer sequences of microRNA machinery components used in quantitative PCR.

PrimerSequence (5′-3′)
DICER1
  Forward TTAACCTTTTGGTGTTTGATGAGTGT
  Reverse AGGACATGATGGACAATT
DROSHA
  Forward CTGTCGATGCACCAGATT
  Reverse TGCATAACTCAACTGTGCAGG
DGCR8
  Forward CAAGCAGGAGACATCGGACAAG
  Reverse CACAATGGACATCTTGGGCTTC
AGO2
  Forward TCATGGTCAAAGATGAGATGACAGA
  Reverse TTTATTCCTGCCCCCGTAGA
β-actin
  Forward CAGCCATGTACGTTGCTATCCAGG
  Reverse AGGTCCAGACGCAGGATGGCATG

[i] DGCR8, DiGeroge syndrome critical region gene 8; AGO2, Argonaute 2.

Statistical analysis

Statistical analysis was performed with SPSS software (version 22.0; IBM SPSS, Armonk, NY, USA). Differences between groups were statistically analyzed by using paired t-test. Co-expression of mRNA levels of various miRNA biogenesis components in TCGA KIRC cohort was searched using cBioPortal (cbioportal.org). The association between inter-individual mRNA levels of miRNA biogenesis components in Korean ccRCC was assessed using the Pearson's correlation coefficient analysis for continuous variables. Clinicopathological associations with the mRNA levels of various miRNA biogenesis components in both TCGA KIRC cohort and Korean ccRCC were analyzed using the linear-by-linear association model, Pearson's Chi-square test, and Fisher's exact test for categorical variables. The mean value was used as a cut-off value (low and high) for categorical variables. P<0.05 was considered to indicate a statistically significant difference.

Results

Altered expression levels of miRNA biogenesis-related genes in TCGA KIRC cohorts

To investigate whether the miRNA biogenesis-related genes (6) are dysregulated in ccRCC tissues, we re-analyzed the sorted mRNA expression values from raw data of TCGA KIRC cohort using paired t-test. Hierarchical clustering showed that various miRNA biogenesis-related genes were dysregulated in carcinomatous tissues compared with ST of patients with ccRCC (Fig. 1). To evaluate the significance of altered mRNA levels between ccRCC and ST, paired t-test was performed. Hierarchical clustering revealed that various miRNA biogenesis-related genes were significantly dysregulated in ccRCC tissues compared with ST of the 72 patients with ccRCC (P<0.05; Fig. 2A). Among the various miRNA biogenesis-related genes, AGO1 was significantly upregulated in ccRCC tissues of TCGA KIRC cohort, while DICER1, DROSHA, DGCR8, trinucleotide repeat containing 6B (TNRC6B), trinucleotide repeat containing 6C (TNRC6C), and AGO3 were significantly downregulated (paired t-test, P<0.05; Fig. 2B).

Figure 1.

Heat map presenting the mRNA expression of the miRNA biogenesis-related genes in the TCGA KIRC cohort. The data are presented in matrix format in which each row represents an individual gene and each column represents a single tissue. Each cell in the matrix represents the expression level of a gene feature in an individual tissue. Expression levels have been standardized (centered and scaled) within columns for visualization. The red and green colors in cells reflect relative high and low expression levels, respectively, as indicated in the scale bar. Images were obtained by re-analysis of the raw data of the TCGA KIRC cohort. ccRCC tissues were ordered from STs to ccRCC tissues according to the standardized expression level of each gene as indicated. TCGA KIRC, The Cancer Genome Atlas kidney clear cell carcinoma; ccRCC, clear cell renal cell carcinoma; ST, adjacent non-neoplastic surround tissues.

Figure 2.

(A) Heat map presenting significantly differential mRNA expression of the miRNA biogenesis-related genes in ccRCC tissues compared with the ST of TCGA KIRC cohort. The data are presented in matrix format in which each row represents an individual gene and each column represents a single tissue. Each cell in the matrix represents the expression level of a gene feature in an individual tissue. Expression levels have been standardized (centered and scaled) within columns for visualization. The red and green colors in cells reflect relative high and low expression levels, respectively, as indicated in the scale bar. Images were obtained by re-analysis of the raw data of the TCGA KIRC cohort. ccRCC tissues were ordered from STs to ccRCC tissues according to the standardized expression level of each gene as indicated. *P<0.05 (ST vs. ccRCC). (B) Relative mRNA levels of various miRNA biogenesis-related genes in ccRCC tissues and their corresponding ST. *P<0.001, **P=0.029 and ***P=0.002, as indicated. TCGA KIRC, The Cancer Genome Atlas kidney clear cell carcinoma; ccRCC, clear cell renal cell carcinoma; ST, adjacent non-neoplastic surround tissues.

