Open Access

Tauroursodeoxycholic acid mediates endoplasmic reticulum stress and autophagy in adrenocortical carcinoma cells

  • Authors:
    • Xuemei Huang
    • Lili Wu
    • Yaqi Kuang
    • Xin Li
    • Xiujun Deng
    • Xinghuan Liang
    • Li Li
    • Haiyan Yang
    • Zhenxing Huang
    • Decheng Lu
    • Zuojie Luo
  • View Affiliations

  • Published online on: November 5, 2019     https://doi.org/10.3892/ol.2019.11057
  • Pages: 6475-6482
  • Copyright: © Huang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Adrenocortical carcinoma (ACC) is an invasive tumor that occurs in the endocrine system. Increasing evidence has shown that endoplasmic reticulum (ER) stress and autophagy play an important role in tumor formation. Tauroursodeoxycholic acid (TUDCA) is an ER chemical chaperone that can alleviate ER stress. In the present study, TUDCA promoted the proliferation, migration and invasion of ACC SW‑13 and NCI‑H295R cells. Reverse transcription‑quantitative PCR and western blot analysis showed that the expression of glucose‑regulated protein 78, a promoter of ER stress, was decreased. The expression levels of protein kinase R (PKR)‑like ER kinase and activating transcription factor 6 were correspondingly decreased, and the downstream proteins, C/EBP homologous protein and JNK, were also decreased. The expression levels of the autophagy factor microtubule‑associated protein light chain 3‑II/I and the anti‑apoptotic factor Bcl‑2 increased following TUDCA treatment, while the expression of the pro‑apoptotic factor Bax decreased. TUDCA alleviated ER stress in ACC SW‑13 and NCI‑H295R cells and induced autophagy, thereby inhibiting ACC cell apoptosis. ER stress‑ and autophagy‑related signaling pathways are involved in the occurrence of ACC, which may provide potential therapeutic targets for ACC treatment.

Introduction

Adrenocortical carcinoma (ACC) is a rare endocrine malignancy, with an incidence rate of 1.5 to 2 cases per million people per year worldwide (1). Albeit rare, ACC is often aggressive and lethal, with 10–20% of patients surviving 5 years after diagnosis (2). To date, the main curative therapy for ACC is surgical resection of the primary tumor. However, most patients with an advanced stage of the disease have a median survival time of <12 months, even after complete tumor resection (3). Even with ostensibly complete resections, the rates of local recurrence have typically ranged from at least 19 to 34% in those patients with no residual disease after surgery (4,5). Mitotane remains the only drug approved for ACC treatment by the U.S. Food and Drug Administration and European Medicine Executive Agency (6). However, mitotane is an adjuvant therapy for patients with low to moderate risk for ACC recurrence, and its efficacy is ultimately limited by its high lipophilicity, poor pharmacokinetic properties, and dose-limiting toxicities (7). In addition, long-term radiotherapy may be used in patients at an increased risk of local recurrence (8). The high degree of malignancy, strong invasiveness, poor traditional treatment efficacy and poor prognosis of ACC have led to the exploration of targeted therapy.

A recent study has demonstrated that endoplasmic reticulum (ER) stress may play an important role in the development of cancer (9). Alterations in the homeostasis and appropriate functioning of the ER initiates a cascade of signaling events known as the ER stress response or unfolded protein response (UPR). When ER stress occurs, cancer cells in colorectal, breast and cervical cancer, adapt the UPR to alleviate the ER stress condition as a survival approach for progression (10,11). Adaptation of cancer cells to adverse conditions largely relies on the ability of a cell to perturb ER stress-associated regulatory networks and prevent ER stress-induced cell death (12,13). Autophagy is a highly conserved system that delivers misfolded proteins and damaged organelles to the lysosome for degradation, maintaining cell homeostasis (14). Li et al (15) showed that the ER stress-responsive protein kinase R-like ER kinase (PERK)-eukaryotic initiation factor-2α (eIF2α)-activating transcription factor (ATF) 4 pathway contributes to ER stress-induced autophagy. Persistent ER stress often results in the stimulation of autophagic activities (16).

Tauroursodeoxycholic acid (TUDCA) is a chemical chaperone that stabilizes protein conformation and improves the folding capacity of the ER (17). Yang et al (18) showed that TUDCA could downregulate ER stress in a dose-dependent manner using human hepatocellular carcinoma cells. Guo et al (19) found that TUDCA reversed abnormal autophagy and reduced ER stress in the liver of obese mice. Therefore, TUDCA is a promising regulator for mediating ER stress, which significantly relieves ER stress and inhibits cell apoptosis in the aforementioned cells.

The present study aimed to identify whether ER stress and autophagy are involved in the occurrence of ACC by TUDCA interventions, providing a theoretical basis for the treatment of ACC.

Materials and methods

Cell culture

The SW-13 cell line was obtained from Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (cat. no. TCHu221). The NCI-H295R cell line was obtained from the American Type Culture Collection (cat. no. ATCC® CRL-2128). Cells were grown in minimum essential medium supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin solution (Beijing Solarbio Science and Technology Co., Ltd.). Cells were cultured at 37°C in a humidified atmosphere with 5% CO2 and 95% humidity in an incubator. TUDCA was purchased from EMD Millipore. SW-13 cells were treated with 0, 100, 200, 300 or 400 µM TUDCA, and NCI-H295R cells were treated with 0, 100, 200, 400 or 600 µM TUDCA.

Cell proliferation assay

SW-13 and NCI-H295R cells were seeded in 96-well plates at a density of 1×103 cells/well and allowed to attach for 24 h. Then, the cells were treated with different concentrations of TUDCA as aforementioned. The cells were incubated at 37°C for 12, 24, 48 and 72 h. Then, cell proliferation was assessed using a Cell Counting Kit 8 (CCK8) assay (Dojindo Molecular Technologies, Inc.) according to the manufacturer's instructions. Finally, the optical density at 450 nm was detected and cell proliferation calculated. Each set of experiments was performed in triplicate.

Cell migration assay

After SW-13 and NCI-H295R cells were resuspended with trypsin (Gibco; Thermo Fisher Scientific, Inc.), 5×105 cells/well were seeded in 6-well plates and incubated in 10% serum-containing minimal essential medium (Gibco; Thermo Fisher Scientific, Inc.) at 37°C for 24 h. When the cells reached 100% confluence, scratches on the cells were made perpendicular to the well plate with a small tip. The well plates were washed once with PBS to remove the dislodged cells. Then, SW-13 and NCI-H295R cells were treated with different concentrations of TUDCA as aforementioned. The cells were cultured in serum-free minimal essential medium at 37°C. Migration was visualized at 0, 6, 12, and 24 h with an inverted light microscope (TE2000; Nikon Corporation). Migration distances were measured using ImageJ software version 1.8.0 (National Institutes of Health).

Transwell invasion assays

SW-13 and NCI-H295R cells were treated with aforementioned concentrations of TUDCA. The cells were cultured in serum-free medium for 24 h at 37°C. Then, the upper chambers were precoated with Matrigel matrix (Corning, Inc.), and cells were added to the upper chambers at a concentration of 1×105 cells per well. Next, 500 µl serum-containing medium was added to the lower chambers. After 24 h of incubation, the cells on the upper side of the filters were removed with a cotton swab, and the filters were washed with PBS. The cells were fixed in methanol for 30 min at room temperature, and nuclei were stained with 0.1% crystal violet for 15 min at room temperature. Images were captured under a light microscope, and cell counts were measured using ImageJ software version 1.8.0 (National Institutes of Health).