Altered mRNA levels of four important miRNA biogenesis components, DICER1, DROSHA, DGCR8, and AGO2, in the Korean ccRCC cohort

To investigate whether DICER1, DROSHA, DGCR8, and/or AGO2 were dysregulated in the Korean ccRCC cohort, we measured the mRNA levels of the four miRNA biogenesis components by qPCR in 53-paired ccRCC and ST specimens from the Korean cohort. After excluding unqualified qPCR results, we analyzed the data. The mRNA levels of all four components were significantly downregulated in ccRCC tissues compared with the corresponding ST (paired t-test, DICER1: P<0.001; DROSHA: P<0.001; DGCR8: P<0.001; AGO2: P<0.001; Fig. 3).

Figure 3.

Relative mRNA levels of various microRNA biogenesis-related genes in ccRCC tissues and their corresponding ST of the Korean ccRCC cohort. *P<0.001, as indicated. ccRCC, clear cell renal cell carcinoma; ST, adjacent non-neoplastic surround tissues; DGCR8, DiGeroge syndrome critical region gene 8; AGO2, Argonaute 2.

Correlations between inter-individual mRNA levels of miRNA biogenesis components in the two cohorts

To evaluate the associations between the mRNA levels of each miRNA biogenesis component in ccRCC specimens, Pearson's correlation coefficient analysis was performed in both TCGA KIRC cohort and the Korean ccRCC cohort. Prior to statistical analysis, significantly altered mRNA levels of miRNA biogenesis components were sorted from both cohorts (Table II). We found significant correlations between the mRNA levels of specific miRNA biogenesis components in both cohorts (Table II). Notably, significant correlations were observed not only between the mRNA levels of DICER1 and DROSHA, but also between those of DROSHA and DGCR8 in both cohorts (Fig. 4; Table II).

Figure 4.

Correlation between inter-individual mRNA levels of microRNA biogenesis components in TCGA KIRC cohort and the Korean ccRCC cohort. DICER1 and RNASEN (DROSHA) and DGCR8 and RNASEN (DROSHA) in (A) TCGA KIRC cohort and the (B) Korean ccRCC cohort. TCGA KIRC, The Cancer Genome Atlas kidney clear cell carcinoma; ccRCC, clear cell renal cell carcinoma; ST, adjacent non-neoplastic surround tissues; DGCR8, DiGeroge syndrome critical region gene 8; RNASEN (DROSHA), RNase III endonuclease DROSHA.

Table II.

Pearson's correlation analysis between individual components of microRNA biogenesis.

Table II.

Pearson's correlation analysis between individual components of microRNA biogenesis.

A, TCGA KIRC cohort

Correlations between componentsPearson's correlation coefficient valueP-value
DICER1 and DROSHA0.3110.008
DICER1 and AGO10.2650.024
DICER1 and TNRC6B0.609<0.001
DICER1 and TNRC6C0.452<0.001
DICER1 and AGO30.543<0.001
DROSHA and DGCR80.3640.002
DROSHA and AGO10.2580.029
DROSHA and TNRC6B0.599<0.001
DROSHA and TNRC6C0.3160.007
DROSHA and AGO30.2670.023
DGCR8 and TNRC6B0.3500.003
DGCR8 and TNRC6C0.3360.004
AGO1 and TNRC6B0.2700.022
AGO1 and AGO30.529<0.001
TNRC6B and TNRC6C0.558<0.001
TNRC6B and AGO30.3650.002
DICER1 and DGCR80.1680.157
DGCR8 and AGO10.0950.428
DGCR8 and AGO30.0650.587
AGO1 and TNRC6C0.1620.175
TNRC6C and AGO30.0250.836

B, Korean ccRCC cohort

Correlations between componentsPearson's correlation coefficient valueP-value

DICER1 and DROSHA0.877<0.001
DICER1 and DGCR80.954<0.001
DICER1 and AGO20.774<0.001
DROSHA and DGCR80.840<0.001
DROSHA and AGO20.641<0.001
DGCR8 and AGO20.837<0.001

[i] TCGA KIRC, The Cancer Genome Atlas kidney clear cell carcinoma; ccRCC, clear cell renal cell carcinoma; DGCR8, DiGeroge syndrome critical region gene 8; TNR, trinucleotide repeat containing.