Reverse transcription-quantitative PCR (RT-qPCR) analysis

Total RNA was extracted from SW-13 cells cultured in different concentrations of TUDCA (0, 100, 200, 300, or 400 µM for 48 h) using RNAiso Plus reagent (Takara Biotechnology Co., Ltd.). Following RNA extraction, cDNA was synthesized using a Takara RT kit (Takara Biotechnology Co., Ltd.) at 37°C for 15 min, 85°C for 5 sec and kept at 4°C until further experimentation. qPCR amplification was conducted with SYBR-Green reagent (Takara Biotechnology Co., Ltd.) using an ABI 7500 sequencer (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the following conditions were used: Initial denaturation at 95°C for 30 sec, then 40 cycles of 95°C for 5 sec and 60°C for 34 sec. The experimental steps were carried out according to the manufacturer's instructions. The primers were designed and synthesized by Sangon Biotech Co., Ltd. (Table I). Cq values were generated using the default analysis settings. ΔCq was calculated using the following formula: (Cq gene of interest)-(CT GAPDH). ∆∆Cq was calculated using the following formula: (ΔCq treated sample)-(Cq control sample). Relative expression was calculated using the 2−ΔΔCq method as previously described (20).

Table I.

Primer sequence for reverse transcription-quantitative PCR.

Table I.

Primer sequence for reverse transcription-quantitative PCR.

Gene namePrimer sequence (5′-3′)
GAPDHF: CAGGAGGCATTGCTGATGAT
R: GAAGGCTGGGGCTCATTT
GRP78F: CAGTTGTTACTGTACCAGCCTA
R: CATTTAGGCCAGCAATAGTTCC
PERKF: CCAGTTTTGTACTCCAATTGCA
R: CAGATACAGCTGGCCTCTATAC
CHOPF: GAGAATGAAAGGAAAGTGGCAC
R: ATTCACCATTCGGTCAATCAGA
JNKF: ACACCACAGAAATCCCTAGAAG
R: CACAGCATCTGATAGAGAAGGT
ATF6F: CTGATGGCTGTTCAATACACAG
R: GATCCCTTCGAAATGACACAAC
LC3-II/IF: AGCCCGTTTCTTTCATCATAACATC
R: AAGATCTAAGCCTGTGCCATTTAC
BaxF: CGAACTGGACAGTAACATGGAG
R: CAGTTTGCTGGCAAAGTAGAAA
Bcl-2F: GACTTCGCCGAGATGTCCAG
R: GAACTCAAAGAAGGCCACAATC

[i] F, forward; R, reverse; GRP78, glucose-regulated protein 78; PERK, protein kinase R-like ER kinase; CHOP, C/EBP homologous protein; ATF6, activating transcription factor 6; LC3, microtubule-associated protein light chain 3.

Western blot analysis

SW-13 cells were treated with aforementioned concentrations of TUDCA. After 48 h, SW-13 cells were lysed with RIPA lysis buffer containing 1 mM PMSF (Beijing Solarbio Science and Technology Co., Ltd.) for 30 min then the cells were centrifuged at 14,000 × g for 10 min at 4°C, and the supernatant was collected. Subsequently, the protein concentration was determined using a BCA protein analysis kit (Beyotime Institute of Biotechnology). A total of 50 µg of total protein was separated using 10% SDS-PAGE and transferred to PVDF membranes (Sigma-Aldrich; Merck KGaA). The membranes were blocked using 5% skimmed milk at room temperature for 1 h and then incubated with primary antibodies at 4°C overnight. Next, the membranes were washed three times with TBS-Tween 20 and incubated with secondary horseradish peroxidase-conjugated antibody (dilution 1:10,000; cat. no. L3012-2; Signalway Antibody LLC) for 1 h at room temperature. The protein bands were imaged using a densitometric scanner (Bio-Rad Laboratories, Inc.) and analyzed with ImageJ software version 1.8.0 (National Institutes of Health). Antibodies against PERK (dilution 1:1,000; cat. no. 3192), JNK (dilution 1:1,000; cat. no. 9252), ATF6 (dilution 1:1,000; cat. no. 65880), C/EBP homologous protein (CHOP; dilution 1:1,000; cat. no. 2895), microtubule-associated protein light chain 3 (LC3)-II/I (dilution 1:1,000; cat. no. 2775), Bax (dilution 1:1,000; cat. no. 2772) and Bcl-2 (dilution 1:1,000; cat. no. 3498) were purchased from Cell Signaling Technology, Inc. Antibodies against glucose-regulated protein 78 (GRP78; dilution 1:1,000; cat. no. 33395) and GAPDH (dilution 1:5,000; cat. no. 21612) were purchased from Signalway Antibody LLC.