Relationship between mRNA levels of the four miRNA biogenesis components and their clinicopathological parameters in both cohorts

To investigate the clinicopathological effects of altered mRNA levels of the selected four miRNA biogenesis components in both cohorts, the correlations between mRNA levels of the miRNA biogenesis components and clinicopathological parameters were statistically evaluated. For TCGA KIRC cohort, downloaded data were processed as the ccRCC to ST ratio. Seventy-two patients with ccRCC, whose clinicopathological data were available, were classified according to each clinicopathological characteristic (Table III). Statistical analysis of the TCGA KIRC cohort data revealed that mRNA levels of DICER1 and DGCR8 were significantly associated with histologic grade, respectively (P=0.025, P=0.044; Table III). Moreover, the mRNA levels of DGCR8 were significantly associated with sex (P=0.024; Table III). Prior to statistical analysis of the Korean ccRCC cohort, raw qPCR data were processed using the 2−∆∆Cq method (17). Fifty-three patients with ccRCC were classified according to each clinicopathological parameter (Table IV). Altered mRNA levels of the analyzed components were not significantly associated with any clinical parameters, including sex, age, T stage, Fuhrman grade/The International Society of Urological Pathology (ISUP) grade, lymphovascular invasion, and peri-renal fat invasion (Table IV).

Table III.

DICER1, DROSHA and DGCR8 mRNA expression levels in relation to clinicopathological parameters of TCGA KIRC.

Table III.

DICER1, DROSHA and DGCR8 mRNA expression levels in relation to clinicopathological parameters of TCGA KIRC.

DICER1DROSHADGCR8



ParametersLowHighP-valueLowHighP-valueLowHighP-value
Sex 0.293a 0.836a 0.024a
  Male2824 3022 3121
  Female812 119 614
Age, years 0.477b 0.640a 0.057b
  <602218 2118 2515
  ≥601418 1913 1220
T stage 0.803c 0.916c 0.983c
  1a,1b1314 1611 1314
  295 77 95
  3a,3b1316 1712 1415
  411 11 11
M stage 0.181a 0.524a 0.683a
  No metastasis2429 2924 2825
  Metastasis127 127 910
Pathologic stage 0.682a 0.570a 0.754a
  Stage I1114 1213 1114
  Stage II65 83 65
  Stage III79 97 88
  Stage IV128 128 128
Histologic grade 0.025c 0.169c 0.044c
  G101 10 01
  G21018 1216 1018
  G31612 1810 1810
  G4105 105 96

a Pearson's chi-square test

b Fisher's Exact test

c Linear by linear association.

Table IV.

DICER1, DROSHA, DGCR8, and AGO2 mRNA expression levels in relation to clinicopathological parameters of Korean clear cell renal cell carcinoma.

Table IV.

DICER1, DROSHA, DGCR8, and AGO2 mRNA expression levels in relation to clinicopathological parameters of Korean clear cell renal cell carcinoma.

DICER1DROSHADGCR8AGO2




ParametersLowHighP-valueLowHighP-valueLowHighP-valueLowHighP-value
Sex 0.560a 0.077b 0.810a 0.728b
  Male207 1512 207 216
  Female215 215 206 224
Age, years 0.941a 0.168a 0.379a 0.293b
  <60216 1611 198 207
  ≥60206 206 215 233
T stage 0.589c 0.878c 0.342c 0.677c
  1A,1B226 1810 226 235
  2A,2B71 71 71 71
  3A,3B125 116 116 134
Fuhrman grade/ISUP grade 0.250c 0.280c 0.105c 0.305c
  120 11 20 20
  2161 1512 161 161
  31510 1411 1510 178
  481 63 72 81
Lymphovascular invasion 0.183b 0.667b 0.053b 0.604b
  (−)379 3214 379 388
  (+)43 43 34 52
Peri-renal fat invasion 0.423b 0.471b 1.000b 0.665b
  (−)3211 2815 3211 349
  (+)91 82 82 91

a Pearson's chi-square test

b Fisher's Exact test

c Linear by linear association. DGCR8, DiGeroge syndrome critical region gene 8; AGO2, Argonaute 2.