Statistical analysis

All experiments were repeated three times, and the data were analyzed using SPSS version 17.0 software (SPSS, Inc.). Graphical representation of data was prepared with GraphPad Prism version 5.0 software (GraphPad Software, Inc.). The data are expressed as the mean ± standard deviation. Differences in the data among the groups were analyzed using one-way ANOVA combined with Bonferroni's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

TUDCA promotes the proliferation, migration, and invasiveness of ACC cells

The effects of TUDCA on SW-13 and NCI-H295R cell proliferation, motility, and invasiveness were investigated. The proliferation of SW-13 and NCI-H295R cells after treatment with different concentrations of TUDCA was measured using a CCK8 assay. The CCK8 assay revealed that TUDCA promoted SW-13 and NCI-H295R cell proliferation. TUDCA at a concentration of 400 µM significantly promoted the proliferation of SW-13 cells, while 600 µM TUDCA significantly promoted NCI-H295R cell proliferation (Fig. 1A and B).

Since the migration and invasion of cancer cells are crucial factors responsible for cancer progression (21), the effect of TUDCA on SW-13 and NCI-H295R cell migration and invasion was examined. The wound healing assays revealed that SW-13 and NCI-H295R cells had different migration potentials after 24 h of intervention with different concentrations of TUDCA. The group treated with 400 µM TUDCA induced the highest percentage of SW-13 cell migration, while 600 µM TUDCA induced the highest percentage of NCI-H295R cell migration (Fig. 2A-D). The Transwell assay confirmed that the invasiveness of SW-13 cells was significantly increased in the 400 µM TUDCA group compared with that in the 0 µM TUDCA group, and the invasiveness of NCI-H295R cells was significantly increased in the 600 µM TUDCA group compared with that in the 0 µM TUDCA group (Fig. 3A-D).

TUDCA alleviates the influence of ER stress in SW-13 cells

In the present study, whether TUDCA regulated the ER stress pathway in SW-13 cells was investigated using RT-qPCR and western blot analyses. The mRNA expression of the ER stress promoter GRP78 was significantly decreased in the 400 µM TUDCA group. In accordance with the changes in mRNA expression, western blot analysis showed that the expression of GRP78 protein was also markedly decreased in the 400 µM TUDCA group compared with that in the 0 µM TUDCA group after 48 h. Decreased expression of GRP78 alleviated ER stress in SW-13 cells. In addition, the expression of ER-related factors was downregulated with TUDCA treatment; PERK and ATF6 mRNA and protein expression levels were significantly reduced in the 400 µM TUDCA group compared with those in the 0 µM TUDCA group. The mRNA and protein expression of other downstream factors, CHOP and JNK, also correspondingly decreased with TUDCA treatment. There were no significant differences in the mRNA levels of ER stress-related factors between the 100 µM TUDCA group and the 0 µM TUDCA group. Therefore, the protein levels of 100 µM TUDCA group was not compared using western blot analysis (Fig. 4A-C).

TUDCA induces autophagy and inhibits apoptosis in SW-13 cells

LC3 serves as one of the most important markers of autophagy. When autophagy occurs, the LC3-I cytosolic form is converted to the LC3-II lipid-conjugated membrane-bound form (22). Our results showed that LC3-II/I expression increased in a concentration-dependent manner after TUDCA intervention, and LC3-II/I mRNA and protein expression in the 400 µM TUDCA group was significantly higher compared with that in the 0 µM TUDCA group (Fig. 5A-C). In addition, TUDCA alleviated ER stress and induced autophagy, thereby inhibiting apoptosis. In the 400 µM TUDCA group, the expression of the anti-apoptotic factor Bcl-2 was upregulated, and the mRNA and protein expression of Bcl-2 was significantly higher in the 400 µM TUDCA group compared with that in the 0 µM TUDCA group. However, the mRNA and protein expression of the pro-apoptotic factor Bax exhibited the opposite expression pattern from Bcl-2 (Fig. 6A-C).