Discussion

Dysregulation of miRNA biogenesis components has been reported to be associated with carcinogenesis (18), cancer chemosensitivity (19), angiogenesis (13), metastasis (20), proliferation and migration (21), and the prognosis of patients with cancer (20,22) in various cancers, including ccRCC (12,13). Although the dysregulation and pathophysiological role of DICER1 in ccRCC has been investigated (12,13), studies of other miRNA biogenesis components, such as DROSHA, DGCR8, and AGO2 are needed. In the present study, we investigated the mRNA levels of miRNA biogenesis components and analyzed their clinicopathological relevance in the TCGA KIRC cohort and a Korean ccRCC cohort.

First, our hierarchical clustering results revealed considerable dysregulation of miRNA biogenesis-related genes in ccRCC tissues compared with ST from TCGA KIRC cohort. Among the dysregulated genes, DICER 1 was significantly downregulated in ccRCC tissues. Similarly, in our Korean ccRCC cohort, DICER 1 was significantly downregulated. These results are consistent with those of previous studies of ccRCC in which downregulated DICER1 mRNA levels were detected (12). Particularly, one study revealed that DICER1 was more downregulated in VHL-deficient (VHL mutation and methylation) ccRCCs compared with ST (13). Because nearly all samples (71 of 72 patients with ccRCC) were VHL-deficient (data not shown) in the dataset of 72 patients with ccRCC of TCGA KIRC cohort, we did not evaluate whether DICER1 mRNA levels were downregulated in VHL-deficient ccRCCs compared with wild-type VHL ccRCCs. Notably, we found for the first time that DROSHA and DGCR8 were significantly downregulated in the ccRCC tissues of both cohorts. On the other hand, AGO2 was only significantly downregulated in the Korean ccRCC cohort. Although we did not identify the exact cause underlying the downregulation of AGO2 in only the Korean ccRCC cohort, it is possible that racial differences between the two cohorts affected the AGO2 mRNA levels. These results demonstrate that the downregulated mRNA levels of DICER1, DROSHA, and DGCR8 are common in ccRCC samples and that downregulation of the three components is important in the pathophysiology of ccRCC.

Accumulating evidence indicates significant correlations between the inter-individual levels of miRNA biogenesis components in paired samples of cancer and ST: DGCR8 and AGO2 in colorectal cancer (23); DICER1 and DROSHA in triple negative breast cancer (24); and DICER1 and DROSHA, as well as DROSHA and DGCR8, in TCGA papillary thyroid carcinoma (25). Therefore, we investigated the correlation between the mRNA levels of the components in both cohorts. Our data revealed significant correlations between DICER1 and DROSHA as well as between DROSHA and DGCR8 in both cohorts.

Recent studies showed that aberrant regulation of miRNA biogenesis components is associated with specific clinicopathological parameters (10,26–29). For example, DICER1 mRNA levels were significantly correlated with overall TNM staging (12). Subsequent studies evaluated the clinicopathological implications of dysregulated miRNA biogenesis components in ccRCC. In contrast to a recent study (12), our results revealed that there was no significant correlation between the mRNA levels of any components and stages of T and M in TCGA KIRC cohort. Furthermore, DICER1 and DGCR8 mRNA levels were significantly correlated with histologic grade of ccRCC. However, we found no significant correlation between dysregulation of the miRNA biogenesis components and any clinicopathological parameters in the Korean ccRCC cohort, including sex, age, T stage, Fuhrman grade/ISUP grade (histologic grade), lymphovascular invasion, and peri-renal fat invasion. These differences between cohorts may be attributed to the small numbers of enrolled patients and racial differences. Because few studies have examined the clinicopathological implications of dysregulated the miRNA biogenesis components in ccRCC, further studies focusing on these issues in ccRCC are required.