Discussion

TUDCA is a well-known ER chaperone that alleviates ER stress (23). Activation of the UPR signaling pathway following ER stress plays an important role in tumorigenesis (24). UPR activation involves GRP78, PERK, inositol-requiring protein 1α (IRE1α), and ATF6 (25). The competitive binding of GRP78 with the hydrophobic surfaces of misfolded proteins following ER stress releases these transducers to induce UPR signaling. GRP78, the ER promoter, acts as a major regulator of the UPR through directly interacting with the UPR sensors, namely, PERK, IRE1α, and ATF6 (26). When TUDCA inhibited ER stress, three ER sensors were also inhibited. The dissociation of GRP78 from PERK, IRE1α, and ATF6 leads to their inhibition. Liu et al (27) administered TUDCA to salivary adenoid cystic carcinoma cell cultures 3 h before ceramide treatment. Ceramide-induced X-box binding protein 1 mRNA splicing was significantly inhibited by TUDCA pretreatment, and TUDCA inhibited ceramide-induced eIF2α phosphorylation. TUDCA alleviated ceramide-induced ER stress. Marquardt et al (28) reported that TUDCA ameliorated maladaptive ER stress signaling and reduced the expression of ATF6 and CHOP. In the present study, it was observed that TUDCA alleviates ER stress and promotes ACC cell proliferation. Thus, ER stress-related signaling pathways play a role in ACC.

Autophagy is important for the secretion of diverse proteins involved in intercellular signaling and cancer progression. Autophagic flux can be upregulated in response to stressful stimuli, such as nutritional, metabolic, oxidative, pathogenic, genotoxic, or proteotoxic stress (29). This stimulus-induced autophagy serves a cytoprotective function by helping cells adapt to stress and promoting cell survival (30,31). As one of the most important markers of autophagy, the transition of LC3 from LC3-I to LC3-II mediates key features of autophagy activation by promoting lysis, lipogenesis, and proteolysis (22). Some studies showed that the PERK-eIF2α-ATF4-CHOP pathway contributed to the ER stress-induced activation of autophagy (32,33). A study by B'Chir et al (32) showed that the LC3-II/LC3-I ratio was increased after knockout of CHOP. CHOP is a downstream indicator of the ER stress signaling pathway and a key participant in apoptosis. CHOP can activate a death program by inducing both the extrinsic and intrinsic apoptotic pathways, decreasing the expression of the anti-apoptotic protein Bcl-2 while increasing the expression of the pro-apoptotic Bax (34). The present study found that TUDCA alleviated ER stress via the PERK-ATF4-CHOP pathway and induced autophagy in ACC SW-13 cells. Meanwhile, CHOP expression was downregulated, which may inhibit ACC cell apoptosis. A previous study has shown that TUDCA inhibited ER stress in pancreatic cancer cells and blocked the pachymic acid-induced apoptosis of pancreatic cancer (35). These results provide evidence demonstrating that TUDCA alleviated ER stress and induced autophagy in ACC cells, thereby inhibiting the apoptosis of ACC cells.

In conclusion, TUDCA induced autophagy of ACC SW-13 cells and inhibited apoptosis of ACC SW-13 cells after alleviating ER stress of ACC SW-13 cells. ER stress- and autophagy-related signaling pathways are involved in the occurrence of ACC, which may provide potential therapeutic targets for ACC treatment. There is a complex interplay between ER stress and autophagy in ACC. Therefore, an ER stress inducer such as thapsigargin will be used in in vitro and in vivo experiments with ACC in future studies.

Acknowledgements

Not applicable.

Funding

This study was supported by the National Natural Science Foundation of China (grant no. 81060220), the Innovation Project of Guangxi Graduate Education (grant no. YCBZ2018037), and the Guangxi Medical and Health Self-financing Project (grant no. Z20180636).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

XH, DL and ZL designed the study. XH, LW, YK, XL, XD, XHL, LL, HY, ZH, DL and ZL conducted the study and analyzed the data. XH wrote the manuscript, and ZL revised the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

ACC

adrenocortical carcinoma

ER

endoplasmic reticulum

TUDCA

tauroursodeoxycholic acid

UPR

unfolded protein response

PERK

protein kinase R-like ER kinase

eIF2α

eukaryotic initiation factor-2α

ATF4

activating transcription factor 4

GRP78

glucose-regulated protein 78

IRE1α

inositol-requiring protein 1α

References

1 

Xie C, Tanakchi S, Raygada M, Davis JL and Del Rivero J: Case report of an adrenocortical carcinoma associated with germline CHEK2 mutation. J Endocr Soc. 3:284–290. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Xiao H, Xu D, Chen P, Zeng G, Wang X and Zhang X: Identification of five genes as a potential biomarker for predicting progress and prognosis in adrenocortical carcinoma. J Cancer. 9:4484–4495. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Li Y, Bian X, Ouyang J, Wei S, He M and Luo Z: Nomograms to predict overall survival and cancer-specific survival in patients with adrenocortical carcinoma. Cancer Manag Res. 10:6949–6959. 2018. View Article : Google Scholar : PubMed/NCBI

4 

Else T, Kim AC, Sabolch A, Raymond VM, Kandathil A, Caoili EM, Jolly S, Miller BS, Giordano TJ and Hammer GD: Adrenocortical carcinoma. Endocr Rev. 35:282–326. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Gonzalez RJ, Tamm EP, Ng C, Phan AT, Vassilopoulou-Sellin R, Perrier ND, Evans DB and Lee JE: Response to mitotane predicts outcome in patients with recurrent adrenal cortical carcinoma. Surgery. 142:867–875. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Schteingart DE, Doherty GM, Gauger PG, Giordano TJ, Hammer GD, Korobkin M and Worden FP: Management of patients with adrenal cancer: Recommendations of an international consensus conference. Endocrine-Related Cancer. 12:667–680. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Mohan DR, Lerario AM and Hammer GD: Therapeutic targets for adrenocortical carcinoma in the genomics era. J Endocr Soc. 2:1259–1274. 2018. View Article : Google Scholar : PubMed/NCBI

8 

Baudin E; Endocrine Tumor Board of Gustave R, : Adrenocortical carcinoma. Endocrinol Metab Clin North Am. 44:411–434. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Teng Y, Zhao H, Gao L, Zhang W, Shull AY and Shay C: FGF19 protects hepatocellular carcinoma cells against endoplasmic reticulum stress via activation of FGFR4- GSK3β-Nrf2 Signaling. Cancer Res. 77:6215–6225. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Kim C and Kim B: Anti-cancer natural products and their bioactive compounds inducing ER stress-mediated apoptosis: A review. Nutrients. 10(pii): E10212018. View Article : Google Scholar : PubMed/NCBI

11 

Limonta P, Moretti RM, Marzagalli M, Fontana F, Raimondi M and Montagnani Marelli M: Role of endoplasmic reticulum stress in the anticancer activity of natural compounds. Int J Mol Sci. 20(pii): E9612019. View Article : Google Scholar : PubMed/NCBI

12 

Wang M, Law ME, Castellano RK and Law BK: The unfolded protein response as a target for anticancer therapeutics. Crit Rev Oncol Hematol. 127:66–79. 2018. View Article : Google Scholar : PubMed/NCBI

13 

Moon HW, Han HG and Jeon YJ: Protein quality control in the endoplasmic reticulum and cancer. Int J Mol Sci. 19(pii): E30202018. View Article : Google Scholar : PubMed/NCBI

14 

Zhou F, Yang X, Zhao H, Liu Y, Feng Y, An R, Lv X, Li J and Chen B: Down-regulation of OGT promotes cisplatin resistance by inducing autophagy in ovarian cancer. Theranostics. 8:5200–5212. 2018. View Article : Google Scholar : PubMed/NCBI