Because RT-qPCR and RNA-Seq are different experimental assays utilizing different methodologies and show varying sensitivities, dynamic ranges of the results, and experimental principles, the results of the present study should be interpreted with caution. Nevertheless, we detected downregulation of DICER1, DROSHA, DGCR8, and AGO2 and significant correlations between DICER1 and DROSHA as well as between DROSHA and DGCR8 in ccRCC. Collectively, DICER1, DROSHA, DGCR8, and AGO2 were significantly downregulated and correlated with each other in ccRCC, suggesting that they serve important roles in the pathophysiology of ccRCC.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Research Foundation of Korea (grant funded by the Korea Government Ministry of Science, ICT and Future Planning; grant nos. 2017R1C1B5016670 and 2014R1A5A2010008).

Availability of data and materials

The datasets analyzed during the present study are available from The Cancer Genome Atlas (tcga-data.nci.nih.gov/tcga/tcgaDownload.jsp) and the UCSC Xena (xena.ucsc.edu). The datasets generated in the present study are available from the corresponding author upon reasonable request.

Authors' contributions

SSL and SK contributed to the conception and design of the study, analysis of the data, interpretation of the results, and the writing of the manuscript. HM and SK contributed to the acquisition of data. SSL, HM and SK performed the experiments. JYH, BHK and MSC contributed to the conception and design of the study, and assisted with the determination of the clinical implications of the study. SK reviewed and edited the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy and integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

The biospecimens for this retrospective study were provided by the Keimyung Human Bio-Resource Bank, a member of the National Biobank of Korea, which is supported by the Ministry of Health and Welfare. The experimental study was approved by the Institutional Review Board of Keimyung University and Dongsan Medical Center (approval no. 2015-10-021-004) and was performed in accordance with the principles of the Declaration of Helsinki. The requirement for written informed consent was waived due to the retrospective nature of the study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

ccRCC

clear cell renal cell carcinoma

miRNA

microRNA

TCGA KIRC

The Cancer Genome Atlas Kidney Clear Cell Carcinoma

qPCR

quantitative PCR

DGCR8

DiGeroge syndrome critical region gene 8

AGO2

Argonaute 2

ST

adjacent non-neoplastic surround tissues

References

1 

Bhatt JR and Finelli A: Landmarks in the diagnosis and treatment of renal cell carcinoma. Nat Rev Urol. 11:517–525. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2018. CA Cancer J Clin. 68:7–30. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Kovacs G, Akhtar M, Beckwith BJ, Bugert P, Cooper CS, Delahunt B, Eble JN, Fleming S, Ljungberg B, Medeiros LJ, et al: The Heidelberg classification of renal cell tumours. J Pathol. 183:131–133. 1997. View Article : Google Scholar : PubMed/NCBI

4 

Campbell D, Walker R, Mathew T and Craig J: Commentary on ‘Influence of industry on renal guideline development’. Clin J Am Soc Nephrol. 2:2112007. View Article : Google Scholar : PubMed/NCBI

5 

Papachristou DJ, Korpetinou A, Giannopoulou E, Antonacopoulou AG, Papadaki H, Grivas P, Scopa CD and Kalofonos HP: Expression of the ribonucleases Drosha, Dicer, and Ago2 in colorectal carcinomas. Virchows Arch. 459:431–440. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Mockenhaupt S, Schurmann N and Grimm D: When cellular networks run out of control: Global dysregulation of the RNAi machinery in human pathology and therapy. Prog Mol Biol Transl Sci. 102:165–242. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Kim S, Song ML, Min H, Hwang I, Baek SK, Kwon TK and Park JW: miRNA biogenesis-associated RNase III nucleases Drosha and Dicer are upregulated in colorectal adenocarcinoma. Oncol Lett. 14:4379–4383. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Lin S and Gregory RI: MicroRNA biogenesis pathways in cancer. Nat Rev Cancer. 15:321–333. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Hata A and Kashima R: Dysregulation of microRNA biogenesis machinery in cancer. Crit Rev Biochem Mol Biol. 51:121–134. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Tchernitsa O, Kasajima A, Schäfer R, Kuban RJ, Ungethüm U, Györffy B, Neumann U, Simon E, Weichert W, Ebert MP and Röcken C: Systematic evaluation of the miRNA-ome and its downstream effects on mRNA expression identifies gastric cancer progression. J Pathol. 222:310–319. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Shaikhibrahim Z, Lindstrot A, Ochsenfahrt J, Fuchs K and Wernert N: Epigenetics-related genes in prostate cancer: Expression profile in prostate cancer tissues, androgen-sensitive and -insensitive cell lines. Int J Mol Med. 31:21–25. 2013.PubMed/NCBI