15 

Li S, Guo L, Qian P, Zhao Y, Liu A, Ji F, Chen L, Wu X and Qian G: Lipopolysaccharide induces autophagic cell death through the PERK-dependent branch of the unfolded protein response in human alveolar epithelial A549 cells. Cell Physiol Biochem. 36:2403–2417. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Luchetti F, Crinelli R, Cesarini E, Canonico B, Guidi L, Zerbinati C, Di Sario G, Zamai L, Magnani M, Papa S and Iuliano L: Endothelial cells, endoplasmic reticulum stress and oxysterols. Redox Biol. 13:581–587. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Chen Y, Liu CP, Xu KF, Mao XD, Lu YB, Fang L, Yang JW and Liu C: Effect of taurine-conjugated ursodeoxycholic acid on endoplasmic reticulum stress and apoptosis induced by advanced glycation end products in cultured mouse podocytes. Am J Nephrol. 28:1014–1022. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Yang Y, Tang X, Hao F, Ma Z, Wang Y, Wang L and Gao Y: Bavachin induces apoptosis through mitochondrial regulated ER stress pathway in HepG2 cells. Biol Pharm Bull. 41:198–207. 2018. View Article : Google Scholar : PubMed/NCBI

19 

Guo Q, Shi Q, Li H, Liu J, Wu S, Sun H and Zhou B: Glycolipid metabolism disorder in the liver of obese mice is improved by TUDCA via the restoration of defective hepatic autophagy. Int J Endocrinol. 2015:6879382015. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Li J, Wang Y, Ge J, Li W, Yin L, Zhao Z, Liu S, Qin H, Yang J, Wang L, et al: Doublecortin-like kinase 1 (DCLK1) regulates B cell-specific moloney murine leukemia virus insertion site 1 (Bmi-1) and is associated with metastasis and prognosis in pancreatic cancer. Cell Physiol Biochem. 51:262–277. 2018. View Article : Google Scholar : PubMed/NCBI

22 

Rahman FU, Ali A, Duong HQ, Khan IU, Bhatti MZ, Li ZT, Wang H and Zhang DW: ONS-donor ligand based Pt(II) complexes display extremely high anticancer potency through autophagic cell death pathway. Eur J Med Chem. 164:546–561. 2019. View Article : Google Scholar : PubMed/NCBI

23 

Vandewynckel YP, Laukens D, Devisscher L, Paridaens A, Bogaerts E, Verhelst X, Van den Bussche A, Raevens S, Van Steenkiste C, Van Troys M, et al: Tauroursodeoxycholic acid dampens oncogenic apoptosis induced by endoplasmic reticulum stress during hepatocarcinogen exposure. Oncotarget. 6:28011–28025. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Wu CH, Silvers CR, Messing EM and Lee YF: Bladder cancer extracellular vesicles drive tumorigenesis by inducing the unfolded protein response in endoplasmic reticulum of nonmalignant cells. J Biol Chem. 294:3207–3218. 2019. View Article : Google Scholar : PubMed/NCBI

25 

Luo B and Lee AS: The critical roles of endoplasmic reticulum chaperones and unfolded protein response in tumorigenesis and anticancer therapies. Oncogene. 32:805–818. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Guzel E, Arlier S, Guzeloglu-Kayisli O, Tabak MS, Ekiz T, Semerci N, Larsen K, Schatz F, Lockwood CJ and Kayisli UA: Endoplasmic reticulum stress and homeostasis in reproductive physiology and pathology. Int J Mol Sci. 18:E7922017. View Article : Google Scholar : PubMed/NCBI

27 

Liu Z, Xia Y, Li B, Xu H, Wang C, Liu Y, Li Y, Li C, Gao N and Li L: Induction of ER stress-mediated apoptosis by ceramide via disruption of ER Ca(2+) homeostasis in human adenoid cystic carcinoma cells. Cell Biosci. 4:712014. View Article : Google Scholar : PubMed/NCBI