12 

Ma X, Fan Y, Gao Y, Zhang Y, Huang Q, Ai Q, Ni D, Chen W, Zhang P, Song E, et al: Dicer is down-regulated in clear cell renal cell carcinoma and in vitro Dicer knockdown enhances malignant phenotype transformation. Urol Oncol. 32:46.e9–e17. 2014. View Article : Google Scholar

13 

Fan Y, Li H, Ma X, Gao Y, Bao X, Du Q, Ma M, Liu K, Yao Y, Huang Q, et al: Dicer suppresses the malignant phenotype in VHL-deficient clear cell renal cell carcinoma by inhibiting HIF-2α. Oncotarget. 7:18280–18294. 2016.PubMed/NCBI

14 

Lin J, Horikawa Y, Tamboli P, Clague J, Wood CG and Wu X: Genetic variations in microRNA-related genes are associated with survival and recurrence in patients with renal cell carcinoma. Carcinogenesis. 31:1805–1812. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Cancer Genome Atlas Research Network, . Comprehensive molecular characterization of clear cell renal cell carcinoma. Nature. 499:43–49. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Edge S, Byrd DR, Compton CC, Fritz AG, Greene F and Trotti A: AJCC cancer staging handbook: From the AJCC cancer staging manual. Springer; New York: 2010

17 

Schmittgen TD and Livak KJ: Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3:1101–1108. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Gurtner A, Falcone E, Garibaldi F and Piaggio G: Dysregulation of microRNA biogenesis in cancer: The impact of mutant p53 on Drosha complex activity. J Exp Clin Cancer Res. 35:452016. View Article : Google Scholar : PubMed/NCBI

19 

Chen X, Li WF, Wu X, Zhang HC, Chen L, Zhang PY, Liu LY, Ma D, Chen T, Zhou L, et al: Dicer regulates non-homologous end joining and is associated with chemosensitivity in colon cancer patients. Carcinogenesis. 38:873–882. 2017. View Article : Google Scholar : PubMed/NCBI

20 

To SKY, Mak ASC, Eva Fung YM, Che CM, Li SS, Deng W, Ru B, Zhang J and Wong AST: β-catenin downregulates Dicer to promote ovarian cancer metastasis. Oncogene. 36:5927–5938. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Yu Z, Wang L, Wang C, Ju X, Wang M, Chen K, Loro E, Li Z, Zhang Y, Wu K, et al: Cyclin D1 induction of Dicer governs microRNA processing and expression in breast cancer. Nat Commun. 4:28122013. View Article : Google Scholar : PubMed/NCBI

22 

Diaz-Garcia CV, Agudo-López A, Pérez C, López-Martín JA, Rodríguez-Peralto JL, de Castro J, Cortijo A, Martínez-Villanueva M, Iglesias L, García-Carbonero R, et al: DICER1, DROSHA and miRNAs in patients with non-small cell lung cancer: Implications for outcomes and histologic classification. Carcinogenesis. 34:1031–1038. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Kim B, Lee JH, Park JW, Kwon TK, Baek SK, Hwang I and Kim S: An essential microRNA maturing microprocessor complex component DGCR8 is up-regulated in colorectal carcinomas. Clin Exp Med. 14:331–336. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Passon N, Gerometta A, Puppin C, Lavarone E, Puglisi F, Tell G, Di Loreto C and Damante G: Expression of Dicer and Drosha in triple-negative breast cancer. J Clin Pathol. 65:320–326. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Kim J, Park WJ, Jeong KJ, Kang SH, Kwon SY, Kim S and Park JW: Racial differences in expression levels of miRNA machinery-related genes, Dicer, Drosha, DGCR8, and AGO2, in Asian Korean papillary thyroid carcinoma and comparative validation using the cancer genome atlas. Int J Genomics. 2017:57897692017. View Article : Google Scholar : PubMed/NCBI

26 

Vaksman O, Hetland TE, Trope' CG, Reich R and Davidson B: Argonaute, Dicer, and Drosha are up-regulated along tumor progression in serous ovarian carcinoma. Hum Pathol. 43:2062–2069. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Lin RJ, Lin YC, Chen J, Kuo HH, Chen YY, Diccianni MB, London WB, Chang CH and Yu AL: microRNA signature and expression of Dicer and Drosha can predict prognosis and delineate risk groups in neuroblastoma. Cancer Res. 70:7841–7850. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Stratmann J, Wang CJ, Gnosa S, Wallin A, Hinselwood D, Sun XF and Zhang H: Dicer and miRNA in relation to clinicopathological variables in colorectal cancer patients. BMC Cancer. 11:3452011. View Article : Google Scholar : PubMed/NCBI

29 

Shu GS, Yang ZL and Liu DC: Immunohistochemical study of Dicer and Drosha expression in the benign and malignant lesions of gallbladder and their clinicopathological significances. Pathol Res Pract. 208:392–397. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lee SS, Min H, Ha JY, Kim BH, Choi MS and Kim S: Dysregulation of the miRNA biogenesis components DICER1, DROSHA, DGCR8 and AGO2 in clear cell renal cell carcinoma in both a Korean cohort and the cancer genome atlas kidney clear cell carcinoma cohort. Oncol Lett 18: 4337-4345, 2019.
APA
Lee, S.S., Min, H., Ha, J.Y., Kim, B.H., Choi, M.S., & Kim, S. (2019). Dysregulation of the miRNA biogenesis components DICER1, DROSHA, DGCR8 and AGO2 in clear cell renal cell carcinoma in both a Korean cohort and the cancer genome atlas kidney clear cell carcinoma cohort. Oncology Letters, 18, 4337-4345. https://doi.org/10.3892/ol.2019.10759
MLA
Lee, S. S., Min, H., Ha, J. Y., Kim, B. H., Choi, M. S., Kim, S."Dysregulation of the miRNA biogenesis components DICER1, DROSHA, DGCR8 and AGO2 in clear cell renal cell carcinoma in both a Korean cohort and the cancer genome atlas kidney clear cell carcinoma cohort". Oncology Letters 18.4 (2019): 4337-4345.
Chicago
Lee, S. S., Min, H., Ha, J. Y., Kim, B. H., Choi, M. S., Kim, S."Dysregulation of the miRNA biogenesis components DICER1, DROSHA, DGCR8 and AGO2 in clear cell renal cell carcinoma in both a Korean cohort and the cancer genome atlas kidney clear cell carcinoma cohort". Oncology Letters 18, no. 4 (2019): 4337-4345. https://doi.org/10.3892/ol.2019.10759
Copy and paste a formatted citation
x
Spandidos Publications style
Lee SS, Min H, Ha JY, Kim BH, Choi MS and Kim S: Dysregulation of the miRNA biogenesis components DICER1, DROSHA, DGCR8 and AGO2 in clear cell renal cell carcinoma in both a Korean cohort and the cancer genome atlas kidney clear cell carcinoma cohort. Oncol Lett 18: 4337-4345, 2019.
APA
Lee, S.S., Min, H., Ha, J.Y., Kim, B.H., Choi, M.S., & Kim, S. (2019). Dysregulation of the miRNA biogenesis components DICER1, DROSHA, DGCR8 and AGO2 in clear cell renal cell carcinoma in both a Korean cohort and the cancer genome atlas kidney clear cell carcinoma cohort. Oncology Letters, 18, 4337-4345. https://doi.org/10.3892/ol.2019.10759
MLA
Lee, S. S., Min, H., Ha, J. Y., Kim, B. H., Choi, M. S., Kim, S."Dysregulation of the miRNA biogenesis components DICER1, DROSHA, DGCR8 and AGO2 in clear cell renal cell carcinoma in both a Korean cohort and the cancer genome atlas kidney clear cell carcinoma cohort". Oncology Letters 18.4 (2019): 4337-4345.
Chicago
Lee, S. S., Min, H., Ha, J. Y., Kim, B. H., Choi, M. S., Kim, S."Dysregulation of the miRNA biogenesis components DICER1, DROSHA, DGCR8 and AGO2 in clear cell renal cell carcinoma in both a Korean cohort and the cancer genome atlas kidney clear cell carcinoma cohort". Oncology Letters 18, no. 4 (2019): 4337-4345. https://doi.org/10.3892/ol.2019.10759
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team