28 

Marquardt A, Al-Dabet MM, Ghosh S, Kohli S, Manoharan J, ElWakiel A, Gadi I, Bock F, Nazir S and Wang H: Farnesoid X receptor agonism protects against diabetic tubulopathy: Potential add-on therapy for diabetic nephropathy. J Am Soc Nephrol. 28:3182–3189. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Galluzzi L, Pietrocola F, Bravo-San Pedro JM, Amaravadi RK, Baehrecke EH, Cecconi F, Codogno P, Debnath J, Gewirtz DA, Karantza V, et al: Autophagy in malignant transformation and cancer progression. EMBO J. 34:856–880. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Amaravadi R, Kimmelman AC and White E: Recent insights into the function of autophagy in cancer. Genes Dev. 30:1913–1930. 2016. View Article : Google Scholar : PubMed/NCBI

31 

Cotzomi-Ortega I, Aguilar-Alonso P, Reyes-Leyva J and Maycotte P: Autophagy and its role in protein secretion: Implications for cancer therapy. Mediators Inflamm. 2018:42315912018. View Article : Google Scholar : PubMed/NCBI

32 

B'Chir W, Chaveroux C, Carraro V, Averous J, Maurin AC, Jousse C, Muranishi Y, Parry L, Fafournoux P and Bruhat A: Dual role for CHOP in the crosstalk between autophagy and apoptosis to determine cell fate in response to amino acid deprivation. Cell Signal. 26:1385–1391. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Lei Y, Wang S, Ren B, Wang J, Chen J, Lu J, Zhan S, Fu Y, Huang L and Tan J: CHOP favors endoplasmic reticulum stress-induced apoptosis in hepatocellular carcinoma cells via inhibition of autophagy. PLoS One. 12:e01836802017. View Article : Google Scholar : PubMed/NCBI

34 

Puthalakath H, O'Reilly LA, Gunn P, Lee L, Kelly PN, Huntington ND, Hughes PD, Michalak EM, McKimm-Breschkin J, Motoyama N, et al: ER stress triggers apoptosis by activating BH3-only protein Bim. Cell. 129:1337–1349. 2007. View Article : Google Scholar : PubMed/NCBI

35 

Cheng S, Swanson K, Eliaz I, McClintick JN, Sandusky GE and Sliva D: Pachymic acid inhibits growth and induces apoptosis of pancreatic cancer in vitro and in vivo by targeting ER stress. PLoS One. 10:e01222702015. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

December-2019
Volume 18 Issue 6

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Huang X, Wu L, Kuang Y, Li X, Deng X, Liang X, Li L, Yang H, Huang Z, Lu D, Lu D, et al: Tauroursodeoxycholic acid mediates endoplasmic reticulum stress and autophagy in adrenocortical carcinoma cells. Oncol Lett 18: 6475-6482, 2019.
APA
Huang, X., Wu, L., Kuang, Y., Li, X., Deng, X., Liang, X. ... Luo, Z. (2019). Tauroursodeoxycholic acid mediates endoplasmic reticulum stress and autophagy in adrenocortical carcinoma cells. Oncology Letters, 18, 6475-6482. https://doi.org/10.3892/ol.2019.11057
MLA
Huang, X., Wu, L., Kuang, Y., Li, X., Deng, X., Liang, X., Li, L., Yang, H., Huang, Z., Lu, D., Luo, Z."Tauroursodeoxycholic acid mediates endoplasmic reticulum stress and autophagy in adrenocortical carcinoma cells". Oncology Letters 18.6 (2019): 6475-6482.
Chicago
Huang, X., Wu, L., Kuang, Y., Li, X., Deng, X., Liang, X., Li, L., Yang, H., Huang, Z., Lu, D., Luo, Z."Tauroursodeoxycholic acid mediates endoplasmic reticulum stress and autophagy in adrenocortical carcinoma cells". Oncology Letters 18, no. 6 (2019): 6475-6482. https://doi.org/10.3892/ol.2019.11057